miRTarBase - #MIRT007054


—
pre-miRNA Information
pre-miRNA hsa-mir-195   
Genomic Coordinates chr17: 7017615 - 7017701
Description Homo sapiens miR-195 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-195-5p
Sequence 15| UAGCAGCACAGAAAUAUUGGC |35
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1311315368 2 dbSNP
rs1483556117 3 dbSNP
rs1257736738 4 dbSNP
rs1230392050 6 dbSNP
rs1354352122 9 dbSNP
rs1346604530 12 dbSNP
rs761226479 14 dbSNP
rs376953960 17 dbSNP
rs767045828 19 dbSNP
rs975705809 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BPLS91 miR-195-5p Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Peripheral blood Quantitative reverse transcription PCR
Gene Information
Gene Symbol CAB39   
Synonyms CGI-66, MO25
Description calcium binding protein 39
Transcript NM_001130849   
Other Transcripts NM_001130850 , NM_016289   
Expression
Putative miRNA Targets on CAB39
3'UTR of CAB39
(miRNA target sites are highlighted)		 
>CAB39|NM_001130849|3'UTR
   1 TCTCCAATAAACATCTATGTTAAATCCAAATTCAGCATTTGCTGTTAGCTATTCAGCATCAGGCACTCTTATTGATTCAT
  81 GAGGAACATTACTGCTAATCTGCTGTTAAGTGAACGGTTTTTCATTTTACCCTTTTGTTTTTCAGTCCAGGTTGGAGATC
 161 GTAGCTGCTGCTGCTTGCACACTAGGGCACATGTGGGCTTTCTCTTGATCTTTGTGTCATTTCAGAATTCAAAGACTGTG
 241 CTACGGGAGTTCTGAACATGGCTGGGTTCATGAAGGCAAATGTATGGATGAGAGTGTGGTTTAGGAAAGAGGGCACTGAT
 321 ATCAGATTAGACCTATGTGTTTGCACCCATCTTTGTTGGCGATCTGAGTGCAGTGTGGCAAGTGCACACCTGGCATCCCT
 401 GCGTCAGATCGCGCACCTTCAGGTCGCGCACCTTCGCTGAAGGAAGATGACGCAGAGCTTTATCTGAAATCAGAGGGGAG
 481 CTATCCAAAATGGGAGTTTGGGGGCAGCTAAAGTTGACATGCGAATAAATTGATACTGAAACTTAGCAACTTCTTAAAAG
 561 TGTAAAGAAGCCTCATAAGATCATAAGGAAAATGTATATATGCTTTTCACAGCTTTCTAGAATTTTTTGACATTTGATTT
 641 TCTTGAGACTTGTAAACCTGGATATGTTGAAGGGTATTTGTTAATTTTACTTTTCAAAGATACTTTAAAACAGTAGAGCT
 721 AGCAATGACACCTTGCATTTCATTTCAACACTGCTTCAAGGTTTCTTTTGTATATAATTCTTAGAATGCTCATTTCTTTT
 801 AAATGGTTTAATTTGTACAGCAGAGGAATGTTATTGTAGTAGTATGTAACTATTACCTAATACTGAGTTTTTGCAAAAAA
 881 CAATGAATGCTCATATGTAATTGAAATACTTCAGATCACATGAAAATGCTGATTTAACATTTAAGTATCACAGCATTAAA
 961 AGAAAAAGAAAGTAAACCAGTCCTTTGTATTCAGTTACCTAATGGGGTGCCATCAATAAGCTGCGATACAGCCCTGGAGC
1041 TCAGTCAGCCACACCTTCCTGCATCCTATTGGCCTTATTCATTTTAAATGAGTTAATGAATCTGCCAGATCTGTGAATGA
1121 TAGAGATTATGCTAAATTAATGCTGATTCTTTGTGTGTGTGGGAAATCTCTGTAGAGCACCTTTTCTTTCTTAGACTAAG
1201 TAACCCAGTACAATAGTTGTGAACTGAATAATTAAAACTTTGGCTTCTCTTAGGAAAAGACGACTTCCTAGTCATAGGTG
1281 TCCTATGGGGAAATTTATTTTTTTTAATGTCCTGTTCCTTAATGCTGCAAATTATCAGTATTTATAAAGTAACTGATTTT
1361 GCACCACTTTTTTGTTACTGTGACCACGGCAGAACAATGTCTTCTAGACTATATCTATGTAAAGTTATTAGAATGGTATC
1441 TGTTCATTTTAGTGATATGAAGATCACAACTAACAACTGACAAATCAGAGTTTGCCAGTTCAAATTCAGCATGGCTGCAG
1521 CTGATTAAGAAATTGATATGATTATTCTTTGCTAGCCTCTCTTACTAATGGAATTATATACTGGCCAGTAAAATGGGCCT
1601 CCCAATTGCTGTTTCAGCAGGTTTTAAACCTTCAGGAACACCAGTTAGGAAAATAGCTCCAGAAAATATAGATATATTTT
1681 ATTTTTATTAAAATGGCAGTCTACATCATAATTGGCATTTCTCAAGACTGTCTTTACCAGAATCTGTGTGAAATAAGGCA
1761 ATCTAGTCTCCTTGAAAAAAAAATCTCTTGGATGTTTAGGAAGGAAGACTTGGCCGTGATGTGGTGTCCTGGCTTTGTGG
1841 TGTAGTGCTGTGTGTATGGAGTTAGTGTAAAAACATGGATTACACCAAGTGGAAGAAACGTCTTCTTGCCAAGCTCATTC
1921 TTAGAACTTACACATCTAGAACAGCTTCCACTTTGGCAGTGAGGTCGTAGCCTTTTAGGTGGAAGAAGTGAGGGTGCAGC
2001 GTGTCAGACACAACATTCATGTTACTCTTACATTGGAATCTGAAGGTAGTTCAGACTTCGTGGGTTTTGTTTTTAAGCAA
2081 AACAATGTGAAAACATTTAAGTTTGAAATGTTGCATTTGAAGTTATGATCATTTAATATATTCATATTACCAAGACTATT
2161 ATACTGGAAGTGGTTTTTGTGTTATAAAGGTTTAATTTTACATAAGGCAGTTACTTAATGTGATTTTTAACCCTTAAAAA
2241 AGTGGAGATGTATACATTTGTTAACAATGCCATGAAAGCATTTTCTTTCTCCTAAGGAAAAGTGAATTTCTTATCAGAAT
2321 ATCTGGCTGGCCCTGTAATTTAAATTAAAATAAAATTTTGGAGAAACAGCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cggUUA-UAAAGAC-ACGACGAu 5'
             :|| :|  ||| ||||||| 
Target 5' ggaGATCGTAGCTGCTGCTGCTt 3'
 154 - 176 150.00 -13.90
2 
miRNA  3' cggUUAUAAAGAC------ACGACGAu 5'
             || ||| |||      |||||:| 
Target 5' aggAACATTACTGCTAATCTGCTGTTa 3'
 82 - 108 140.00 -9.40
3 
miRNA  3' cgGUUAUAAAGACACGACGAu 5'
            ||: |||    |||||:| 
Target 5' ttCAGCATT----TGCTGTTa 3'
 31 - 47 133.00 -9.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN25851892 52 COSMIC
COSN20979148 56 COSMIC
COSN20097949 70 COSMIC
COSN6174093 84 COSMIC
COSN26604450 85 COSMIC
COSN31531166 87 COSMIC
COSN31606836 205 COSMIC
COSN15889263 265 COSMIC
COSN21486844 414 COSMIC
COSN31567538 621 COSMIC
COSN26030767 687 COSMIC
COSN31490655 696 COSMIC
COSN31530532 797 COSMIC
COSN26477991 1025 COSMIC
COSN31566523 1110 COSMIC
COSN22275694 1226 COSMIC
COSN31545979 1306 COSMIC
COSN20794981 1415 COSMIC
COSN5129900 1489 COSMIC
COSN22765634 1560 COSMIC
COSN1830849 1667 COSMIC
COSN31596497 1957 COSMIC
COSN23833102 2008 COSMIC
COSN26553894 2008 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs777268279 1 dbSNP
rs746888930 7 dbSNP
rs140024311 8 dbSNP
rs377634027 12 dbSNP
rs745686119 14 dbSNP
rs1192241224 15 dbSNP
rs769658301 18 dbSNP
rs1426751453 20 dbSNP
rs1172893377 23 dbSNP
rs1355304918 25 dbSNP
rs1324967942 26 dbSNP
rs778966102 27 dbSNP
rs1016582778 28 dbSNP
rs748410922 31 dbSNP
rs1367164753 40 dbSNP
rs772223411 43 dbSNP
rs773485898 45 dbSNP
rs373497400 51 dbSNP
rs377713869 52 dbSNP
rs1431148624 55 dbSNP
rs570787578 56 dbSNP
rs1345626845 63 dbSNP
rs963201597 64 dbSNP
rs1406339852 67 dbSNP
rs16836174 69 dbSNP
rs756020786 69 dbSNP
rs1406164810 70 dbSNP
rs201481747 71 dbSNP
rs559978943 73 dbSNP
rs1412374529 74 dbSNP
rs1227879787 91 dbSNP
rs919967803 98 dbSNP
rs1450425766 106 dbSNP
rs143740984 112 dbSNP
rs1354097475 113 dbSNP
rs1047477673 116 dbSNP
rs192811843 117 dbSNP
rs1212386002 118 dbSNP
rs777154196 132 dbSNP
rs1278128090 144 dbSNP
rs185074030 151 dbSNP
rs1343960333 161 dbSNP
rs780571146 162 dbSNP
rs1434259666 164 dbSNP
rs1379865915 173 dbSNP
rs554040316 176 dbSNP
rs879355943 179 dbSNP
rs565906482 184 dbSNP
rs529013818 188 dbSNP
rs1170637172 189 dbSNP
rs573803733 192 dbSNP
rs115435589 199 dbSNP
rs6716468 203 dbSNP
rs940702180 205 dbSNP
rs1425970286 216 dbSNP
rs1037685596 219 dbSNP
rs899083825 228 dbSNP
rs1001421287 232 dbSNP
rs1206136366 237 dbSNP
rs1484191076 237 dbSNP
rs1055667643 238 dbSNP
rs11886295 239 dbSNP
rs1383775337 245 dbSNP
rs1035738160 246 dbSNP
rs1377723611 247 dbSNP
rs1014035004 248 dbSNP
rs959722981 250 dbSNP
rs1012624420 253 dbSNP
rs1307060604 260 dbSNP
rs115143121 272 dbSNP
rs967124073 278 dbSNP
rs1167449721 291 dbSNP
rs573687514 295 dbSNP
rs1413153360 296 dbSNP
rs1183044026 297 dbSNP
rs1473676262 301 dbSNP
rs1245099209 303 dbSNP
rs973200381 306 dbSNP
rs1488651414 313 dbSNP
rs1266996585 314 dbSNP
rs1219273416 315 dbSNP
rs754500586 320 dbSNP
rs1229659835 321 dbSNP
rs1236974074 321 dbSNP
rs775564148 323 dbSNP
rs1486276598 325 dbSNP
rs146820041 334 dbSNP
rs1387000631 336 dbSNP
rs1254445562 348 dbSNP
rs912666793 350 dbSNP
rs16827588 354 dbSNP
rs1295717768 356 dbSNP
rs199659622 361 dbSNP
rs954864063 362 dbSNP
rs1394442331 368 dbSNP
rs987629094 375 dbSNP
rs1473584348 379 dbSNP
rs907972332 385 dbSNP
rs1409866044 386 dbSNP
rs1434050270 389 dbSNP
rs1039718036 394 dbSNP
rs1189294036 398 dbSNP
rs921476522 403 dbSNP
rs1210530228 404 dbSNP
rs1268635861 404 dbSNP
rs971597941 404 dbSNP
rs1233510585 409 dbSNP
rs1332515283 409 dbSNP
rs564159598 409 dbSNP
rs189539235 411 dbSNP
rs1043586907 413 dbSNP
rs903366963 414 dbSNP
rs1459286928 417 dbSNP
rs371017109 425 dbSNP
rs546047346 426 dbSNP
rs761941126 427 dbSNP
rs937278342 428 dbSNP
rs767889730 429 dbSNP
rs895596587 430 dbSNP
rs1299088602 431 dbSNP
rs7596575 431 dbSNP
rs1453962797 434 dbSNP
rs1290290578 436 dbSNP
rs895678949 437 dbSNP
rs531727168 446 dbSNP
rs549942442 447 dbSNP
rs1246861166 450 dbSNP
rs115168898 451 dbSNP
rs115627254 452 dbSNP
rs994774369 454 dbSNP
rs1232090594 457 dbSNP
rs547927856 472 dbSNP
rs1026673165 477 dbSNP
rs1298886837 478 dbSNP
rs950566981 479 dbSNP
rs11555189 481 dbSNP
rs996413791 483 dbSNP
rs1396631610 487 dbSNP
rs1404461906 488 dbSNP
rs1170972299 497 dbSNP
rs1241333818 498 dbSNP
rs1019691992 499 dbSNP
rs1390549822 500 dbSNP
rs965434748 501 dbSNP
rs975349018 503 dbSNP
rs371828298 505 dbSNP
rs55790626 512 dbSNP
rs947614861 513 dbSNP
rs192785949 514 dbSNP
rs569894604 517 dbSNP
rs1188187321 518 dbSNP
rs537033309 519 dbSNP
rs140567636 521 dbSNP
rs150041626 522 dbSNP
rs934845513 523 dbSNP
rs962474744 524 dbSNP
rs1177169161 537 dbSNP
rs1249155659 542 dbSNP
rs1340510110 546 dbSNP
rs1419133061 548 dbSNP
rs1160714684 556 dbSNP
rs777331357 568 dbSNP
rs1057484775 571 dbSNP
rs1414379388 573 dbSNP
rs920616050 573 dbSNP
rs895536028 574 dbSNP
rs145313702 576 dbSNP
rs1408063998 587 dbSNP
rs779426505 588 dbSNP
rs1427523664 597 dbSNP
rs1395520682 598 dbSNP
rs991457420 601 dbSNP
rs898815060 603 dbSNP
rs917188672 609 dbSNP
rs949907236 612 dbSNP
rs1186664302 614 dbSNP
rs1374017476 621 dbSNP
rs531183203 624 dbSNP
rs374741327 625 dbSNP
rs79216152 629 dbSNP
rs183700989 632 dbSNP
rs1224360286 637 dbSNP
rs550897873 654 dbSNP
rs1008691756 658 dbSNP
rs1232712686 674 dbSNP
rs1265343685 675 dbSNP
rs1306150836 687 dbSNP
rs1019201673 690 dbSNP
rs1353700817 692 dbSNP
rs965403616 704 dbSNP
rs1481947724 707 dbSNP
rs1183703477 715 dbSNP
rs1388541394 716 dbSNP
rs1266173409 720 dbSNP
rs1457257838 724 dbSNP
rs567820961 726 dbSNP
rs772868230 728 dbSNP
rs749123068 742 dbSNP
rs114055615 749 dbSNP
rs1028385533 772 dbSNP
rs968685141 774 dbSNP
rs1232644866 775 dbSNP
rs1200077196 777 dbSNP
rs1009146982 787 dbSNP
rs979212362 793 dbSNP
rs962215494 805 dbSNP
rs770780267 806 dbSNP
rs1222265092 823 dbSNP
rs1372933046 827 dbSNP
rs769369645 830 dbSNP
rs1407970411 832 dbSNP
rs775157563 834 dbSNP
rs548701014 835 dbSNP
rs1027751673 836 dbSNP
rs1435810896 836 dbSNP
rs1390190733 842 dbSNP
rs1355023535 845 dbSNP
rs934916867 852 dbSNP
rs1399728891 858 dbSNP
rs1463474397 865 dbSNP
rs561900584 868 dbSNP
rs917442197 877 dbSNP
rs536370465 882 dbSNP
rs1251523044 883 dbSNP
rs950042569 884 dbSNP
rs977348337 885 dbSNP
rs948889545 890 dbSNP
rs1044156600 891 dbSNP
rs920377081 892 dbSNP
rs930323359 895 dbSNP
rs935863207 897 dbSNP
rs1054195598 898 dbSNP
