miRTarBase - #MIRT007725


—
pre-miRNA Information
pre-miRNA mmu-mir-301b   
Genomic Coordinates chr16: 17124400 - 17124496
Synonyms Mirn301b, mir-301b, Mir301b
Description Mus musculus miR-301b stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-301b-3p
Sequence 55| CAGUGCAAUGGUAUUGUCAAAGC |77
Evidence Experimental
Experiments MiRAP-cloned
Putative Targets

Gene Information
Gene Symbol Ubap2l   
Synonyms 3110083O19Rik, 4932431F02Rik, A430103N23Rik, C77168, Nice-4, mKIAA0144
Description ubiquitin-associated protein 2-like
Transcript NM_028475   
Other Transcripts NM_001165984 , NM_001165985 , NM_001165986 , NM_001165987 , NM_001165988 , NM_001165983 , NM_153489   
Expression
Putative miRNA Targets on Ubap2l
3'UTR of Ubap2l
(miRNA target sites are highlighted)		 
>Ubap2l|NM_028475|3'UTR
   1 GTATTACCGTACCAACTGGGGCCTCTTCTAGCAGGCTCGAAGGCTGTGGAATAAAGTGAAATCTTTGCCCTTTAAGATCT
  81 CTCACCTTAATGTGCTAATATTTTGCCCTTAAGGGGATTTCCTTATACATTCTGTGACTGGAAAGAACTACTGCAAATCT
 161 TCATTTCTTCTAGAAACTGCCTCATCTACAGCACGTTTCAGGAAGTGAAAGGGGAAGGAGCTAAGGACATTTAGAAGGCA
 241 AAGGACCTTGTGGGAATCTAAGCATGGTTTTAAAGGATTCTGAAGTCTCAAGCCAGCATTAGCTGCTGGCCGGCAGAACT
 321 CAATCTTGGGGTCTTTTTCTCTTTGGAGGAGTATAGTAGTTCTTGTTCTCTGAGTTATGTTTTTGAGACAGTCTCACTAT
 401 GTAACCCTGACTGGCCTGGAGCTTGGTGTGGAGACCAGGTTGGTCTCACATTCAGAGATCTGCCTGCTTCTACCTCTTGA
 481 GTGCTAAGGTTAAAGGTTGTCAGCACTACACCCTGCCTTGCCTATTTTATGTGGCTTTGAAATGCCTACATTTTGGGAAA
 561 AGAATGGATGATCTTAGAGCAAGACCTGGGGTGGGGGCATGGTGCAGTAAAAGGTTTTTGGACTTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgAAACUGUUAUGGUAACGUGAc 5'
            | || :||||:: |||| || 
Target 5' aaTGTGCTAATATT-TTGCCCTt 3'
 89 - 110 132.00 -6.50
2 
miRNA  3' cgaaACUGUUAUGGUAACGUGAc 5'
              ||| |||  | |||| || 
Target 5' aaagTGA-AAT--CTTTGCCCTt 3'
 53 - 72 122.00 -6.30
3 
miRNA  3' cgaaacUGUUAUGGUAACGUGAc 5'
                | || ::: ||| ||| 
Target 5' tgcagtAAAAGGTTTTTGGACTt 3'
 603 - 625 117.00 -6.20
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions C2C12
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes ...

- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgAAACUGUUAUGGUAACGUGAc 5'
            | ||   |||   ||||||| 
Target 5' ugUGUGUGUAUAAAUUUGCACU- 3'
 		9 - 30
Article - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al.
- Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
392 mmu-miR-301b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006125 Meox1 mesenchyme homeobox 1 3 1
MIRT007716 Tmx4 thioredoxin-related transmembrane protein 4 1 1
MIRT007717 Sephs1 selenophosphate synthetase 1 1 1
MIRT007718 Mprip myosin phosphatase Rho interacting protein 1 1
MIRT007719 Usp32 ubiquitin specific peptidase 32 1 1
MIRT007720 Zdhhc20 zinc finger, DHHC domain containing 20 1 1
MIRT007721 Traf3 TNF receptor-associated factor 3 1 1
MIRT007722 Cd81 CD81 antigen 1 1
MIRT007723 Tspan9 tetraspanin 9 1 1
MIRT007724 Itm2b integral membrane protein 2B 1 1
MIRT007725 Ubap2l ubiquitin-associated protein 2-like 1 2
MIRT007726 Slc9a2 solute carrier family 9 (sodium/hydrogen exchanger), member 2 1 1
MIRT007727 Pik3c2b phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 1 1
MIRT007728 Arxes2 adipocyte-related X-chromosome expressed sequence 2 1 1
MIRT007729 Lrrc55 leucine rich repeat containing 55 1 1
MIRT007730 Fam63b MINDY lysine 48 deubiquitinase 2 1 1
MIRT007731 Wdr44 WD repeat domain 44 1 1
MIRT007732 Cdc42 cell division cycle 42 1 1
MIRT007733 Zfp41 zinc finger protein 41 1 1
MIRT007734 Sema4g sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G 1 1
MIRT007735 Mcm7 minichromosome maintenance complex component 7 1 1
MIRT007736 Tmed4 transmembrane p24 trafficking protein 4 1 1
MIRT007737 Gid4 GID complex subunit 4, VID24 homolog 1 1
MIRT007738 Cep112 centrosomal protein 112 1 1
MIRT007739 Slc17a6 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 1 1
MIRT007740 Cmtm3 CKLF-like MARVEL transmembrane domain containing 3 1 1
MIRT007741 Dsel dermatan sulfate epimerase-like 1 1
MIRT007742 Aspscr1 alveolar soft part sarcoma chromosome region, candidate 1 (human) 1 1
MIRT007743 Socs6 suppressor of cytokine signaling 6 1 1
MIRT007744 Klf10 Kruppel-like factor 10 1 1
MIRT007745 Lsamp limbic system-associated membrane protein 1 1
MIRT007746 Adam19 a disintegrin and metallopeptidase domain 19 (meltrin beta) 1 1
MIRT007747 Cln6 ceroid-lipofuscinosis, neuronal 6 1 1
MIRT007748 Adamts8 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8 1 1
MIRT007749 Fat3 FAT atypical cadherin 3 1 1
MIRT007750 Ankrd26 ankyrin repeat domain 26 1 1
MIRT007751 Pianp PILR alpha associated neural protein 1 1
MIRT007752 Xrn1 5'-3' exoribonuclease 1 1 1
MIRT007753 Haus6 HAUS augmin-like complex, subunit 6 1 1
MIRT007754 Slc47a1 solute carrier family 47, member 1 1 1
MIRT007755 Ube3b ubiquitin protein ligase E3B 1 1
MIRT007756 Cyb5d2 cytochrome b5 domain containing 2 1 1
MIRT007757 Ppp6r3 protein phosphatase 6, regulatory subunit 3 1 1
MIRT007758 Rnf103 ring finger protein 103 1 1
MIRT007759 Ppp1r21 protein phosphatase 1, regulatory subunit 21 1 1
MIRT007760 Ankrd52 ankyrin repeat domain 52 1 1
MIRT007761 Dcbld2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT007762 Atf2 activating transcription factor 2 1 1
MIRT007763 Slc1a2 solute carrier family 1 (glial high affinity glutamate transporter), member 2 1 1
MIRT007764 Cald1 caldesmon 1 1 1
MIRT007765 Adarb1 adenosine deaminase, RNA-specific, B1 1 1
MIRT007766 AU040320 expressed sequence AU040320 1 1
MIRT007767 Nudt10 nudix (nucleoside diphosphate linked moiety X)-type motif 10 1 1
