miRTarBase - #MIRT006967


—
pre-miRNA Information
pre-miRNA mmu-mir-125a   
Genomic Coordinates chr17: 17830812 - 17830879
Description Mus musculus miR-125a stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-125a-5p
Sequence 6| UCCCUGAGACCCUUUAACCUGUGA |29
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol 4632428N05Rik
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions E14Tg2a
Location of target site 3'UTR
Original Description (Extracted from the article) ... miR-125a and miR-125b directly regulate Dies1 ex- pression in ESCs by targeting its 3'UTR. The mutation of the predicted miRNA bind- ing sequence in the Dies1 3=UTR completely abolished the responsiveness of this reporter vector to miRNA overexpression. ...

- Parisi S; Battista M; Musto A; Navarra A; et al., 2012, FASEB journal : official publication of the Federation of American Societies for Experimental Biology.

Article - Parisi S; Battista M; Musto A; Navarra A; et al.
- FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 2012
Bone morphogenetic protein 4 (BMP4) plays an important role in maintaining embryonic stem cells (ESCs) in the undifferentiated state and in the regulation of lineage commitment. We recently identified a transmembrane protein, named Dies1, the suppression of which by RNA interference blocks mouse ESC differentiation by interfering with the BMP4 signaling. We asked whether modulation of Dies1 levels could be a physiological mechanism to regulate ESC pluripotency and/or differentiation. We demonstrated that miR-125a targets Dies1 and regulates its expression in ESCs. The overexpression of miR-125a impairs differentiation, and this effect is specifically mediated by Dies1 down-regulation and accompanied by a decrease of BMP4 signaling. We also found that Dies1 is associated with BMP4 receptor complex and that BMP4 activates the transcription of miR-125a gene. Therefore, a feedback loop exists that sets ESC sensitivity to BMP4. The analysis of this regulatory mechanism revealed that miR-125a overexpression and the consequent inhibition of the BMP4 signaling arrest the cells in the epiblast stem cell (epiSC) status, due to the concomitant activation of the Nodal/Activin pathway.
LinkOut: [PMID: 22751012]
28 mmu-miR-125a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001716 Lin28a lin-28 homolog A (C. elegans) 1 1
MIRT005597 Trim71 tripartite motif-containing 71 4 3
MIRT006310 Cbx7 chromobox 7 2 1
MIRT006967 4632428N05Rik V-set immunoregulatory receptor 2 1
MIRT054177 Ptpn18 protein tyrosine phosphatase, non-receptor type 18 2 1
MIRT054178 Ptpn7 protein tyrosine phosphatase, non-receptor type 7 2 1
MIRT054179 Ppp1ca protein phosphatase 1, catalytic subunit, alpha isoform 2 1
MIRT054180 Ppp2ca protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform 2 1
MIRT054570 Traf6 TNF receptor-associated factor 6 3 1
MIRT580227 Tspan12 tetraspanin 12 2 2
MIRT582368 Mtf1 metal response element binding transcription factor 1 2 2
MIRT582450 Mgat4a mannoside acetylglucosaminyltransferase 4, isoenzyme A 2 2
MIRT584884 Antxr2 anthrax toxin receptor 2 2 2
MIRT587193 Foxk1 forkhead box K1 2 2
MIRT588848 Snrnp40 small nuclear ribonucleoprotein 40 (U5) 2 2
MIRT591275 Lars2 leucyl-tRNA synthetase, mitochondrial 2 4
MIRT592914 Madd MAP-kinase activating death domain 2 2
MIRT594893 Il1rn interleukin 1 receptor antagonist 2 4
MIRT596427 Hif1an hypoxia-inducible factor 1, alpha subunit inhibitor 3 3
MIRT599142 Dqx1 DEAQ RNA-dependent ATPase 2 2
MIRT599717 Aph1c aph1 homolog C, gamma secretase subunit 2 2
MIRT600832 Gm14137 predicted gene 14137 2 2
MIRT604902 Jmy junction-mediating and regulatory protein 2 2
MIRT605441 Stat1 signal transducer and activator of transcription 1 2 2
MIRT606092 Wdr25 WD repeat domain 25 2 2
MIRT732537 Tnfrsf1b tumor necrosis factor receptor superfamily, member 1b 4 0
MIRT734700 VDR vitamin D receptor 2 0
MIRT734824 Sox11 SRY (sex determining region Y)-box 11 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-125a Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-125a Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice lung 20145010 2010 down-regulated
miR-125a Chaihu Shugan San NULL NULL Microarray hippocampus 23947143 2013 down-regualted
miR-125a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 down-regulated
miR-125a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 up-regulated
miR-125a Enoxacin approved 3229 Quantitative real-time PCR HEK293 cells 18641635 2008 up-regulated
miR-125a 4-hydroxynonenal NULL 5283344 Microarray human leukemic HL-60 cell 19022373 2009 up-regulated
miR-125a Valproate approved 3121 Quantitative real-time PCR CD4+, CD25- T cells 20427269 2010 down-regulated
miR-125a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-125a Enoxacin approved 3229 Northern blot HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-125a Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-125a 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-125a-5p Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-125a-5p Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
miR-125a-5p Curcumin NULL 969516 Microarray HONE1 cells 24896104 2014 down-regulated
miR-125a-5p 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-125a-5p Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-125a-5p Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-125a-5p Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-125a-5p Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-125a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Colon Cancer tissue and cell line (HT-29)

Error report submission