rs1345464072 907 dbSNP
rs1047851438 913 dbSNP
rs759603520 914 dbSNP
rs1296819221 919 dbSNP
rs886323177 922 dbSNP
rs1435698222 932 dbSNP
rs1009240851 940 dbSNP
rs1309723876 948 dbSNP
rs529314739 948 dbSNP
rs547868357 951 dbSNP
rs559936306 963 dbSNP
rs1288894192 965 dbSNP
rs1359247392 966 dbSNP
rs1490036439 975 dbSNP
rs1335701973 982 dbSNP
rs1412465427 985 dbSNP
rs114917875 986 dbSNP
rs768505756 988 dbSNP
rs115825820 1000 dbSNP
rs1450603372 1007 dbSNP
rs1248088370 1008 dbSNP
rs1212498710 1009 dbSNP
rs1050754808 1014 dbSNP
rs890792439 1017 dbSNP
rs569909099 1025 dbSNP
rs1419968910 1026 dbSNP
rs1213919976 1028 dbSNP
rs1015161685 1035 dbSNP
rs371350699 1040 dbSNP
rs898041999 1041 dbSNP
rs1412511534 1047 dbSNP
rs1374514414 1048 dbSNP
rs1308291203 1049 dbSNP
rs536917387 1052 dbSNP
rs1372811114 1054 dbSNP
rs549272353 1056 dbSNP
rs958784846 1067 dbSNP
rs149227901 1069 dbSNP
rs1012997419 1072 dbSNP
rs774311181 1075 dbSNP
rs1257020806 1077 dbSNP
rs1206160543 1078 dbSNP
rs1343643676 1079 dbSNP
rs1024351498 1082 dbSNP
rs1249466898 1103 dbSNP
rs1289752522 1107 dbSNP
rs1322305424 1113 dbSNP
rs1364566410 1120 dbSNP
rs1230881460 1122 dbSNP
rs1354292322 1130 dbSNP
rs1288524508 1138 dbSNP
rs971410151 1141 dbSNP
rs56218749 1142 dbSNP
rs1244289716 1149 dbSNP
rs1375967276 1158 dbSNP
rs1296860577 1160 dbSNP
rs1461895270 1161 dbSNP
rs762036895 1163 dbSNP
rs1350937709 1166 dbSNP
rs1167560530 1172 dbSNP
rs1459891972 1173 dbSNP
rs1417260290 1176 dbSNP
rs977796528 1189 dbSNP
rs1473726725 1192 dbSNP
rs1248119137 1197 dbSNP
rs924570741 1202 dbSNP
rs957477743 1215 dbSNP
rs1291410081 1216 dbSNP
rs188170227 1217 dbSNP
rs989950774 1218 dbSNP
rs1268278457 1220 dbSNP
rs1214661400 1224 dbSNP
rs767695154 1225 dbSNP
rs116332899 1226 dbSNP
rs1305887479 1227 dbSNP
rs932445081 1233 dbSNP
rs1391128082 1239 dbSNP
rs1050786037 1242 dbSNP
rs1328431779 1243 dbSNP
rs1439419804 1261 dbSNP
rs1393818221 1262 dbSNP
rs181969255 1263 dbSNP
rs1455515601 1264 dbSNP
rs540003268 1272 dbSNP
rs1037079741 1273 dbSNP
rs1433497332 1274 dbSNP
rs1384517673 1275 dbSNP
rs898078603 1278 dbSNP
rs995052894 1279 dbSNP
rs1049292279 1288 dbSNP
rs894643979 1291 dbSNP
rs1013034620 1298 dbSNP
rs1210011939 1298 dbSNP
rs566506515 1298 dbSNP
rs1259719774 1299 dbSNP
rs538245619 1304 dbSNP
rs1233523393 1308 dbSNP
rs1024409014 1313 dbSNP
rs375317718 1322 dbSNP
rs1306169295 1324 dbSNP
rs971865332 1345 dbSNP
rs998871594 1350 dbSNP
rs1032056889 1351 dbSNP
rs1383948001 1352 dbSNP
rs1405896652 1358 dbSNP
rs1382902489 1362 dbSNP
rs1288442914 1366 dbSNP
rs369915312 1368 dbSNP
rs760986380 1369 dbSNP
rs576593370 1371 dbSNP
rs74356364 1372 dbSNP
rs1453607127 1375 dbSNP
rs1390657966 1376 dbSNP
rs199811907 1383 dbSNP
rs1195251767 1384 dbSNP
rs562374007 1388 dbSNP
rs574081626 1389 dbSNP
rs541479816 1393 dbSNP
rs1484060596 1405 dbSNP
rs747950008 1409 dbSNP
rs1209130291 1410 dbSNP
rs1384096394 1411 dbSNP
rs1298914832 1412 dbSNP
rs1455067728 1418 dbSNP
rs953865970 1425 dbSNP
rs1295007611 1429 dbSNP
rs1285399723 1431 dbSNP
rs986565795 1449 dbSNP
rs912330927 1455 dbSNP
rs1311313902 1459 dbSNP
rs1194815357 1471 dbSNP
rs1433802283 1484 dbSNP
rs186302098 1485 dbSNP
rs1036707708 1487 dbSNP
rs533491245 1487 dbSNP
rs1330842891 1496 dbSNP
rs143391728 1510 dbSNP
rs1201529000 1512 dbSNP
rs919576922 1513 dbSNP
rs1187693631 1518 dbSNP
rs754176880 1521 dbSNP
rs563301956 1523 dbSNP
rs1461665148 1530 dbSNP
rs1186801541 1539 dbSNP
rs77291838 1540 dbSNP
rs1198063366 1547 dbSNP
rs1338061235 1551 dbSNP
rs894702503 1556 dbSNP
rs1245549667 1561 dbSNP
rs1357458663 1568 dbSNP
rs1291594075 1569 dbSNP
rs11555190 1572 dbSNP
rs1469675638 1578 dbSNP
rs1414464875 1579 dbSNP
rs1350868198 1580 dbSNP
rs1159282775 1585 dbSNP
rs1414462717 1586 dbSNP
rs1468437194 1606 dbSNP
rs1330696751 1612 dbSNP
rs1176091212 1615 dbSNP
rs1407327989 1616 dbSNP
rs1163796404 1619 dbSNP
rs1013109969 1633 dbSNP
rs1186778420 1636 dbSNP
rs1472747402 1637 dbSNP
rs1184374704 1643 dbSNP
rs1327400040 1644 dbSNP
rs1436452365 1645 dbSNP
rs1046280143 1646 dbSNP
rs1250356314 1652 dbSNP
rs907293901 1656 dbSNP
rs1214866041 1666 dbSNP
rs1337031216 1669 dbSNP
rs548959598 1670 dbSNP
rs1232872962 1674 dbSNP
rs3087558 1677 dbSNP
rs34517847 1677 dbSNP
rs567269303 1682 dbSNP
rs1031713793 1688 dbSNP
rs1330132418 1697 dbSNP
rs558859519 1700 dbSNP
rs1439695090 1704 dbSNP
rs893110896 1710 dbSNP
rs1440816827 1713 dbSNP
rs1443099318 1719 dbSNP
rs1011480230 1728 dbSNP
rs1279692855 1739 dbSNP
rs1409641434 1745 dbSNP
rs1156456745 1746 dbSNP
rs1351875945 1761 dbSNP
rs1028207204 1762 dbSNP
rs953939249 1767 dbSNP
rs1470254912 1768 dbSNP
rs1213107390 1775 dbSNP
rs1251180960 1775 dbSNP
rs726379 1780 dbSNP
rs1286538400 1783 dbSNP
rs10006 1787 dbSNP
rs554357540 1791 dbSNP
rs1270785207 1793 dbSNP
rs1303956601 1798 dbSNP
rs1236379224 1813 dbSNP
rs1368647602 1814 dbSNP
rs765401731 1817 dbSNP
rs570934908 1819 dbSNP
rs972891167 1825 dbSNP
rs1399809462 1827 dbSNP
rs1182534306 1840 dbSNP
rs368813439 1853 dbSNP
rs372180332 1858 dbSNP
rs919625660 1858 dbSNP
rs1455881964 1865 dbSNP
rs1479551713 1870 dbSNP
rs1193575901 1876 dbSNP
rs1475746024 1878 dbSNP
rs1243985354 1883 dbSNP
rs1199007943 1884 dbSNP
rs1213893668 1885 dbSNP
rs73096708 1887 dbSNP
rs190242891 1888 dbSNP
rs1212691803 1891 dbSNP
rs756825649 1896 dbSNP
rs1396401505 1900 dbSNP
rs574263277 1901 dbSNP
rs181708102 1904 dbSNP
rs1359334457 1914 dbSNP
rs907363735 1916 dbSNP
rs1436911892 1917 dbSNP
rs1371889749 1919 dbSNP
rs1173561142 1927 dbSNP
rs1411076007 1935 dbSNP
rs745620022 1940 dbSNP
rs1421714201 1946 dbSNP
rs1402670184 1955 dbSNP
rs1184899815 1965 dbSNP
rs568551255 1967 dbSNP
rs934788200 1968 dbSNP
rs1190334757 1970 dbSNP
rs1053602442 1972 dbSNP
rs749877068 1973 dbSNP
rs1309223730 1999 dbSNP
rs1345819605 2001 dbSNP
rs1355561094 2002 dbSNP
rs576513447 2002 dbSNP
rs1235139581 2005 dbSNP
rs1011549080 2010 dbSNP
rs1302686089 2015 dbSNP
rs141969677 2016 dbSNP
rs1028238516 2019 dbSNP
rs755781501 2031 dbSNP
rs889706745 2052 dbSNP
rs186718372 2053 dbSNP
rs1276815270 2059 dbSNP
rs556088274 2061 dbSNP
rs1474375708 2062 dbSNP
rs777051971 2069 dbSNP
rs1489871355 2075 dbSNP
rs1177525093 2081 dbSNP
rs1221906565 2084 dbSNP
rs1019482142 2086 dbSNP
rs1203744706 2095 dbSNP
rs879624133 2095 dbSNP
rs961483825 2095 dbSNP
rs771872206 2097 dbSNP
rs972538176 2101 dbSNP
rs574422284 2102 dbSNP
rs1475996981 2105 dbSNP
rs1171064545 2116 dbSNP
rs541416442 2130 dbSNP
rs1296950396 2131 dbSNP
rs1422205038 2137 dbSNP
rs1446768913 2137 dbSNP
rs1302064436 2145 dbSNP
rs1459966453 2146 dbSNP
rs916242749 2149 dbSNP
rs1160129533 2159 dbSNP
rs948990117 2165 dbSNP
rs1405606823 2171 dbSNP
rs1176540465 2174 dbSNP
rs1468899268 2178 dbSNP
rs201178433 2180 dbSNP
rs1254302330 2194 dbSNP
rs1390925116 2207 dbSNP
rs879292256 2208 dbSNP
rs1467657154 2210 dbSNP
rs1240824576 2211 dbSNP
rs1260880683 2211 dbSNP
rs1319091937 2215 dbSNP
rs982085419 2221 dbSNP
rs1240012708 2224 dbSNP
rs1372305061 2226 dbSNP
rs1306295400 2229 dbSNP
rs928849837 2260 dbSNP
rs934839985 2261 dbSNP
rs1289663786 2286 dbSNP
rs58016278 2293 dbSNP
rs1455595485 2304 dbSNP
rs1315903837 2306 dbSNP
rs553373196 2314 dbSNP
rs1228919864 2315 dbSNP
rs761863845 2321 dbSNP
rs1454572811 2346 dbSNP
rs1396760974 2347 dbSNP
rs1299706211 2355 dbSNP
rs750604991 2368 dbSNP
rs995992389 2372 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Micro-RNA-195 and -451 Regulate the LKB1/AMPK Signaling Axis by Targeting MO25 ...

- Chen H; Untiveros GM; McKee LA; Perez J; Li et al., 2012, PloS one.

Article - Chen H; Untiveros GM; McKee LA; Perez J; Li et al.
- PloS one, 2012
BACKGROUND: Recently, MicroRNAs (miR) and AMP-kinase (AMPK) have emerged as prominent players in the development of cardiac hypertrophy and heart failure. We hypothesized that components of the adenosine monophosphate-activated kinase (AMPK) pathway are targeted by miRs and alter AMPK signaling during pathological cardiac stress. METHODOLOGY/PRINCIPAL FINDINGS: Using a mouse model of hypertrophic cardiomyopathy (HCM), we demonstrated early elevation of miR-195 and miR-451 in HCM hearts, which targets MO25, a central component of the MO25/STRAD/LKB1 complex that acts as an upstream kinase for AMPK. We show functional targeting of MO25 by miR-195 and -451. Further in vitro interrogation of MO25 as a functional target validated this hypothesis where over-expression of miR-195 in C2C12 cells knocked down MO25 expression levels and downstream AMPK signaling (phosphorylation of Acetyl CoA carboxylase [ACC] and AMPK activity assay), similar to MO25 knockdown in C2C12 cells by siRNA. Parallel changes were measured in 60 day R403Q HCM male hearts that were rescued by short-term administration of AICAR, an AMPK agonist. CONCLUSIONS/SIGNIFICANCE: Elevated miR-195 targets the LKB1/AMPK signaling axis in HCM progression and implicates a functional role in HCM disease progression. MiR-195 may serve as potential therapeutics or therapeutic targets for heart disease.
LinkOut: [PMID: 22844503]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.756 5.8e-5 0.811 7.2e-6 20 Click to see details
GSE21032 Prostate cancer 0.314 1.9e-3 0.346 6.8e-4 83 Click to see details
GSE38226 Liver fibrosis 0.552 4.7e-3 0.484 1.3e-2 21 Click to see details
GSE21687 Ependynoma primary tumors 0.285 1.1e-2 0.322 4.7e-3 64 Click to see details
GSE42095 Differentiated embryonic stem cells 0.4 2.9e-2 0.251 1.2e-1 23 Click to see details
GSE14794 Lymphoblastoid cells 0.173 5.1e-2 0.190 3.6e-2 90 Click to see details
GSE21849 B cell lymphoma 0.298 5.8e-2 0.397 1.6e-2 29 Click to see details
GSE28544 Breast cancer 0.308 7.2e-2 0.360 4.2e-2 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.291 8.4e-2 0.493 7.2e-3 24 Click to see details
GSE19536 Breast cancer -0.132 9.5e-2 -0.143 7.8e-2 100 Click to see details
GSE19783 ER- ER- breast cancer -0.146 1.0e-1 -0.207 3.4e-2 79 Click to see details