MIRT007768 Cnr1 cannabinoid receptor 1 (brain) 1 1
MIRT007769 Picalm phosphatidylinositol binding clathrin assembly protein 1 1
MIRT007770 Strip2 striatin interacting protein 2 1 1
MIRT007771 BC005537 cDNA sequence BC005537 1 1
MIRT007772 Mtss1l metastasis suppressor 1-like 1 1
MIRT007773 Polq polymerase (DNA directed), theta 1 1
MIRT007774 Msi2 musashi RNA-binding protein 2 1 1
MIRT007775 Etnk1 ethanolamine kinase 1 1 1
MIRT007776 Iqgap2 IQ motif containing GTPase activating protein 2 1 1
MIRT007777 Ythdc2 YTH domain containing 2 1 1
MIRT007778 Fcho2 FCH domain only 2 1 1
MIRT007779 Rnf128 ring finger protein 128 1 1
MIRT007780 Dynll2 dynein light chain LC8-type 2 1 1
MIRT007781 Srsf2 serine/arginine-rich splicing factor 2 1 1
MIRT007782 Htr5a 5-hydroxytryptamine (serotonin) receptor 5A 1 1
MIRT007783 Arl6ip1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT007784 Cpeb4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT007785 Heg1 heart development protein with EGF-like domains 1 1 1
MIRT007786 Zkscan8 zinc finger with KRAB and SCAN domains 8 1 1
MIRT007787 Nhsl2 NHS-like 2 1 1
MIRT007788 Kdm2a lysine (K)-specific demethylase 2A 1 2
MIRT007789 Chst1 carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 1 1
MIRT007790 Fam179b TOG array regulator of axonemal microtubules 1 1 1
MIRT007791 Tmem9b TMEM9 domain family, member B 1 1
MIRT007792 Acvr1 activin A receptor, type 1 1 1
MIRT007793 Gadd45a growth arrest and DNA-damage-inducible 45 alpha 1 1
MIRT007794 Prnp prion protein 1 1
MIRT007795 Ubl3 ubiquitin-like 3 1 1
MIRT007796 Sgcb sarcoglycan, beta (dystrophin-associated glycoprotein) 1 1
MIRT007797 Npnt nephronectin 1 1
MIRT007798 Phf3 PHD finger protein 3 1 1
MIRT007799 Ap1m1 adaptor-related protein complex AP-1, mu subunit 1 1 1
MIRT007800 Dnajc9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT007801 Epdr1 ependymin related protein 1 (zebrafish) 1 1
MIRT007802 Usp3 ubiquitin specific peptidase 3 1 1
MIRT007803 Fam173b family with sequence similarity 173, member B 1 1
MIRT007804 Scaper S phase cyclin A-associated protein in the ER 1 1
MIRT007805 Map1b microtubule-associated protein 1B 1 1
MIRT007806 Adpgk ADP-dependent glucokinase 1 1
MIRT007807 Mlh3 mutL homolog 3 1 1
MIRT007808 B3galt2 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 1 1
MIRT007809 Brms1l breast cancer metastasis-suppressor 1-like 1 1
MIRT007810 Etv5 ets variant 5 1 1
MIRT007811 Prrg3 proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) 1 1
MIRT007812 Adh5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT007813 Cnot10 CCR4-NOT transcription complex, subunit 10 1 1
MIRT007814 Aplp2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT007815 Cox5b cytochrome c oxidase subunit Vb 1 1
MIRT007816 Papola poly (A) polymerase alpha 1 1
MIRT007817 Setd7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT007818 Dcaf12l1 DDB1 and CUL4 associated factor 12-like 1 1 1
MIRT007819 1600012H06Rik RIKEN cDNA 1600012H06 gene 1 1
MIRT007820 Rnf11 ring finger protein 11 1 1
MIRT007821 Kif5c kinesin family member 5C 1 1
MIRT007822 Fyn Fyn proto-oncogene 1 1
MIRT007823 Cyp4x1 cytochrome P450, family 4, subfamily x, polypeptide 1 1 1
MIRT007824 Cntn3 contactin 3 1 1
