>TJAP1|NM_001146016|3'UTR
   1 GGCCCCTGCTGGCCTTCCTGCCATTGCTGCACCAGGACTGCAAGGAGTCCCCACACCTTGGCAGCTCAGGGTCCCCAGTC
  81 CAAGCCCTTGACCTCTCCTCTATCCAGACCCGCACAGCTGTTTCCTGTGTGGATGGGGTCAGGTTGTGGGCCATGCCAGG
 161 CCTGTCAGCTGCGTTGACTGACTGCAGCAGCTTGCCTCATGGTTTTCCCTTTTTCTTAGAATATTTATTCTTCAGAGGTA
 241 ACATGCAGTTGGGTCTCAAGACCTTTCCTCCAATCAGCCCAACCCAGCCCAGACTGGGCTTTTCTGGGGAGCTGAGGAGT
 321 TTATCAGTATTCATCTTCCATCCTTTCATAGTCACAAGTTTTGTTATTTTGTTTTTTTTTGGGGGTGATGGTGTAATTGT
 401 TAACCTCATTTCCGTTTCCTACCTGTTTGCTTCCCCCCCCAGTCCTCCGCATGAGCTGTTGCCCTCCAGGGGCCTGGCAC
 481 AGCTGGCCTTGGGGACGAGGGAGAGGACTGATTCAGGGCCCCCTCAGCTGTCTCCTCCCTCCCTCTGGAAAGGAGGGTGG
 561 GGCTCAGGGGCCTCAAGCTGGGCTCTGTGTGAGGCCTGGCCCCCACTCCCAACCTTGGCTCTAGACTGTTACTCTTAAGC
 641 TTTGAGAAATTTTCACATTGATGACTATTTTAAAATCAAATAAAACTATTTTACTGGTATGAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gcUGGUACCGACAUCUGACAAu 5' ||| ||||| ||||||||| Target 5' caACCTTGGCTCTAGACTGTTa 3'	610 - 631	184.00	-24.50
2	miRNA 3' gcUGGUACCGACAU----CUGACaau 5' :|||| |||| | ||||| Target 5' ctGCCATTGCTGCACCAGGACTGcaa 3'	18 - 43	126.00	-14.72
3	miRNA 3' gcUGGUACCGACAUCUGACAAu 5' || | || | :||||| | Target 5' ggACGA-GGGAGAGGACTGATt 3'	493 - 513	119.00	-11.72

Mutant ID	Mutant Position	Mutant Source
COSN30566374	26	COSMIC
COSN7883517	98	COSMIC
COSN9907478	224	COSMIC
COSN29234837	276	COSMIC
COSN29610894	381	COSMIC
COSN7790609	381	COSMIC
COSN28201786	384	COSMIC
COSN31543668	415	COSMIC
COSN24381016	441	COSMIC
COSN31484464	498	COSMIC
COSN31579754	552	COSMIC
COSN31584412	647	COSMIC
COSN28718048	678	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1309687936	4	dbSNP
rs1353310853	6	dbSNP
rs755213132	8	dbSNP
rs1292862879	13	dbSNP
rs939207742	19	dbSNP
rs1428775172	25	dbSNP
rs1387938611	27	dbSNP
rs1247013338	30	dbSNP
rs778926832	32	dbSNP
rs1339373225	35	dbSNP
rs1195217769	39	dbSNP
rs1433576355	45	dbSNP
rs34182777	46	dbSNP
rs1202589923	48	dbSNP
rs1056199588	54	dbSNP
rs1189442857	58	dbSNP
rs1481655632	74	dbSNP
rs114849138	79	dbSNP
rs1204543500	82	dbSNP
rs1351730991	86	dbSNP
rs188240163	91	dbSNP
rs1301167127	95	dbSNP
rs1234360646	101	dbSNP
rs1329758668	102	dbSNP
rs1299784907	103	dbSNP
rs1393718541	106	dbSNP
rs1235841194	111	dbSNP
rs1027563724	112	dbSNP
rs538642168	113	dbSNP
rs1368262694	121	dbSNP
rs554150390	124	dbSNP
rs1466333650	128	dbSNP
rs1376923550	129	dbSNP
rs1281442493	132	dbSNP
rs1173852298	137	dbSNP
rs1341747883	142	dbSNP
rs887446342	144	dbSNP
rs1007185929	146	dbSNP
rs1482128274	149	dbSNP
rs115466806	154	dbSNP
rs1201290410	163	dbSNP
rs1344751472	168	dbSNP
rs546208567	173	dbSNP
rs1276869405	174	dbSNP
rs1330375046	175	dbSNP
rs1483415781	175	dbSNP
rs965757240	180	dbSNP
rs975815762	184	dbSNP
rs146145333	199	dbSNP
rs1335776555	208	dbSNP
rs77082223	211	dbSNP
rs1300796970	219	dbSNP
rs1431331970	222	dbSNP
rs568842238	223	dbSNP
rs777647378	226	dbSNP
rs915456392	231	dbSNP
rs1158400364	241	dbSNP
rs1471635653	244	dbSNP
rs537619591	254	dbSNP
rs749273668	256	dbSNP
rs1200766205	264	dbSNP
rs1395398511	266	dbSNP
rs946714077	271	dbSNP
rs1442004558	272	dbSNP
rs1448508459	274	dbSNP
rs1207211329	280	dbSNP