GSE32688 Pancreatic cancer 0.232 1.0e-1 0.198 1.4e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.197 1.7e-1 0.215 1.5e-1 25 Click to see details
GSE19350 CNS germ cell tumors 0.27 2.0e-1 0.392 1.0e-1 12 Click to see details
GSE28260 Renal cortex and medulla 0.206 2.5e-1 0.275 1.8e-1 13 Click to see details
GSE17498 Multiple myeloma 0.096 2.8e-1 0.130 2.1e-1 40 Click to see details
GSE27834 Pluripotent stem cells -0.148 2.9e-1 -0.035 4.5e-1 16 Click to see details
GSE19783 ER+ ER+ breast cancer 0.088 3.6e-1 0.149 2.7e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.076 3.6e-1 0.033 4.4e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.087 4.1e-1 0.333 1.9e-1 9 Click to see details
GSE17306 Multiple myeloma -0.014 4.6e-1 -0.104 2.4e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
ESCA -0.706 0.01 -0.555 0.04 11 Click to see details
STAD -0.312 0.04 -0.240 0.09 32 Click to see details
BRCA -0.177 0.05 -0.139 0.1 84 Click to see details
PCPG -0.967 0.08 -0.500 0.33 3 Click to see details
PAAD 0.828 0.09 0.800 0.1 4 Click to see details
BLCA -0.303 0.11 -0.300 0.11 18 Click to see details
KIRC 0.135 0.14 0.140 0.13 68 Click to see details
LIHC -0.141 0.17 -0.166 0.13 49 Click to see details
KICH -0.189 0.18 -0.137 0.26 25 Click to see details
PRAD 0.111 0.22 0.044 0.38 50 Click to see details
CHOL -0.287 0.23 -0.450 0.11 9 Click to see details
CESC -0.746 0.23 -0.500 0.33 3 Click to see details
THCA 0.085 0.26 0.013 0.46 59 Click to see details
KIRP 0.094 0.3 0.125 0.25 32 Click to see details
LUSC 0.081 0.31 0.069 0.34 38 Click to see details
LUAD 0.096 0.38 0.112 0.36 12 Click to see details
UCEC 0.066 0.39 -0.058 0.41 19 Click to see details
HNSC -0.022 0.45 0.080 0.31 42 Click to see details
COAD -0.019 0.48 0.167 0.35 8 Click to see details
COAD -0.019 0.48 0.167 0.35 8 Click to see details
COAD -0.019 0.48 0.167 0.35 8 Click to see details
618 hsa-miR-195-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000222 WEE1 WEE1 G2 checkpoint kinase 13 8
MIRT000223 E2F3 E2F transcription factor 3 5 3
MIRT000224 CDK6 cyclin dependent kinase 6 6 4
MIRT000225 CCND1 cyclin D1 6 8
MIRT000785 BCL2L11 BCL2 like 11 2 1
MIRT000795 MECP2 methyl-CpG binding protein 2 2 1
MIRT004273 VEGFA vascular endothelial growth factor A 7 16
MIRT004390 SKI SKI proto-oncogene 4 4
MIRT004669 CCL4 C-C motif chemokine ligand 4 3 1
MIRT004937 KRT7 keratin 7 2 1
MIRT005362 BCL2 BCL2, apoptosis regulator 5 3
MIRT006077 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 3 2
MIRT006080 RUNX2 runt related transcription factor 2 3 1
MIRT006235 SLC2A3 solute carrier family 2 member 3 4 5
MIRT006245 TBCCD1 TBCC domain containing 1 3 2
MIRT006246 CCND3 cyclin D3 2 2
MIRT006252 CDK4 cyclin dependent kinase 4 2 2
MIRT006995 CDC42 cell division cycle 42 3 2
MIRT007054 CAB39 calcium binding protein 39 2 1
MIRT007169 CHUK conserved helix-loop-helix ubiquitous kinase 1 1
MIRT007170 TAB3 TGF-beta activated kinase 1 and MAP3K7 binding protein 3 1 1
MIRT007219 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT007237 CCNE1 cyclin E1 5 7
MIRT007370 BCL2L2 BCL2 like 2 2 1
MIRT044858 JAK2 Janus kinase 2 1 1
MIRT044859 CAMKV CaM kinase like vesicle associated 1 1
MIRT044860 AGER advanced glycosylation end-product specific receptor 1 1
MIRT044861 LSM11 LSM11, U7 small nuclear RNA associated 2 4
MIRT044862 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT044863 ZNF280C zinc finger protein 280C 1 1
MIRT044864 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT044865 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT044866 CAND1 cullin associated and neddylation dissociated 1 1 1
MIRT044867 COPB1 coatomer protein complex subunit beta 1 1 1
MIRT044868 RPL10 ribosomal protein L10 1 1
MIRT044869 TMC6 transmembrane channel like 6 1 1
MIRT044870 TPI1 triosephosphate isomerase 1 1 1
MIRT044871 SH3BGRL2 SH3 domain binding glutamate rich protein like 2 1 1
MIRT044872 AGO1 argonaute 1, RISC catalytic component 1 1
MIRT053194 DICER1 dicer 1, ribonuclease III 3 2
MIRT053228 FASN fatty acid synthase 5 5
MIRT053467 ARL2 ADP ribosylation factor like GTPase 2 4 1
MIRT054417 BIRC5 baculoviral IAP repeat containing 5 2 1
MIRT054418 WNT7A Wnt family member 7A 2 1
MIRT054890 MYB MYB proto-oncogene, transcription factor 3 1
MIRT054904 ATG14 autophagy related 14 4 3
MIRT055424 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 11
MIRT055817 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT057517 CEP55 centrosomal protein 55 2 8
MIRT057735 ZDHHC16 zinc finger DHHC-type containing 16 2 2
MIRT057909 STXBP3 syntaxin binding protein 3 1 1
MIRT061007 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT061249 AMOTL1 angiomotin like 1 2 12
MIRT061531 BTG2 BTG anti-proliferation factor 2 1 1
MIRT063399 ETNK1 ethanolamine kinase 1 1 1
MIRT064688 CCND2 cyclin D2 2 4
MIRT065716 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT066296 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT066314 USP15 ubiquitin specific peptidase 15 2 2
MIRT068658 AKAP11 A-kinase anchoring protein 11 1 1
MIRT071211 FCF1 FCF1, rRNA-processing protein 2 2
MIRT072825 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 5
MIRT074533 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT075254 SNTB2 syntrophin beta 2 2 4
MIRT075277 VPS4A vacuolar protein sorting 4 homolog A 2 8
MIRT075896 C16ORF72 chromosome 16 open reading frame 72 2 7
MIRT076795 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT077785 MINK1 misshapen like kinase 1 1 1
MIRT078285 RPS6KB1 ribosomal protein S6 kinase B1 5 3
MIRT079658 NAPG NSF attachment protein gamma 2 12
MIRT080014 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 2 4
MIRT082988 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083269 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT084465 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT085217 CCNT2 cyclin T2 1 1
MIRT086012 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087426 ZNRF3 zinc and ring finger 3 2 2
MIRT087557 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT088106 SEPT2 septin 2 1 1
MIRT089111 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT089211 ACTR2 ARP2 actin related protein 2 homolog 2 3
MIRT090450 CDV3 CDV3 homolog 1 1
MIRT090691 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT091673 RARB retinoic acid receptor beta 2 6
MIRT092195 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 1 1
MIRT092213 BHLHE40 basic helix-loop-helix family member e40 1 1
MIRT093687 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT095434 PURA purine rich element binding protein A 1 1
MIRT096238 CANX calnexin 2 2
MIRT098830 PCMT1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 1
MIRT100210 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100368 HSPA1B heat shock protein family A (Hsp70) member 1B 2 7
MIRT100571 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT100899 CD2AP CD2 associated protein 2 2
MIRT102439 CALU calumenin 2 3
MIRT102635 UBN2 ubinuclein 2 2 11
MIRT102973 EN2 engrailed homeobox 2 2 6
MIRT103096 MAFK MAF bZIP transcription factor K 2 5
MIRT103858 FOXK1 forkhead box K1 2 3
MIRT104019 USP42 ubiquitin specific peptidase 42 2 6
MIRT104235 DMTF1 cyclin D binding myb like transcription factor 1 2 3
MIRT106297 ZFHX4 zinc finger homeobox 4 2 6
MIRT106736 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 3
MIRT107220 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT107688 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT108985 SLC9A6 solute carrier family 9 member A6 1 1
MIRT109244 ZNF275 zinc finger protein 275 2 2
MIRT110056 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 7
MIRT112974 LUZP1 leucine zipper protein 1 2 6
MIRT114927 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117659 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT120683 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT125925 PDCD4 programmed cell death 4 1 1
MIRT127735 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 3
MIRT128805 UBE4A ubiquitination factor E4A 1 1
MIRT129059 ARCN1 archain 1 1 1
MIRT130383 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT131102 TMEM138 transmembrane protein 138 1 1
MIRT132746 RASSF5 Ras association domain family member 5 1 1
MIRT132836 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT133339 BCL7A BCL tumor suppressor 7A 1 1
MIRT137521 RCOR1 REST corepressor 1 1 1
MIRT140151 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT140827 SMAD3 SMAD family member 3 1 1
MIRT141246 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141285 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT142244 DCTN5 dynactin subunit 5 2 9
MIRT144030 PSKH1 protein serine kinase H1 1 1
MIRT145386 ANKRD13B ankyrin repeat domain 13B 1 1
MIRT146023 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT146359 PNPO pyridoxamine 5'-phosphate oxidase 1 1
MIRT146502 SNX11 sorting nexin 11 1 1
MIRT148310 RNF138 ring finger protein 138 1 1
MIRT150358 IER2 immediate early response 2 1 1
MIRT152285 TNFSF9 TNF superfamily member 9 2 3
MIRT152512 ENTPD6 ectonucleoside triphosphate diphosphohydrolase 6 (putative) 1 1
MIRT152753 KIF3B kinesin family member 3B 1 1
MIRT152932 NOL4L nucleolar protein 4 like 2 3
MIRT154051 RASSF2 Ras association domain family member 2 2 2
MIRT154403 CDS2 CDP-diacylglycerol synthase 2 1 1
MIRT156463 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT158529 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT159005 EPT1 selenoprotein I 1 1
MIRT159592 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT160173 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT163261 PRKCD protein kinase C delta 1 1
MIRT164271 CPEB2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT164961 TADA2B transcriptional adaptor 2B 1 1
MIRT165180 GRAMD3 GRAM domain containing 2B 2 3
MIRT165896 CREBRF CREB3 regulatory factor 2 3
MIRT168591 HMGA1 high mobility group AT-hook 1 3 2