MIRT007825 6030458C11Rik RIKEN cDNA 6030458C11 gene 1 1
MIRT007826 Tmem245 transmembrane protein 245 1 1
MIRT007827 Hspa12a heat shock protein 12A 1 1
MIRT007828 Syt1 synaptotagmin I 1 1
MIRT007829 Fam117b family with sequence similarity 117, member B 1 1
MIRT007830 Foxo3 forkhead box O3 1 1
MIRT007831 Sorbs2 sorbin and SH3 domain containing 2 1 1
MIRT007832 Whsc1l1 nuclear receptor binding SET domain protein 3 1 1
MIRT007833 Zmym2 zinc finger, MYM-type 2 1 1
MIRT007834 Dirc2 disrupted in renal carcinoma 2 (human) 1 1
MIRT007835 Ski ski sarcoma viral oncogene homolog (avian) 1 1
MIRT007836 Camk2n1 calcium/calmodulin-dependent protein kinase II inhibitor 1 1 1
MIRT007837 Zbtb37 zinc finger and BTB domain containing 37 1 1
MIRT007838 Zfand4 zinc finger, AN1-type domain 4 1 1
MIRT007839 Sp1 trans-acting transcription factor 1 1 1
MIRT007840 Slitrk5 SLIT and NTRK-like family, member 5 1 1
MIRT007841 Rb1 RB transcriptional corepressor 1 1 1
MIRT007842 D430041D05Rik RIKEN cDNA D430041D05 gene 1 1
MIRT007843 Lrtm2 leucine-rich repeats and transmembrane domains 2 1 1
MIRT007844 Tacc1 transforming, acidic coiled-coil containing protein 1 1 1
MIRT007845 Cav1 caveolin 1, caveolae protein 1 1
MIRT007846 Tnfrsf21 tumor necrosis factor receptor superfamily, member 21 1 1
MIRT007847 Aff4 AF4/FMR2 family, member 4 1 1
MIRT007848 Prkch protein kinase C, eta 1 1
MIRT007849 Pafah1b1 platelet-activating factor acetylhydrolase, isoform 1b, subunit 1 1 1
MIRT007850 Soga3 SOGA family member 3 1 1
MIRT007851 Suv420h1 lysine methyltransferase 5B 1 1
MIRT007852 Gng12 guanine nucleotide binding protein (G protein), gamma 12 1 1
MIRT007853 D130043K22Rik RIKEN cDNA D130043K22 gene 1 1
MIRT007854 Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 1 1
MIRT007855 Trib2 tribbles pseudokinase 2 1 1
MIRT007856 Aldh3a2 aldehyde dehydrogenase family 3, subfamily A2 1 1
MIRT007857 Znfx1 zinc finger, NFX1-type containing 1 1 1
MIRT007858 Cttnbp2nl CTTNBP2 N-terminal like 1 1
MIRT007859 Kcnt2 potassium channel, subfamily T, member 2 1 1
MIRT007860 Hmgcll1 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 1 1
MIRT007861 Fnbp1 formin binding protein 1 1 1
MIRT007862 Zfp597 zinc finger protein 597 1 1
MIRT007863 Nap1l3 nucleosome assembly protein 1-like 3 1 1
MIRT007864 Pbxip1 pre B cell leukemia transcription factor interacting protein 1 1 1
MIRT007865 Snip1 Smad nuclear interacting protein 1 1 1
MIRT007866 Lrp1b low density lipoprotein-related protein 1B (deleted in tumors) 1 1
MIRT007867 Klf9 Kruppel-like factor 9 1 1
MIRT007868 Ezh1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT007869 Enpp4 ectonucleotide pyrophosphatase/phosphodiesterase 4 1 1
MIRT007870 Patl1 protein associated with topoisomerase II homolog 1 (yeast) 1 1
MIRT007871 Grin3a glutamate receptor ionotropic, NMDA3A 1 1
MIRT007872 Map3k5 mitogen-activated protein kinase kinase kinase 5 1 1
MIRT007873 Kif5a kinesin family member 5A 1 1
MIRT007874 Golt1b golgi transport 1B 1 1
MIRT007875 Lnpep leucyl/cystinyl aminopeptidase 1 1
MIRT007876 Snn stannin 1 1
MIRT007877 Naa50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT007878 Smoc2 SPARC related modular calcium binding 2 1 1
MIRT007879 Hlf hepatic leukemia factor 1 1
MIRT007880 Txnip thioredoxin interacting protein 1 1