rs1465666502	283	dbSNP
rs543571269	285	dbSNP
rs561940056	286	dbSNP
rs72857288	292	dbSNP
rs1056468852	295	dbSNP
rs1244887356	302	dbSNP
rs1339471300	303	dbSNP
rs572214188	306	dbSNP
rs1436980925	308	dbSNP
rs765404221	314	dbSNP
rs1304642339	322	dbSNP
rs55869200	329	dbSNP
rs1364835475	334	dbSNP
rs865891986	336	dbSNP
rs1455634417	348	dbSNP
rs115171506	350	dbSNP
rs1163848309	350	dbSNP
rs959326033	354	dbSNP
rs1300067956	358	dbSNP
rs527264442	359	dbSNP
rs1049459537	363	dbSNP
rs1247859153	367	dbSNP
rs887673671	368	dbSNP
rs1007657064	372	dbSNP
rs577275176	372	dbSNP
rs1220965297	373	dbSNP
rs1263705027	374	dbSNP
rs180905262	381	dbSNP
rs570411035	382	dbSNP
rs1215410615	385	dbSNP
rs9394955	387	dbSNP
rs9394956	390	dbSNP
rs1332703380	397	dbSNP
rs1324179023	399	dbSNP
rs997300698	400	dbSNP
rs983576444	403	dbSNP
rs537949866	405	dbSNP
rs116653268	407	dbSNP
rs1009702494	408	dbSNP
rs772690302	414	dbSNP
rs568253258	415	dbSNP
rs1247780272	418	dbSNP
rs1163489729	420	dbSNP
rs1366144216	421	dbSNP
rs1198828011	422	dbSNP
rs1342354967	433	dbSNP
rs1450534647	433	dbSNP
rs553632280	433	dbSNP
rs535682304	438	dbSNP
rs554087189	439	dbSNP
rs572328656	440	dbSNP
rs560770694	441	dbSNP
rs545845674	442	dbSNP
rs1426398260	445	dbSNP
rs932273713	449	dbSNP
rs1053464610	450	dbSNP
rs1235110614	454	dbSNP
rs1183666479	462	dbSNP
rs1483123323	464	dbSNP
rs1362944309	465	dbSNP
rs960694539	467	dbSNP
rs35888396	469	dbSNP
rs1443912948	471	dbSNP
rs558145114	472	dbSNP
rs116208590	473	dbSNP
rs1342734223	473	dbSNP
rs1042167776	483	dbSNP
rs906687945	491	dbSNP
rs1323573072	493	dbSNP
rs1306400323	494	dbSNP
rs115202991	497	dbSNP
rs1273718357	498	dbSNP
rs1048864196	501	dbSNP
rs1333850584	502	dbSNP
rs1413154952	505	dbSNP
rs1464308322	514	dbSNP
rs1160601443	520	dbSNP
rs542290673	524	dbSNP
rs895414398	529	dbSNP
rs371630009	530	dbSNP
rs994772449	544	dbSNP
rs116615275	547	dbSNP
rs1237726230	549	dbSNP
rs950774577	554	dbSNP
rs1253548090	561	dbSNP
rs1165389881	563	dbSNP
rs1425018532	563	dbSNP
rs1269909637	565	dbSNP
rs1005367649	566	dbSNP
rs901549151	566	dbSNP
rs997145167	570	dbSNP
rs1166337548	571	dbSNP
rs1019066245	573	dbSNP
rs1052862538	574	dbSNP
rs185510840	576	dbSNP
rs559761432	584	dbSNP
rs1010165977	586	dbSNP
rs976623203	586	dbSNP
rs921155777	588	dbSNP
rs953964720	608	dbSNP
rs931138006	612	dbSNP
rs989422970	617	dbSNP
rs1456064152	619	dbSNP
rs563152670	623	dbSNP
rs1387094817	626	dbSNP
rs1156261338	631	dbSNP
rs914897940	633	dbSNP
rs945095755	634	dbSNP
rs978244072	642	dbSNP
rs549334457	643	dbSNP
rs1447655672	646	dbSNP
rs1249724636	650	dbSNP
rs927742268	652	dbSNP
rs1464337042	656	dbSNP
rs1258926792	657	dbSNP
rs1223806285	659	dbSNP
rs1381499641	660	dbSNP
rs138957492	663	dbSNP
rs1226874652	664	dbSNP
rs1055239090	677	dbSNP
rs919355559	678	dbSNP
rs1434863223	682	dbSNP
rs895342195	689	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Proceedings of the National Academy of Sciences of the United States of America, 2012

Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA- RNA-induced silencing complex (RISC)-messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.