MIRT168685 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT169070 IRF4 interferon regulatory factor 4 1 1
MIRT170158 KLHDC10 kelch domain containing 10 1 1
MIRT170740 UBE3C ubiquitin protein ligase E3C 1 1
MIRT171604 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT172819 HMBOX1 homeobox containing 1 1 1
MIRT174792 RNF38 ring finger protein 38 1 1
MIRT175236 PSAT1 phosphoserine aminotransferase 1 2 7
MIRT175527 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT179012 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT180911 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT186374 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT189763 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT189964 AGO4 argonaute 4, RISC catalytic component 3 2
MIRT190187 GPR180 G protein-coupled receptor 180 2 6
MIRT191457 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT191628 SLC39A9 solute carrier family 39 member 9 2 6
MIRT194241 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT194907 RBBP6 RB binding protein 6, ubiquitin ligase 2 8
MIRT196278 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT196455 TAOK1 TAO kinase 1 2 2
MIRT201458 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204596 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204627 MOB4 MOB family member 4, phocein 2 8
MIRT204743 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206022 NUP50 nucleoporin 50 2 7
MIRT211200 FGF2 fibroblast growth factor 2 5 4
MIRT211316 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 4
MIRT212610 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT217747 TBPL1 TATA-box binding protein like 1 2 3
MIRT223692 FZD6 frizzled class receptor 6 2 6
MIRT224968 BAG4 BCL2 associated athanogene 4 2 2
MIRT229349 ZNF449 zinc finger protein 449 2 2
MIRT229863 YIPF6 Yip1 domain family member 6 2 2
MIRT230122 DDX3Y DEAD-box helicase 3, Y-linked 1 1
MIRT234345 MSL1 male specific lethal 1 homolog 2 8
MIRT245006 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT246940 PRRC2C proline rich coiled-coil 2C 1 1
MIRT247239 ELK4 ELK4, ETS transcription factor 2 4
MIRT247370 GABARAPL1 GABA type A receptor associated protein like 1 2 6
MIRT248555 PDIK1L PDLIM1 interacting kinase 1 like 1 1
MIRT248768 ATXN7L3B ataxin 7 like 3B 2 4
MIRT249452 ZNF691 zinc finger protein 691 2 4
MIRT251494 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT255337 SRPRB SRP receptor beta subunit 2 5
MIRT256310 CDC42SE2 CDC42 small effector 2 2 2
MIRT258413 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 3
MIRT265058 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT265078 CHEK1 checkpoint kinase 1 5 4
MIRT267256 TMEM109 transmembrane protein 109 1 1
MIRT267531 C1ORF226 chromosome 1 open reading frame 226 2 2
MIRT270456 SIRT4 sirtuin 4 1 1
MIRT270555 SETD1B SET domain containing 1B 2 2
MIRT273668 HOXC8 homeobox C8 2 2
MIRT274744 RAB3IP RAB3A interacting protein 2 2
MIRT277508 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT282537 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT286970 MLLT6 MLLT6, PHD finger containing 1 1
MIRT289633 CBX2 chromobox 2 2 2
MIRT294286 ZFP28 ZFP28 zinc finger protein 2 2
MIRT295814 CHMP4B charged multivesicular body protein 4B 2 2
MIRT297781 GABPA GA binding protein transcription factor alpha subunit 2 4
MIRT300108 STRADB STE20-related kinase adaptor beta 4 3
MIRT300997 MTMR3 myotubularin related protein 3 2 2
MIRT302617 CRIM1 cysteine rich transmembrane BMP regulator 1 2 6
MIRT302828 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT307144 CTDSPL CTD small phosphatase like 2 4
MIRT313678 ITGA2 integrin subunit alpha 2 2 2
MIRT314054 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT317724 PPIL1 peptidylprolyl isomerase like 1 2 7
MIRT319334 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320630 ZNRF2 zinc and ring finger 2 2 2
MIRT324841 IFT74 intraflagellar transport 74 1 1
MIRT326305 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT327966 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT367267 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT437657 ALOX12 arachidonate 12-lipoxygenase, 12S type 2 1
MIRT437658 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437659 CGNL1 cingulin like 1 2 1
MIRT437660 KIF21A kinesin family member 21A 2 1
MIRT437661 RASGEF1B RasGEF domain family member 1B 2 1
MIRT437662 TUFT1 tuftelin 1 2 1
MIRT437663 PDIA6 protein disulfide isomerase family A member 6 4 5
MIRT437664 SNX16 sorting nexin 16 4 7
MIRT437665 TRIP10 thyroid hormone receptor interactor 10 2 1
MIRT437792 CDC25A cell division cycle 25A 4 4
MIRT437793 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 3 2
MIRT438296 INSR insulin receptor 3 1
MIRT438377 ELN elastin 3 1
MIRT438609 RET ret proto-oncogene 1 1
MIRT438896 Bace1 beta-secretase 1 1 1
MIRT443814 SIDT2 SID1 transmembrane family member 2 2 2
MIRT446505 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447775 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT448444 TLL1 tolloid like 1 2 2
MIRT449187 LUC7L3 LUC7 like 3 pre-mRNA splicing factor 2 2
MIRT451836 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT453285 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT453751 CSNK1E casein kinase 1 epsilon 2 2
MIRT454967 TPM2 tropomyosin 2 2 2
MIRT456864 ZNF460 zinc finger protein 460 2 10
MIRT460221 FGFR4 fibroblast growth factor receptor 4 2 2
MIRT460435 DOCK11 dedicator of cytokinesis 11 2 2
MIRT461561 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463166 ZNF367 zinc finger protein 367 2 10
MIRT464664 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT464747 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 3
MIRT465164 TSC22D2 TSC22 domain family member 2 2 2
MIRT465567 TOB2 transducer of ERBB2, 2 2 2
MIRT465928 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT466011 TMEM189 transmembrane protein 189 2 8
MIRT466295 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT466434 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466919 STK38 serine/threonine kinase 38 2 10
MIRT466999 SSRP1 structure specific recognition protein 1 2 5
MIRT468056 SIK1 salt inducible kinase 1 2 3
MIRT468148 SH3BP4 SH3 domain binding protein 4 2 2
MIRT468678 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT469087 RNF168 ring finger protein 168 2 2
MIRT469412 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471036 PISD phosphatidylserine decarboxylase 2 10
MIRT471493 PDE4D phosphodiesterase 4D 2 4
MIRT471953 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472264 NFIC nuclear factor I C 2 2
MIRT472666 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT474317 LAMC1 laminin subunit gamma 1 2 2
MIRT474832 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT475066 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT475120 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT475536 HOXA3 homeobox A3 2 8
MIRT475717 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT475840 HDGF heparin binding growth factor 2 4
MIRT476257 GNB1 G protein subunit beta 1 2 7
MIRT476274 GNAL G protein subunit alpha L 2 6
MIRT476697 FURIN furin, paired basic amino acid cleaving enzyme 2 2
MIRT477562 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 8
MIRT477846 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478909 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT479985 CARD10 caspase recruitment domain family member 10 2 2
MIRT481180 AVL9 AVL9 cell migration associated 2 6
MIRT482115 AKT3 AKT serine/threonine kinase 3 2 4
MIRT482372 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482552 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 10
MIRT482579 ABHD2 abhydrolase domain containing 2 2 2
MIRT484775 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT485217 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT487391 C10orf54 V-set immunoregulatory receptor 2 2
MIRT492712 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494349 CASKIN1 CASK interacting protein 1 2 2
MIRT495144 ZNRF1 zinc and ring finger 1 2 2
MIRT496016 CD180 CD180 molecule 2 2
MIRT497773 KIAA0895 KIAA0895 2 2
MIRT498981 ORC4 origin recognition complex subunit 4 2 8
MIRT499453 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT499617 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT500094 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500323 ZNF622 zinc finger protein 622 2 9
MIRT500421 ZMAT3 zinc finger matrin-type 3 2 4
MIRT500577 USP53 ubiquitin specific peptidase 53 2 2
MIRT500862 SYPL1 synaptophysin like 1 2 8
MIRT500939 SRPR SRP receptor alpha subunit 2 7
MIRT500950 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501086 SMAD7 SMAD family member 7 3 9
MIRT501503 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT502037 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT502149 KIF5B kinesin family member 5B 2 9
MIRT502499 FAM122B family with sequence similarity 122B 2 8
MIRT502569 E2F7 E2F transcription factor 7 2 11
MIRT502647 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502917 CDCA4 cell division cycle associated 4 2 9
MIRT502949 CDC37L1 cell division cycle 37 like 1 2 9
MIRT503145 ATG9A autophagy related 9A 2 7
MIRT504335 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504537 ZNF620 zinc finger protein 620 2 6
MIRT504853 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT505117 YTHDC1 YTH domain containing 1 2 6
MIRT505347 TMEM245 transmembrane protein 245 2 6
MIRT505397 TMEM100 transmembrane protein 100 2 2
MIRT505503 SRSF1 serine and arginine rich splicing factor 1 2 6
MIRT505685 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT505909 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT505927 RCAN3 RCAN family member 3 2 4
MIRT506109 PPIG peptidylprolyl isomerase G 2 6
MIRT506134 PLRG1 pleiotropic regulator 1 2 4
MIRT506167 PLAG1 PLAG1 zinc finger 2 9