MIRT007881 Cep120 centrosomal protein 120 1 1
MIRT007882 Rnf216 ring finger protein 216 1 1
MIRT007883 Wdr47 WD repeat domain 47 1 1
MIRT007884 Il6st interleukin 6 signal transducer 1 1
MIRT007885 Dpysl2 dihydropyrimidinase-like 2 1 1
MIRT007886 Eogt EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase 1 1
MIRT007887 C1galt1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT007888 Ppp1cb protein phosphatase 1, catalytic subunit, beta isoform 1 1
MIRT007889 Ralbp1 ralA binding protein 1 1 1
MIRT007890 Mtmr4 myotubularin related protein 4 1 1
MIRT007891 Stam signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 1 1
MIRT007892 Zeb2 zinc finger E-box binding homeobox 2 1 1
MIRT007893 Fstl5 follistatin-like 5 1 1
MIRT007894 Stim2 stromal interaction molecule 2 1 1
MIRT007895 Inhbb inhibin beta-B 1 1
MIRT007896 Slc24a2 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 1 1
MIRT007897 Tspyl2 TSPY-like 2 1 1
MIRT007898 Szrd1 SUZ RNA binding domain containing 1 1 1
MIRT007899 Adcyap1r1 adenylate cyclase activating polypeptide 1 receptor 1 1 1
MIRT007900 Nfatc3 nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3 1 1
MIRT007901 Arhgap29 Rho GTPase activating protein 29 1 1
MIRT007902 Sec63 SEC63-like (S. cerevisiae) 1 1
MIRT007903 Gm11492 uncharacterized protein C17orf47 homolog 1 1
MIRT007904 Antxr1 anthrax toxin receptor 1 1 1
MIRT007905 Sema3c sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C 1 1
MIRT007906 Tef thyrotroph embryonic factor 1 1
MIRT007907 Gtdc2 protein O-linked mannose beta 1,4-N-acetylglucosaminyltransferase 2 1 1
MIRT007908 Gramd1a GRAM domain containing 1A 1 1
MIRT007909 Dph3 diphthamine biosynthesis 3 1 1
MIRT007910 Fkbp1b FK506 binding protein 1b 1 1
MIRT007911 Ctso cathepsin O 1 1
MIRT007912 Ednrb endothelin receptor type B 1 1
MIRT007913 Arpc4 actin related protein 2/3 complex, subunit 4 1 1
MIRT007914 Hdac8 histone deacetylase 8 1 1
MIRT007915 Scara5 scavenger receptor class A, member 5 1 1
MIRT007916 Lgals8 lectin, galactose binding, soluble 8 1 1
MIRT007917 Cacna2d1 calcium channel, voltage-dependent, alpha2/delta subunit 1 1 1
MIRT007918 Npy2r neuropeptide Y receptor Y2 1 1
MIRT007919 Scn3b sodium channel, voltage-gated, type III, beta 1 1
MIRT007920 Them6 thioesterase superfamily member 6 1 1
MIRT007921 Zfp191 zinc finger protein 24 1 1
MIRT007922 Tex2 testis expressed gene 2 1 1
MIRT007923 Auh AU RNA binding protein/enoyl-coenzyme A hydratase 1 1
MIRT007924 Frmpd4 FERM and PDZ domain containing 4 1 1
MIRT007925 Gtf2i general transcription factor II I 1 1
MIRT007926 Slc7a11 solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 1 1
MIRT007927 B4galt6 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 1 1
MIRT007928 Asxl3 additional sex combs like 3 (Drosophila) 1 1
MIRT007929 Gm6792 epididymal protein 13 1 1
MIRT007930 BC003331 cDNA sequence BC003331 1 1
MIRT007931 Ubxn4 UBX domain protein 4 1 1
MIRT007932 Gfra2 glial cell line derived neurotrophic factor family receptor alpha 2 1 1
MIRT007933 Dpp6 dipeptidylpeptidase 6 1 1
MIRT007934 Smap1 small ArfGAP 1 1 1
MIRT007935 Drd1a dopamine receptor D1 1 1
MIRT007936 Frmd4a FERM domain containing 4A 1 1
MIRT007937 Gria4 glutamate receptor, ionotropic, AMPA4 (alpha 4) 1 1