MIRT506193 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506489 MYO5A myosin VA 2 7
MIRT506855 KIF23 kinesin family member 23 2 7
MIRT507000 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 6
MIRT507821 CDK1 cyclin dependent kinase 1 2 6
MIRT507851 CCNE2 cyclin E2 2 6
MIRT507880 CBX6 chromobox 6 2 2
MIRT508038 AXIN2 axin 2 2 6
MIRT508642 CASK calcium/calmodulin dependent serine protein kinase 2 5
MIRT509365 DMPK DM1 protein kinase 2 11
MIRT509691 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510044 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT511844 GPATCH8 G-patch domain containing 8 2 5
MIRT512284 ARHGDIA Rho GDP dissociation inhibitor alpha 2 7
MIRT512643 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 5
MIRT513859 JARID2 jumonji and AT-rich interaction domain containing 2 2 8
MIRT514023 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 5
MIRT518092 TRIM35 tripartite motif containing 35 2 2
MIRT518531 FLCN folliculin 2 6
MIRT518995 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521204 SBNO1 strawberry notch homolog 1 2 6
MIRT521813 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522101 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 5
MIRT522776 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT537816 EFNB2 ephrin B2 2 4
MIRT539900 RPL14 ribosomal protein L14 2 4
MIRT540844 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541220 HOXA10 homeobox A10 2 2
MIRT541431 CBX4 chromobox 4 5 4
MIRT542807 PHC3 polyhomeotic homolog 3 2 3
MIRT542834 PDCD1 programmed cell death 1 2 7
MIRT543060 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT543080 APP amyloid beta precursor protein 2 2
MIRT543307 ZNF585B zinc finger protein 585B 2 2
MIRT543409 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT543526 PRSS21 protease, serine 21 2 2
MIRT543798 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT543836 GSG1 germ cell associated 1 2 2
MIRT544572 POLDIP3 DNA polymerase delta interacting protein 3 2 2
MIRT544590 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544913 CLSPN claspin 2 2
MIRT544966 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545187 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545348 CCDC83 coiled-coil domain containing 83 2 2
MIRT545683 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545956 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT545976 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT546115 USP48 ubiquitin specific peptidase 48 2 4
MIRT546606 SALL1 spalt like transcription factor 1 2 4
MIRT546618 RUNX1T1 RUNX1 translocation partner 1 2 2
MIRT546637 RTN4 reticulon 4 2 2
MIRT547064 PNISR PNN interacting serine and arginine rich protein 2 3
MIRT547129 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547232 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 4
MIRT547301 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 3
MIRT547410 MKX mohawk homeobox 2 2
MIRT547461 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547550 LRRFIP2 LRR binding FLII interacting protein 2 2 4
MIRT547665 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547701 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547971 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT547997 HCFC2 host cell factor C2 2 4
MIRT548016 GRB2 growth factor receptor bound protein 2 2 4
MIRT548221 FKBP1A FK506 binding protein 1A 2 2
MIRT548277 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548728 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548805 CLIP4 CAP-Gly domain containing linker protein family member 4 2 4
MIRT548948 CDK17 cyclin dependent kinase 17 2 3
MIRT549079 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549126 C11orf24 chromosome 11 open reading frame 24 2 4
MIRT549277 ASH1L ASH1 like histone lysine methyltransferase 2 3
MIRT549387 AMOT angiomotin 2 2
MIRT550403 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT550467 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550616 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT550824 FAM229B family with sequence similarity 229 member B 2 2
MIRT551380 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT551618 ZNF267 zinc finger protein 267 2 2
MIRT551738 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT552036 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552345 ZNF704 zinc finger protein 704 2 2
MIRT552750 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553440 TPM3 tropomyosin 3 2 2
MIRT553563 TMEM161B transmembrane protein 161B 2 2
MIRT553617 TM7SF3 transmembrane 7 superfamily member 3 2 2
MIRT553773 TAF13 TATA-box binding protein associated factor 13 2 4
MIRT553810 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554701 RNF149 ring finger protein 149 2 2
MIRT554963 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT555033 RAB23 RAB23, member RAS oncogene family 2 2
MIRT555148 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555226 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555277 PRDM4 PR/SET domain 4 2 2
MIRT555437 PPAP2B phospholipid phosphatase 3 2 2
MIRT556384 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT556854 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557282 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT557481 GPR27 G protein-coupled receptor 27 2 4
MIRT558038 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558508 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558590 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558663 CNKSR3 CNKSR family member 3 2 2
MIRT559012 CA8 carbonic anhydrase 8 2 2
MIRT559157 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559532 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT560853 OSBPL3 oxysterol binding protein like 3 2 2
MIRT561151 KRT33B keratin 33B 2 2
MIRT561401 TUBB2A tubulin beta 2A class IIa 2 2
MIRT561875 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT562028 LANCL1 LanC like 1 2 2
MIRT562202 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT562878 KIAA1456 KIAA1456 2 2
MIRT563087 SLC25A12 solute carrier family 25 member 12 2 3
MIRT563504 DLGAP3 DLG associated protein 3 2 2
MIRT563702 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT563846 SMDT1 single-pass membrane protein with aspartate rich tail 1 2 2
MIRT563897 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564333 CCNT1 cyclin T1 2 2
MIRT564479 ZNF391 zinc finger protein 391 2 2
MIRT564553 CCDC80 coiled-coil domain containing 80 2 2
MIRT564841 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT564951 XKR7 XK related 7 2 2
MIRT564988 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565043 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565396 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT566121 RASEF RAS and EF-hand domain containing 2 2
MIRT566651 NCKAP1 NCK associated protein 1 2 2
MIRT566832 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT567020 KLHL15 kelch like family member 15 2 2
MIRT567447 GNG12 G protein subunit gamma 12 2 2
MIRT567478 FZD9 frizzled class receptor 9 2 2
MIRT568022 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT568144 CCDC88C coiled-coil domain containing 88C 2 2
MIRT568471 ARMC12 armadillo repeat containing 12 2 2
MIRT568573 AHNAK2 AHNAK nucleoprotein 2 2 2
MIRT568623 ACVR2A activin A receptor type 2A 2 2
MIRT570465 TLK1 tousled like kinase 1 2 3
MIRT571120 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT571284 TTLL5 tubulin tyrosine ligase like 5 2 2
MIRT571429 RIF1 replication timing regulatory factor 1 2 2
MIRT571661 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT571829 PHF19 PHD finger protein 19 2 2
MIRT574058 PROSC pyridoxal phosphate binding protein 2 2
MIRT574204 CLEC2D C-type lectin domain family 2 member D 2 2
MIRT574596 N4BP1 NEDD4 binding protein 1 2 3
MIRT575883 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 4
MIRT575925 Dmpk dystrophia myotonica-protein kinase 2 7
MIRT576097 Pdcd1 programmed cell death 1 2 5
MIRT576597 Npepps aminopeptidase puromycin sensitive 2 2
MIRT614701 TRAK1 trafficking kinesin protein 1 2 2
MIRT616468 ADRA2B adrenoceptor alpha 2B 2 2
MIRT618897 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT619615 RNF41 ring finger protein 41 2 2
MIRT621499 GPRC5A G protein-coupled receptor class C group 5 member A 2 4
MIRT640539 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT645511 BSPRY B-box and SPRY domain containing 2 2
MIRT646596 ANKRD36 ankyrin repeat domain 36 2 2
MIRT648785 KLHL40 kelch like family member 40 2 2
MIRT655813 NOTCH2 notch 2 2 3
MIRT658794 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT659257 CUL3 cullin 3 2 2
MIRT680983 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682282 RS1 retinoschisin 1 2 2
MIRT682515 GLP2R glucagon like peptide 2 receptor 2 2
MIRT691710 FLOT2 flotillin 2 2 3
MIRT693931 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT701507 NEGR1 neuronal growth regulator 1 2 2
MIRT702093 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT702874 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT713420 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT714439 ARHGAP32 Rho GTPase activating protein 32 2 2
MIRT716433 RAB15 RAB15, member RAS oncogene family 2 2
MIRT717462 ADORA3 adenosine A3 receptor 2 2
MIRT720148 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT725128 SYNRG synergin gamma 2 2
MIRT726004 ZNF91 zinc finger protein 91 1 1
MIRT726082 ZBTB5 zinc finger and BTB domain containing 5 1 1
MIRT726125 VPS33B VPS33B, late endosome and lysosome associated 1 1
MIRT726130 CHMP3 charged multivesicular body protein 3 1 1
MIRT726141 VCL vinculin 1 1
MIRT726155 USP3 ubiquitin specific peptidase 3 1 1
MIRT726163 USP31 ubiquitin specific peptidase 31 1 1
MIRT726219 TUBB tubulin beta class I 1 1
MIRT726235 TRAM1 translocation associated membrane protein 1 1 1
MIRT726277 TMEM69 transmembrane protein 69 1 1