MIRT007938 Ralgps1 Ral GEF with PH domain and SH3 binding motif 1 1 1
MIRT007939 Myh10 myosin, heavy polypeptide 10, non-muscle 1 1
MIRT007940 Arhgap24 Rho GTPase activating protein 24 1 1
MIRT007941 Pros1 protein S (alpha) 1 1
MIRT007942 Cxcl14 chemokine (C-X-C motif) ligand 14 1 1
MIRT007943 Cyp46a1 cytochrome P450, family 46, subfamily a, polypeptide 1 1 1
MIRT007944 Nov nephroblastoma overexpressed gene 1 1
MIRT007945 Lamp1 lysosomal-associated membrane protein 1 1 1
MIRT007946 5730455P16Rik RIKEN cDNA 5730455P16 gene 1 1
MIRT007947 Zhx3 zinc fingers and homeoboxes 3 1 1
MIRT007948 Ldhb lactate dehydrogenase B 1 1
MIRT007949 Xpnpep3 X-prolyl aminopeptidase 3, mitochondrial 1 1
MIRT007950 Ppp2ca protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform 1 1
MIRT007951 Adam22 a disintegrin and metallopeptidase domain 22 1 1
MIRT007952 Csrnp2 cysteine-serine-rich nuclear protein 2 1 1
MIRT007953 Scamp5 secretory carrier membrane protein 5 1 1
MIRT007954 Nrarp Notch-regulated ankyrin repeat protein 1 1
MIRT007955 Rala v-ral simian leukemia viral oncogene A (ras related) 1 1
MIRT007956 Tecpr1 tectonin beta-propeller repeat containing 1 1 1
MIRT007957 Jtb jumping translocation breakpoint 1 1
MIRT007958 Nup62 nucleoporin 62 1 1
MIRT007959 Asic2 acid-sensing (proton-gated) ion channel 2 1 1
MIRT007960 Fermt2 fermitin family member 2 1 1
MIRT007961 Fbxw5 F-box and WD-40 domain protein 5 1 1
MIRT007962 Tbc1d12 TBC1D12: TBC1 domain family, member 12 1 1
MIRT007963 Rragd Ras-related GTP binding D 1 1
MIRT007964 Atp2a2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT007965 Cmtm6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT007966 Zbtb1 zinc finger and BTB domain containing 1 1 1
MIRT007967 Fzd6 frizzled class receptor 6 1 1
MIRT007968 Cds2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT007969 Pi4k2a phosphatidylinositol 4-kinase type 2 alpha 1 1
MIRT007970 Mfsd7c major facilitator superfamily domain containing 7C 1 1
MIRT007971 Rb1cc1 RB1-inducible coiled-coil 1 1 1
MIRT007972 Pfn2 profilin 2 1 1
MIRT007973 Ppm1l protein phosphatase 1 (formerly 2C)-like 1 1
MIRT007974 Ldlrad4 low density lipoprotein receptor class A domain containing 4 1 1
MIRT007975 Slc39a10 solute carrier family 39 (zinc transporter), member 10 1 1
MIRT007976 Mtmr12 myotubularin related protein 12 1 1
MIRT007977 Papss2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 1 1
MIRT007978 Nf1 neurofibromin 1 1 1
MIRT007979 Rasgef1a RasGEF domain family, member 1A 1 1
MIRT007980 Ficd FIC domain containing 1 1
MIRT007981 Rph3a rabphilin 3A 1 1
MIRT007982 Tgfbr1 transforming growth factor, beta receptor I 1 1
MIRT007983 Pea15a phosphoprotein enriched in astrocytes 15A 1 1
MIRT007984 Ywhab tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 1 1
MIRT007985 Pcnx pecanex homolog (Drosophila) 1 1
MIRT007986 Btbd7 BTB (POZ) domain containing 7 1 1
MIRT007987 Wnk1 WNK lysine deficient protein kinase 1 1 1
MIRT007988 Nfya nuclear transcription factor-Y alpha 1 1
MIRT007989 Zmat3 zinc finger matrin type 3 1 1
MIRT007990 Pex11a peroxisomal biogenesis factor 11 alpha 1 1
MIRT007991 Cds1 CDP-diacylglycerol synthase 1 1 1
MIRT007992 Tnpo1 transportin 1 1 1
MIRT007993 Epc2 enhancer of polycomb homolog 2 (Drosophila) 1 1
MIRT007994 Npat nuclear protein in the AT region 1 1
MIRT007995 Parg poly (ADP-ribose) glycohydrolase 1 1
MIRT007996 Slc24a3 solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 1 1
MIRT007997 Sel1l3 sel-1 suppressor of lin-12-like 3 (C. elegans) 1 1
MIRT007998 Mul1 mitochondrial ubiquitin ligase activator of NFKB 1 1 1
MIRT007999 Srrm2 serine/arginine repetitive matrix 2 1 1
MIRT008000 Ndufs4 NADH dehydrogenase (ubiquinone) Fe-S protein 4 1 1
MIRT008001 Sh3rf3 SH3 domain containing ring finger 3 1 1
MIRT008002 Psme4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT008003 Sept4 septin 4 1 1
MIRT008004 Simc1 SUMO-interacting motifs containing 1 1 1
MIRT008005 Ppm1d protein phosphatase 1D magnesium-dependent, delta isoform 1 1
MIRT008006 Eno2 enolase 2, gamma neuronal 1 1
MIRT008007 Galc galactosylceramidase 1 1
MIRT008008 Clu clusterin 1 1
MIRT008009 Stxbp5l syntaxin binding protein 5-like 1 1
MIRT008010 Mgll monoglyceride lipase 1 1
MIRT008011 Fam175b BRISC complex subunit 1 1
MIRT008012 Grin2b glutamate receptor, ionotropic, NMDA2B (epsilon 2) 1 1
MIRT008013 Pigk phosphatidylinositol glycan anchor biosynthesis, class K 1 1
MIRT008014 Dcun1d2 DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) 1 1
MIRT008015 Atp6v1h ATPase, H+ transporting, lysosomal V1 subunit H 1 1
MIRT008016 Zdhhc8 zinc finger, DHHC domain containing 8 1 1
MIRT008017 Incenp inner centromere protein 1 1
MIRT008018 Kif21a kinesin family member 21A 1 1
MIRT008019 Usp33 ubiquitin specific peptidase 33 1 1
MIRT008020 4930506M07Rik shootin 1 1 1
MIRT008021 Arel1 apoptosis resistant E3 ubiquitin protein ligase 1 1 1
MIRT008022 Nfia nuclear factor I/A 1 2
MIRT008023 Pygo2 pygopus 2 1 1
MIRT008024 Mtmr6 myotubularin related protein 6 1 1
MIRT008025 Rab11b RAB11B, member RAS oncogene family 1 1
MIRT008026 Pvr poliovirus receptor 1 1
MIRT008027 D4Wsu53e arginine/serine rich protein 1 1 1
MIRT008028 Nudcd3 NudC domain containing 3 1 1
MIRT008029 Gpr158 G protein-coupled receptor 158 1 1
MIRT008030 Cdc42bpa CDC42 binding protein kinase alpha 1 1
MIRT008031 Gabbr2 gamma-aminobutyric acid (GABA) B receptor, 2 1 1
MIRT008032 Grem2 gremlin 2, DAN family BMP antagonist 1 1
MIRT008033 Car12 carbonic anhydrase 12 1 1
MIRT008034 Ldlr low density lipoprotein receptor 1 1
MIRT008035 Zcchc24 zinc finger, CCHC domain containing 24 1 1
MIRT008036 Rgs7bp regulator of G-protein signalling 7 binding protein 1 1
MIRT008037 Pde4b phosphodiesterase 4B, cAMP specific 1 1
MIRT008038 Atrn attractin 1 1
MIRT008039 Pank1 pantothenate kinase 1 1 1
MIRT008040 Mfap3l microfibrillar-associated protein 3-like 1 1
MIRT008041 Stard13 StAR-related lipid transfer (START) domain containing 13 1 1
MIRT008042 Tenm3 teneurin transmembrane protein 3 1 1
MIRT008043 Gpcpd1 glycerophosphocholine phosphodiesterase 1 1 1
MIRT008044 Slc17a7 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 1 1
MIRT008045 Rgma repulsive guidance molecule family member A 1 1
MIRT008046 Ttyh3 tweety family member 3 1 1
MIRT008047 Nfix nuclear factor I/X 1 1
MIRT008048 Glrx5 glutaredoxin 5 1 1
MIRT008049 Ankra2 ankyrin repeat, family A (RFXANK-like), 2 1 1
MIRT008050 Hpca hippocalcin 1 1
MIRT008051 Ing2 inhibitor of growth family, member 2 1 1