MIRT726285 TMEM55B phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 1 1
MIRT726304 TMEM135 transmembrane protein 135 1 1
MIRT726316 TLE4 transducin like enhancer of split 4 1 1
MIRT726319 TKTL1 transketolase like 1 1 1
MIRT726323 TIMM13 translocase of inner mitochondrial membrane 13 1 1
MIRT726335 TFB1M transcription factor B1, mitochondrial 1 1
MIRT726346 TCF3 transcription factor 3 1 1
MIRT726354 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726365 TBC1D20 TBC1 domain family member 20 1 1
MIRT726370 TBC1D14 TBC1 domain family member 14 1 1
MIRT726382 TASP1 taspase 1 1 1
MIRT726408 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT726419 STX17 syntaxin 17 1 1
MIRT726453 SRPK1 SRSF protein kinase 1 1 1
MIRT726460 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT726480 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 1 1
MIRT726504 SLC9A1 solute carrier family 9 member A1 1 1
MIRT726508 SLC7A5 solute carrier family 7 member 5 1 1
MIRT726542 SLC25A29 solute carrier family 25 member 29 1 1
MIRT726546 SLC25A22 solute carrier family 25 member 22 1 1
MIRT726675 RPS6KA3 ribosomal protein S6 kinase A3 1 1
MIRT726678 RPS5 ribosomal protein S5 1 1
MIRT726682 RPL36 ribosomal protein L36 1 1
MIRT726710 RNPS1 RNA binding protein with serine rich domain 1 1 1
MIRT726714 RNMT RNA guanine-7 methyltransferase 1 1
MIRT726717 RNH1 ribonuclease/angiogenin inhibitor 1 1 1
MIRT726754 RFWD2 ring finger and WD repeat domain 2 1 1
MIRT726760 REXO1 RNA exonuclease 1 homolog 1 1
MIRT726770 RELT RELT, TNF receptor 1 1
MIRT726786 RAP2C RAP2C, member of RAS oncogene family 4 1
MIRT726809 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT726824 RAB11FIP2 RAB11 family interacting protein 2 1 1
MIRT726851 PSMB5 proteasome subunit beta 5 1 1
MIRT726872 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726899 POU2AF1 POU class 2 associating factor 1 1 1
MIRT726908 POLE4 DNA polymerase epsilon 4, accessory subunit 1 1
MIRT726965 PGD phosphogluconate dehydrogenase 1 1
MIRT726972 PEX12 peroxisomal biogenesis factor 12 1 1
MIRT727019 PANK1 pantothenate kinase 1 1 1
MIRT727025 TM9SF2 transmembrane 9 superfamily member 2 1 1
MIRT727036 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT727065 NR2C2 nuclear receptor subfamily 2 group C member 2 1 1
MIRT727094 NCOR2 nuclear receptor corepressor 2 1 1
MIRT727135 MTMR4 myotubularin related protein 4 1 1
MIRT727151 MRPL40 mitochondrial ribosomal protein L40 1 1
MIRT727174 MLXIP MLX interacting protein 1 1
MIRT727196 MIB1 mindbomb E3 ubiquitin protein ligase 1 1 1
MIRT727220 MED11 mediator complex subunit 11 1 1
MIRT727226 MCM3AP-AS1 MCM3AP antisense RNA 1 1 1
MIRT727260 LYRM5 electron transfer flavoprotein regulatory factor 1 1 1
MIRT727265 LRRC57 leucine rich repeat containing 57 1 1
MIRT727269 LRPPRC leucine rich pentatricopeptide repeat containing 1 1
MIRT727295 LITAF lipopolysaccharide induced TNF factor 1 1
MIRT727346 KLC2 kinesin light chain 2 1 1
MIRT727375 TECPR2 tectonin beta-propeller repeat containing 2 1 1
MIRT727384 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT727423 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 1 1
MIRT727480 HYOU1 hypoxia up-regulated 1 1 1
MIRT727521 GSK3B glycogen synthase kinase 3 beta 1 1
MIRT727582 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT727603 GANAB glucosidase II alpha subunit 1 1
MIRT727616 GABARAP GABA type A receptor-associated protein 1 1
MIRT727645 FRYL FRY like transcription coactivator 1 1
MIRT727698 FAM73A mitoguardin 1 1 1
MIRT727717 AMER1 APC membrane recruitment protein 1 1 1
MIRT727812 EDC3 enhancer of mRNA decapping 3 1 1
MIRT727854 DSCR3 DSCR3 arrestin fold containing 1 1
MIRT727857 DPP8 dipeptidyl peptidase 8 1 1
MIRT727864 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT727907 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT727911 CYB561A3 cytochrome b561 family member A3 1 1
MIRT727914 CUL2 cullin 2 1 1
MIRT727922 CSDE1 cold shock domain containing E1 1 1
MIRT727934 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT727950 CPNE1 copine 1 1 1
MIRT727997 RHOV ras homolog family member V 1 1
MIRT728003 CDKN2AIPNL CDKN2A interacting protein N-terminal like 1 1
MIRT728017 CDC27 cell division cycle 27 1 1
MIRT728044 CBFA2T3 CBFA2/RUNX1 translocation partner 3 1 1
MIRT728089 C6orf106 chromosome 6 open reading frame 106 1 1
MIRT728098 C2orf42 chromosome 2 open reading frame 42 1 1
MIRT728125 LRIF1 ligand dependent nuclear receptor interacting factor 1 1 1
MIRT728129 C15orf39 chromosome 15 open reading frame 39 1 1
MIRT728192 BSG basigin (Ok blood group) 1 1
MIRT728236 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT728263 ATP13A3 ATPase 13A3 1 1
MIRT728287 ASXL1 additional sex combs like 1, transcriptional regulator 1 1
MIRT728327 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT728381 AFF4 AF4/FMR2 family member 4 1 1
MIRT728397 ACOX1 acyl-CoA oxidase 1 1 1
MIRT732257 NKD1 naked cuticle homolog 1 3 1
MIRT734040 CTBP1-AS CTBP1 antisense RNA 3 0
MIRT735246 SGK1 serum/glucocorticoid regulated kinase 1 5 0
MIRT735431 YAP1 Yes associated protein 1 8 1
MIRT736810 GPER1 G protein-coupled estrogen receptor 1 3 0
MIRT755496 FOSL1 FOS like 1, AP-1 transcription factor subunit 3 1
MIRT755897 SNHG1 small nucleolar RNA host gene 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-195 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-195 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-195 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-195 Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-195 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-195 Glucose NULL 5793 Microarray proximal tubule cell line HK-2 20067797 2010 down-regulated
miR-195 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 up-regulated
miR-195 Aidi injection NULL NULL Quantitative real-time PCR human breast cancer cells 21563499 2011 up-regulated
miR-195 Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-195 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-195 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-195 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 down-regulated
miR-195 Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-195 Celecoxib approved 2662 Microarray gastric cancer cells. 23001726 2013 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-195 Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7, T47D)
hsa-mir-195 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-195 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-195 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-195 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-195-5p (11E)-11-(3-aminopropylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 9978660 NSC724562 resistant
hsa-miR-195-5p (11E)-15,16-dimethoxy-20-methyl-11-[3-(methylamino)propylidene]-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027834 NSC727048 resistant
hsa-miR-195-5p (1R,12S)-20-[2-(dimethylamino)ethyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene-11,19-dione 45027831 NSC726770 resistant
hsa-miR-195-5p (2-azanidylcyclohexyl)azanide;tetrachloroplatinum(2+) 430475 NSC363813 resistant
hsa-miR-195-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 sensitive
hsa-miR-195-5p (2R)-2-(1H-benzimidazol-2-yl)-2-(2-chloro-6-methylpyrimidin-4-yl)acetonitrile 390694 NSC688326 resistant
hsa-miR-195-5p (3-sulfanylidene-5,6-dihydroimidazo[2,1-c][1,2,4]thiadiazol-7-yl) 2-[[4-(trifluoromethoxy)phenyl]sulfonylamino]-4,5-dihydroimidazole-1-carbodithioate 24205510 NSC736065 sensitive
hsa-miR-195-5p (3R,5R,8R,9S,10S,13R,14S,17R)-17-[(2R)-4-(4,5-dihydro-1H-imidazol-2-yl)butan-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-ol 391085 NSC689620 resistant
hsa-miR-195-5p (4aS,4bR,10bS,12aS)-2-butyl-12a-methyl-8-(2-pyrrolidin-1-ylethoxy)-4,4a,4b,5,6,10b,11,12-octahydronaphtho[2,1-f]isoquinoline-1,3-dione 383426 NSC671765 resistant
hsa-miR-195-5p (4e)-2-(2-hydroxybenzoyl)-5-methyl-4-[(3,4,5-trimethoxyphenyl)methylene]pyrazol-3-one 5467421 NSC652182 sensitive
hsa-miR-195-5p (Z)-3-amino-1-(5-amino-3-phenylpyrazol-1-yl)-3-phenylprop-2-en-1-one 21825201 NSC749518 sensitive
hsa-miR-195-5p .alpha.-chloro-n-(p-methoxyphenyl)succinimide 99724 NSC191909 resistant
hsa-miR-195-5p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 resistant
hsa-miR-195-5p [3-methoxy-2-[methyl(octadecyl)amino]propyl] 2-(trimethylazaniumyl)ethyl phosphate 131966 NSC643826 resistant
hsa-miR-195-5p [3,4,5-triacetyloxy-6-[5-[(2-methoxyphenyl)methyl]-3-phenyl-6-sulfanylidene-1,2,4-triazin-1-yl]oxan-2-yl]methyl acetate 362262 NSC625873 sensitive
hsa-miR-195-5p [4-[[4-[4-(3-azidophenothiazin-10-yl)butyl]piperazin-1-yl]methyl]phenyl]-phenylmethanone;(Z)-but-2-enedioic acid 5351430 NSC676963 resistant
hsa-miR-195-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] acetate 9555726 NSC144055 sensitive
hsa-miR-195-5p 1-(2-chloro-6-fluorophenyl)-6-methoxy-1,3-dihydro-[1,3]thiazolo[3,4-a]benzimidazole 396040 NSC701312 sensitive
hsa-miR-195-5p 1-(4,8-dioxothieno[2,3-f][1]benzothiol-2-yl)ethyl acetate 388025 NSC682450 sensitive
hsa-miR-195-5p 1-[(z)-(4-methoxyphenyl)methylideneamino]-3-naphthalen-1-ylurea 5914027 NSC680934 sensitive
hsa-miR-195-5p 1-[4-[[1,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino]butyl]-5,10-dihydroxynaphtho[2,3-f]indole-4,11-dione 406508 NSC724635 resistant
hsa-miR-195-5p 1-[phenyl(2-pyridinyl)methylene]-4-(2-methylphenyl)thiosemicarbazide 6148953 NSC668326 resistant
hsa-miR-195-5p 1-benzyl-3-[[5-(4-chlorophenyl)-7-(p-tolyl)pyrrolo[2,3-d]pyrimidin-4-yl]amino]thiourea 3001721 NSC667707 resistant
hsa-miR-195-5p 1-butan-2-yl-3-[(E)-1-(1H-imidazo[4,5-b]pyridin-2-yl)ethylideneamino]thiourea 135440008 NSC674098 resistant
hsa-miR-195-5p 1-cyclohexyl-3-[(e)-(6-methyl-2-pyridyl)methyleneamino]thiourea 9571907 NSC670782 resistant