MIRT008052 Rab10 RAB10, member RAS oncogene family 1 1
MIRT008053 N4bp1 NEDD4 binding protein 1 1 1
MIRT008054 B3galnt1 UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 1 1
MIRT008055 Trove2 TROVE domain family, member 2 1 1
MIRT008056 Kcna1 potassium voltage-gated channel, shaker-related subfamily, member 1 1 1
MIRT008057 Tmcc1 transmembrane and coiled coil domains 1 1 1
MIRT008058 Fam184a family with sequence similarity 184, member A 1 1
MIRT008059 Adam10 a disintegrin and metallopeptidase domain 10 1 1
MIRT008060 Esyt2 extended synaptotagmin-like protein 2 1 1
MIRT008061 Rab11fip4 RAB11 family interacting protein 4 (class II) 1 1
MIRT008062 Errfi1 ERBB receptor feedback inhibitor 1 1 1
MIRT008063 Zfp275 zinc finger protein 275 1 1
MIRT008064 Psd3 pleckstrin and Sec7 domain containing 3 1 1
MIRT008065 Grb10 growth factor receptor bound protein 10 1 1
MIRT008066 Slc35f3 solute carrier family 35, member F3 1 1
MIRT008067 Hecw2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT008068 Taok1 TAO kinase 1 1 1
MIRT008069 St8sia3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 1 1
MIRT008070 Ccdc88a coiled coil domain containing 88A 1 1
MIRT008071 Enpp5 ectonucleotide pyrophosphatase/phosphodiesterase 5 1 1
MIRT008072 Lrch1 leucine-rich repeats and calponin homology (CH) domain containing 1 1 1
MIRT008073 Jmy junction-mediating and regulatory protein 1 1
MIRT008074 Sall3 sal-like 3 (Drosophila) 1 1
MIRT008075 Cltc clathrin, heavy polypeptide (Hc) 1 1
MIRT008076 Hprt hypoxanthine guanine phosphoribosyl transferase 1 1
MIRT008077 Csmd1 CUB and Sushi multiple domains 1 1 1
MIRT008078 Cblb Casitas B-lineage lymphoma b 1 1
MIRT008079 Abl2 v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) 1 1
MIRT008080 Zfp217 zinc finger protein 217 1 1
MIRT008081 Arap2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT008082 Reps2 RALBP1 associated Eps domain containing protein 2 1 1
MIRT008083 Klf7 Kruppel-like factor 7 (ubiquitous) 1 1
MIRT008084 Sik1 salt inducible kinase 1 1 1
MIRT008085 Apcdd1 adenomatosis polyposis coli down-regulated 1 1 1
MIRT008086 Robo1 roundabout guidance receptor 1 1 1
MIRT008087 Rnf38 ring finger protein 38 1 1
MIRT008088 Agfg1 ArfGAP with FG repeats 1 1 1
MIRT008089 Abca1 ATP-binding cassette, sub-family A (ABC1), member 1 1 1
MIRT008090 Arhgap21 Rho GTPase activating protein 21 1 1
MIRT008091 Sh3d19 SH3 domain protein D19 1 1
MIRT008092 Skida1 SKI/DACH domain containing 1 1 1
MIRT580367 Tmem25 transmembrane protein 25 1 1
MIRT580803 Snx27 sorting nexin family member 27 1 1
MIRT590619 Arrdc3 arrestin domain containing 3 1 1
MIRT590763 Acbd5 acyl-Coenzyme A binding domain containing 5 1 1
MIRT592544 Mup7 major urinary protein 7 1 1
MIRT592587 Mup13 major urinary protein 13 1 1
MIRT595105 Timp2 tissue inhibitor of metalloproteinase 2 1 1
MIRT595361 Fgfr1op2 FGFR1 oncogene partner 2 1 1
MIRT600787 Homez homeodomain leucine zipper-encoding gene 1 1
MIRT604877 Map3k12 mitogen-activated protein kinase kinase kinase 12 1 1
MIRT606371 Inpp5e inositol polyphosphate-5-phosphatase E 1 1
MIRT755742 Nos2 nitric oxide synthase 2, inducible 1 1
MIRT755743 Arg2 arginase type II 1 1
MIRT755747 Tnf tumor necrosis factor 1 1

Error report submission