hsa-miR-195-5p 14-[2-(dimethylamino)ethyl]-n-[3-[3-[[14-[2-(dimethylamino)ethyl]-4-methoxy-8,14,15-triazatetracyclo[7.6.1.02,7.013,16]hexadeca-1(15),2(7),3,5,9,11,13(16)-heptaene-10-carbonyl]amino]propyl-methylamino 135426710 NSC710552 resistant
hsa-miR-195-5p 15-[2-(dimethylamino)ethyl]-10-[2-(dimethylamino)ethylamino]-5-methoxy-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2(7),3,5,9,11,13(17)-hexaene-8,14,16-trione;hydrochloride 392061 NSC691851 resistant
hsa-miR-195-5p 1h-indole, 5-bromo-3-[2-(2-pyridinyl)-4-thiazolyl]- 397551 NSC705871 resistant
hsa-miR-195-5p 2-((5-methyl-3-isoxazolyl)amino)-4-((5-methyl-3-isoxazolyl)imino)-1(4h)-naphthalenone 373420 NSC649750 sensitive
hsa-miR-195-5p 2-(3-ethoxy-4-hydroxyphenyl)-3-[2-[2-(3-ethoxy-4-hydroxyphenyl)-4-oxo-1,3-thiazolidin-3-yl]-[1,3]thiazolo[5,4-f][1,3]benzothiazol-6-yl]-1,3-thiazolidin-4-one 398511 NSC708422 sensitive
hsa-miR-195-5p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 resistant
hsa-miR-195-5p 2-(4-aminobutyl)-1,4-dihydroxyanthracene-9,10-dione;hydrochloride 439019 NSC699139 resistant
hsa-miR-195-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-195-5p 2-[(z)-6-(2-fluorophenyl)hex-3-en-1,5-diynyl]aniline 24204954 NSC733691 sensitive
hsa-miR-195-5p 2-[[1-[[(1r,4s,5r,8s,9r,10s,12r,13r)-1,5,9-trimethyl-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadecan-10-yl]oxy]-3-[[(1r,4s,5r,8s,9r,10s,13r)-1,5,9-trimethyl-11,14,15,16-tetraoxatetracyclo[ 45027898 NSC735846 resistant
hsa-miR-195-5p 2-[[6-[[bis(carboxymethyl)amino]methyl]-4-[2-[4-(2-phenylethynyl)phenyl]ethynyl]pyridin-2-yl]methyl-(carboxymethyl)amino]acetic acid 369524 NSC641379 resistant
hsa-miR-195-5p 2-[2-[(z)-1-benzamido-2-(2-hydroxyphenyl)vinyl]-5-oxo-oxazolidin-4-yl]acetic acid 6477540 NSC686413 sensitive
hsa-miR-195-5p 2-[4-[5-[2,6-dimethoxy-4-[5-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1,2-oxazol-3-yl]phenoxy]pentoxy]-3-methoxyphenyl]-2,3-dihydro-1H-quinazolin-4-one 45029290 NSC746035 sensitive
hsa-miR-195-5p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-195-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-195-5p 2-hydroxy-N-[(E)-1-[6-[(E)-N-[(2-hydroxybenzoyl)amino]-C-methylcarbonimidoyl]pyridin-2-yl]ethylideneamino]benzamide 5779747 NSC617573 resistant
hsa-miR-195-5p 2-mercapto-6-(2-phenylhydrazino)-4-pyrimidinol 3005146 NSC677260 resistant
hsa-miR-195-5p 2-methyl-4-methoxy-5-piperidino-6h-furo[2,3-c]xanthen-6-one 389281 NSC685034 resistant
hsa-miR-195-5p 2-phenyl-12-amino-4h-1-oxa-7-azabenz[a]anthracen-4-one 385046 NSC675967 resistant
hsa-miR-195-5p 2-phenyl-6-((1-phenyl-1h-tetraazol-5-yl)oxy)-4h-chromen-4-one 386037 NSC677603 sensitive
hsa-miR-195-5p 2,4-diethoxyestra-1,3,5(10)trien-3,17.beta.-diol 388044 NSC682505 sensitive
hsa-miR-195-5p 2,6-bis[1-(3-ethylthioureidoimino)ethyl]pyridine 6393657 NSC668337 resistant
hsa-miR-195-5p 2,6-dipyridin-2-ylpyridine;4-methylpyridine;platinum(2+);tetrafluoroborate 24202574 NSC694500 resistant
hsa-miR-195-5p 3-(4-chlorophenyl)thieno[2,3-b]pyrrolizin-8-one 388525 NSC683509 sensitive
hsa-miR-195-5p 3-(9-amino-4-methoxy-6-methyl-7,8-dihydro-5h-[1,3]dioxolo[4,5-g]isoquinolin-5-yl)-6,7-dimethoxy-3h-2-benzofuran-1-one;hydrochloride 45028024 NSC740642 sensitive
hsa-miR-195-5p 3-[(3-chlorophenyl)methyl]-5-methyl-4-oxo-N-phenylthieno[2,3-d]pyrimidine-6-carboxamide 1191776 NSC732903 sensitive
hsa-miR-195-5p 3-[(e)-1-(2-hydroxy-4-methoxy-phenyl)ethylideneamino]-1,1-dimethyl-thiourea 135493996 NSC689547 resistant
hsa-miR-195-5p 3-methyl-4-methylsulfanyl-5-phenyl-6h-pyrazolo[3,4-c]pyrazole 135450457 NSC692021 resistant
hsa-miR-195-5p 3-N',5-N'-bis(2-hydroxybenzoyl)-2,6-dimethyl-1,4-dihydropyridine-3,5-dicarbohydrazide 377030 NSC658247 sensitive
hsa-miR-195-5p 3,4-diphenylisoxazolo[3,4-d]pyridazin-7(6h)-one 54613569 NSC749505 sensitive
hsa-miR-195-5p 3,5,12,14-tetrabutyl-7,10-dithia-8,9-diselena-3,5,12,14-tetrazatricyclo[9.3.0.02,6]tetradeca-1(11),2(6)-diene-4,13-diselone 395765 NSC700584 resistant
hsa-miR-195-5p 4-(4-fluorophenyl)-2-[8-[[4-(4-fluorophenyl)-5-propyl-1h-imidazol-2-yl]sulfanyl]octylsulfanyl]-5-propyl-1h-imidazole;methanesulfonic acid 374589 NSC652562 sensitive
hsa-miR-195-5p 4-[(4-methyl-1,2-oxazol-5-yl)amino]naphthalene-1,2-dione 384244 NSC673785 sensitive
hsa-miR-195-5p 4-[(6-chloro-4h-1,3-benzodioxin-8-yl)methylsulfanyl]pyrrolo[1,2-a]quinoxaline 331156 NSC321491 sensitive
hsa-miR-195-5p 4-[2-(11h-indolo[3,2-c]quinolin-6-ylamino)ethyl]benzene-1,2-diol 24205774 NSC736609 resistant
hsa-miR-195-5p 4-[4-(diethylamino)phenyl]-2-(4-hydroxypiperidin-1-yl)-6-(3,4,5-trimethoxyphenyl)pyridine-3-carbonitrile 60148088 NSC753601 resistant
hsa-miR-195-5p 4-amino-3,5-dichloro-n-(3-(4-(2-methoxyphenyl)-1-piperazinyl)propyl)benzamide 379857 NSC664993 resistant
hsa-miR-195-5p 4,4-dibromo-1-(3-bromo-4-methylpentyl)cyclopentene 382925 NSC670802 resistant
hsa-miR-195-5p 4,4,4-trifluoro-3-hydroxy-1-(3-hydroxy-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1h-cyclopenta[a]phenanthren-17-yl)butan-1-one NSC45236 resistant
hsa-miR-195-5p 5-[(E)-3-[4-(diethylamino)phenyl]prop-2-enylidene]-2-sulfanylidene-1,3-diazinane-4,6-dione 6376062 NSC684567 sensitive
hsa-miR-195-5p 5-[[4-[5-(4-chloroanilino)-1,3,4-thiadiazol-2-yl]anilino]methyl]-n-(4-chlorophenyl)-1,3,4-thiadiazol-2-amine NSC697140 resistant
hsa-miR-195-5p 5-benzyl-9-hydroxy-5h-indeno[1,2-b]indol-10-one 406582 NSC724794 sensitive
hsa-miR-195-5p 5-bromo-n-(2-methyl-3-oxo-1-thia-4-azaspiro[4.5]decan-4-yl)-3-phenyl-1h-indole-2-carboxamide 24205438 NSC735532 resistant
hsa-miR-195-5p 5-fluoranyl-7-nitro-quinolin-8-ol 260644 NSC92207 resistant
hsa-miR-195-5p 5-fluoro-N-(2-methyl-3-oxo-8-phenyl-1-thia-4-azaspiro[4.5]decan-4-yl)-3-phenyl-1H-indole-2-carboxamide 24205446 NSC735540 resistant
hsa-miR-195-5p 6-(11-aminoundecyl)indeno[1,2-c]isoquinoline-5,11-dione;hydrochloride 16221323 NSC740510 resistant
hsa-miR-195-5p 6-(4-acetylanilino)-9-methoxyindeno[1,2-c]quinolin-11-one 24205210 NSC734628 sensitive
hsa-miR-195-5p 6-(4-methylphenyl)-8-(4-chlorophenyl)imidazo[1,2-a]pyrazine 11336170 NSC731104 sensitive
hsa-miR-195-5p 6-(aziridin-1-yl)-7-methoxy-2,3-dihydro-1h-pyrrolo[1,2-a]benzimidazole-5,8-dione 383842 NSC672472 resistant
hsa-miR-195-5p 6-[2-[2-[2-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]ethylamino]ethyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027833 NSC726973 resistant
hsa-miR-195-5p 6-[2-[3-[2-(2,3-dimethoxy-5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)ethylamino]propylamino]ethyl]-2,3-dimethoxyindeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027895 NSC735372 resistant
hsa-miR-195-5p 6-[3-[2-[3-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)propylamino]ethylamino]propyl]indeno[1,2-c]isoquinoline-5,11-dione;2,2,2-trifluoroacetic acid 45027830 NSC726767 resistant
hsa-miR-195-5p 6-aryl alkyl fluoro quinolone derivative 135465400 NSC731099 sensitive
hsa-miR-195-5p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-195-5p 6-chloro-5-(2-piperazin-1-ylethyl)-1,3-dihydroindol-2-one 22181640 NSC762889 sensitive
hsa-miR-195-5p 6,13-bis[2-[(2,3,4-trimethoxyphenyl)methylamino]ethyl]-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone;4-methylbenzenesulfonic acid;hydrate 60147730 NSC752278 resistant
hsa-miR-195-5p 7-methoxy-5,11-dimethyl-10h-pyrido[3,4-b]carbazole 379120 NSC663334 resistant
hsa-miR-195-5p 9-[2-(2,5-dimethylpyrrol-1-yl)phenyl]-7-hydroxy-5,6-di(propan-2-yloxy)-3-oxa-1-azatricyclo[6.3.1.04,12]dodeca-4,6,8(12),10-tetraen-2-one 389261 NSC685014 resistant
hsa-miR-195-5p 9-[4-[(4,6-dimethylpyrimidin-2-yl)sulfamoyl]anilino]-n-(2-hydroxyethyl)acridine-4-carboxamide 384527 NSC674498 resistant
hsa-miR-195-5p Aklavin 264889 NSC100290 resistant
hsa-miR-195-5p Amonafide 50515 NSC308847 resistant
hsa-miR-195-5p Antineoplastic-92909 261046 NSC92909 sensitive
hsa-miR-195-5p Basic yellow k 7081 NSC13973 resistant
hsa-miR-195-5p Butanedioic acid;10-[3-(4-methylpiperazin-1-yl)propyl]-2-(trifluoromethyl)phenothiazine 5351168 NSC46061 resistant
hsa-miR-195-5p Chlorodestruxin 370710 NSC644211 resistant
hsa-miR-195-5p Cinnoline, 4-nitro-, 1-oxide 100397 NSC294846 resistant
hsa-miR-195-5p Crotoxin cd NSC636009 sensitive
hsa-miR-195-5p Deferoxamine hydrochloride 2973 NSC268993 approved resistant
hsa-miR-195-5p Destruxin b NSC236580 resistant
hsa-miR-195-5p Diaziridinone, bis(.alpha.,.alpha.-dimethylphenethyl)- 391928 NSC691608 resistant
hsa-miR-195-5p Diethyl 1,6-dihydropyrrolo[2,3-e]indole-2,7-dicarboxylate 389557 NSC685862 sensitive
hsa-miR-195-5p Diethyl(acetylamino)[(6-nitro-1h-indol-3-yl)methyl]propanedioate 249442 NSC67774 sensitive
hsa-miR-195-5p Dimethyl 12-cyclohexyl-8-oxo-1-phenyl-12-azatricyclo[7.2.1.02,7]dodeca-2,4,6,10-tetraene-10,11-dicarboxylate 394469 NSC697942 resistant
hsa-miR-195-5p Edelfosine 1392 NSC324368 resistant
hsa-miR-195-5p Emofolin sodium 135488934 NSC139490 resistant
hsa-miR-195-5p Entinostat 4261 NSC706995 resistant
hsa-miR-195-5p Ethanol, 2-[4-(2,2':6',2"-terpyridin-4'-yl)phenoxy]- 368990 NSC640499 resistant
hsa-miR-195-5p Ethyl 2-((4-(6-bromo-2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494008 NSC691085 sensitive
hsa-miR-195-5p Ethyl 4-(1,3-thiazol-2-ylcarbamoylamino)benzoate 307683 NSC205795 sensitive
hsa-miR-195-5p From combretum caffrum plant 5386397 NSC609397 sensitive
hsa-miR-195-5p Hexadecyl-(2-hydroxyethyl)-(1H-imidazol-5-ylmethyl)-methylazanium;chloride 21144688 NSC265875 resistant
hsa-miR-195-5p J-400634 385621 NSC676944 resistant
hsa-miR-195-5p J7x181m78y 395460 NSC700023 sensitive
hsa-miR-195-5p Justicidin b 122805 NSC254665 resistant
hsa-miR-195-5p L-cysteine, s-[(4-chlorophenyl)diphenylmethyl]- 275977 NSC123138 sensitive
hsa-miR-195-5p L-lys-l-p-no2phe-l-ala-l-p-no2phenh2 386384 NSC678355 resistant
hsa-miR-195-5p Lomondomycin 135426834 NSC156939 sensitive
hsa-miR-195-5p Ls-133613 365597 NSC633398 resistant
hsa-miR-195-5p Massoia lactone 39914 NSC720841 resistant
hsa-miR-195-5p Methanesulfonic acid;10-[3-[3-[(9-methoxy-5,11-dimethyl-6h-pyrido[4,3-b]carbazol-1-yl)amino]propyl-methylamino]propylamino]-1,14-diazatetracyclo[7.6.1.02,7.013,16]hexadeca-2,4,6,9,11,13(16),14-heptaen 438996 NSC695938 resistant
hsa-miR-195-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 sensitive
hsa-miR-195-5p Methyl 2-[33,34,35,36-tetrahydroxy-11,19,27-tris(2-methoxy-2-oxoethyl)-7,15,23,31-tetramethyl-3,11,19,27-tetrazapentacyclo[27.3.1.15,9.113,17.121,25]hexatriaconta-1(32),5,7,9(36),13,15,17(35),21(34),2 395595 NSC700325 resistant
hsa-miR-195-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-195-5p Miltefosin c 3599 NSC605583 resistant
hsa-miR-195-5p N'-(1-(1-hydroxy-1lambda(5)-pyridin-2-yl)ethyl)-4-(2-pyridinyl)-1-piperazinecarbothiohydrazide 3003953 NSC352741 resistant
hsa-miR-195-5p N'-[8-(4-hydroxy-3,5-dimethoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]-4-methylbenzenesulfonohydrazide 383134 NSC671175 sensitive
hsa-miR-195-5p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-2-(4-hydroxy-2-oxochromen-3-yl)-2-oxoacetamide 54693275 NSC649811 sensitive
hsa-miR-195-5p N-(3-methoxyphenethyl)-3,3,3-triphenylpropionamide 11453337 NSC730691 resistant
hsa-miR-195-5p N-[(22s)-13-methoxy-18-methylsulfanyl-19-oxo-4,11-diazapentacyclo[12.10.0.03,12.05,10.015,21]tetracosa-1,3,5,7,9,11,13,15,17,20-decaen-22-yl]acetamide 395872 NSC700913 sensitive
hsa-miR-195-5p N-[(e)-[4-(diethylamino)-2-hydroxyphenyl]methylideneamino]-2-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968272 NSC747458 resistant
hsa-miR-195-5p N-[(E)-1-(6-methylpyridin-2-yl)ethylideneamino]-3-azabicyclo[3.2.2]nonane-3-carbothioamide 5464837 NSC335789 resistant
hsa-miR-195-5p N-[(e)-1-isoquinolin-3-ylethylideneamino]-1-methylbenzimidazol-2-amine 9572093 NSC703108 resistant
hsa-miR-195-5p N-[(Z)-1-(4-oxo-3,1-benzoxazin-2-yl)-2-phenylethenyl]benzamide 5917766 NSC686428 sensitive
hsa-miR-195-5p N-[2-(1h-indol-3-yl)ethyl]-4-[[[(e)-3-(4-phenylphenyl)prop-2-enoyl]amino]methyl]benzamide 5470491 NSC702137 resistant
hsa-miR-195-5p N-[2-(dimethylamino)ethyl]-9-fluorophenazine-1-carboxamide;hydrochloride 386521 NSC678925 resistant
hsa-miR-195-5p N-[2-[[4,5-dihydroxy-2-methyl-6-(7H-purin-6-ylamino)oxan-3-yl]amino]-2-oxoethyl]-14-methylpentadecanamide 4366047 NSC268251 resistant
hsa-miR-195-5p N-[3-(dimethylamino)propyl]-9-oxo-2-thia-11,14-diazatetracyclo[8.7.0.03,8.011,15]heptadeca-1(10),3,5,7,12,14,16-heptaene-13-carboxamide 385059 NSC675988 resistant
hsa-miR-195-5p N-[8-hydroxy-7-(piperidin-1-ylmethyl)quinolin-5-yl]acetamide 279612 NSC130876 resistant
hsa-miR-195-5p N,N'-bis[(5E)-5-[(3,4-dihydroxyphenyl)methylidene]-2-(2-hydroxynaphthalen-1-yl)-4-oxo-1,3-thiazolidin-3-yl]decanediamide 5470052 NSC697192 resistant
hsa-miR-195-5p Neuro_000327 16683203 NSC643859 sensitive
hsa-miR-195-5p Neuro_000347 438571 NSC645835 resistant
hsa-miR-195-5p NSC697653 NSC697653 resistant
hsa-miR-195-5p NSC755523 NSC755523 resistant
hsa-miR-195-5p Octadecylphosphocholine 125219 NSC282880 resistant
hsa-miR-195-5p Oxin 1923 NSC2039 approved resistant
hsa-miR-195-5p P-fuchsin 11292 NSC10460 sensitive
hsa-miR-195-5p Pan (van) 6825 NSC5332 resistant
hsa-miR-195-5p Paullone analog 9 396412 NSC702378 resistant
hsa-miR-195-5p Perifosine 148177 NSC639966 resistant
hsa-miR-195-5p Proflavine hcl 197873 NSC605756 resistant
hsa-miR-195-5p Questiomycin a 72725 NSC94945 sensitive
hsa-miR-195-5p Replaced cas registry number(s): 66835-31-2 312122 NSC220334 sensitive
hsa-miR-195-5p Sc-60646 419381 NSC114382 sensitive
hsa-miR-195-5p Sodium;3-hydroxy-4-[(1-hydroxynaphthalen-2-yl)diazenyl]-8-nitronaphthalene-1-sulfonate 135488931 NSC85561 resistant
hsa-miR-195-5p Sr16388 54612678 NSC745098 sensitive
hsa-miR-195-5p Stereoisomer of nsc 674067-p 384359 NSC674066 resistant
hsa-miR-195-5p Tellurium, trichloro[1,2-hexanedioato(2-)-o,o']-, ammonium 498945 NSC641009 resistant
hsa-miR-195-5p Tert-butyl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 386493 NSC678637 sensitive
hsa-miR-195-5p Thujaplicin mixture 252101 NSC73300 resistant
hsa-miR-195-5p Tris(1,10-phenanthroline)neodymium(iii)-trithiocyanate 24202207 NSC632730 resistant
hsa-miR-195-5p Verrucarin a 9,10-epoxide 5358836 NSC283445 resistant
hsa-miR-195-5p Z24759926 4853660 NSC743408 sensitive
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved sensitive High Small Cell Lung Cancer cell line (NCI-H69)
hsa-miR-195-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U251MG)
hsa-miR-195-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7, MDA-MB-231)
hsa-miR-195-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-195-5p Docetaxel 148124 NSC628503 approved resistant High Head And Neck Squamous Cell Carcinoma cell line (UMSCC-1, SQ20B)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (BEL-7402)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (BEL-7402)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Epidermoid Carcinoma cell line (KB-3-1, KB-CP.5, KB-CP20)
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved sensitive Low Colon Cancer cell line (HT-29, LOVO)
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer tissue and cell line (MCF-7)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-195-5p Gemcitabine 60750 NSC613327 approved resistant High Bladder Cancer cell line (RT4, J82,TCCSUP, UM-UC-3,RT112,CUBIII)
hsa-miR-195-5p Gemcitabine 60750 NSC613327 approved sensitive High Non-Small Cell Lung Cancer cell line (SK-MES-1, NCI-H1975, NCI-H460)
hsa-miR-195-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-195-5p Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor tissue
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved resistant High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (IOSE386, IOSE397, A2780, KF, SKOV3, TOUS3,TU-OC-1, OVCAR-3, OV2008, CI3)
hsa-miR-195-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (COC1)
hsa-miR-195-5p Prednisolone 5755 NSC9120 approved sensitive Low Ulcerative Colitis tissue
hsa-miR-195-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-195-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-195-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-195-5p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-195-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved resistant Low Colorectal Cancer cell line (HCT-116)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Melanoma cell line (UACC-62, SK-MEL-5)
hsa-miR-195-5p Temozolomide 5394 NSC362856 approved sensitive Low Melanoma cell line (UACC-62, SK-MEL-5)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-195-5p Gemcitabine 60750 NSC613327 approved sensitive Low Urothelial Bladder Cancer cell line (T24)
hsa-miR-195-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-195-5p Azacitidine 9444 NSC102816 approved resistant High Acute Myeloid Leukemia tissue
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (Caco-2, HCT8, HCT-116, SW480)
hsa-miR-195-5p Eribulin 73425383 approved sensitive Low Non-Small Cell Lung Cancer cell line (H1299)
hsa-miR-195-5p Docetaxel 148124 NSC628503 approved sensitive Low Prostate Cancer cell line (DU-145)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (SW620, HT-29)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (MKN28)
hsa-miR-195-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Gastric Cancer cell line (MKN28)
hsa-miR-195-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-195-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (U251MG)
hsa-miR-195-5p Radioactivity Iodine sensitive High Papillary Thyroid Cancer tissue
hsa-miR-195-5p Trastuzumab sensitive Low HER2-Positive Breast Cancer cell line (BT-474)
hsa-miR-195-5p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) resistant High Metastatic Colorectal Cancer tissue
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (SGC-7901, AGS)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer cell line (MGC-803)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3, HO8910, ES-2, A2780)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-116, RKO)
hsa-miR-195-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HCT-116, RKO)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (MGC-803)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (W1)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (W1)
hsa-miR-195-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-195-5p Platinum 23939 sensitive High High-Grade Serous Ovarian Cancer tissue
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7, Hep3B)
hsa-miR-195-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-195-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT116)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM36)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-195-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-195-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-195-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-195-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-195-5p Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-miR-195-5p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-195-5p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-195-5p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-195-5p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-195-5p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-195-5p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-195-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-195-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-195-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-195-5p Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-195-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-195-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-195-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)

Error report submission