miRTarBase - #MIRT007732


—
pre-miRNA Information
pre-miRNA mmu-mir-301b   
Genomic Coordinates chr16: 17124400 - 17124496
Synonyms Mirn301b, mir-301b, Mir301b
Description Mus musculus miR-301b stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-301b-3p
Sequence 55| CAGUGCAAUGGUAUUGUCAAAGC |77
Evidence Experimental
Experiments MiRAP-cloned
Putative Targets

Gene Information
Gene Symbol Cdc42   
Synonyms AI747189, AU018915
Description cell division cycle 42
Transcript NM_009861   
Expression
Putative miRNA Targets on Cdc42
3'UTR of Cdc42
(miRNA target sites are highlighted)		 
>Cdc42|NM_009861|3'UTR
   1 ACGCATCTCCAGAGCCCTTTCTGCACAGCTGGTGTTGTCGTCATACTAAAAGCAATGTTTAAATCAAACTAAAGATTAAA
  81 AATTAAAATTTGTTTCTGCAATAATGACAAACGCCCTGCACCTACCCACATGCACTCATGTGAGACAAGGCCCATTAGTA
 161 TGGCCCCTCCTTGCCCTTCCAGTAATAGTTAATTTTGAATAATTATGTATTGTCTGAAAAGCAATGAGTGCTAGTTTTTG
 241 TTTTCTTTGTTTAAAAAAAAAAACAAAAATCCCCACAAACGTTTGTTGTTTTTTTGTTTAAAAGCAAGCATGCTTGTATT
 321 GACTGTAACAGACTAATTCAGATTGTCAAAGCTGCTCCCTGGTTCCATTTTGGAGAGTAATCTGGGGCATCTTCGTGTCT
 401 TCTGTTTTGTTTTGTTTTGTTTTTCCTCAACCCTTCTCTCCTTTTGGGGTGTGTATGGGGTTGTTTCTTAGACTTGTATT
 481 TTAAAATTTGTTAACCATAGGACAGCCTGTGGGGAGGAGGACAGAGTATTTCCACATTCCACTCCCTAGGTCTAGTTTAG
 561 CAAACGTGTCCCCACCTGGTGCTCTTAGGAAGGAGTATAGAAACGCCTCGATTAACAACGTATTCCTTCTTGAAAGTTGC
 641 CTTTTCTCTCCACCTCTGAGTGGGTCCAGTCTGTGATGGAACTCATGAAGGTGGGTGGACGCTGTCTCGCCCCTCTTTCT
 721 AGGATGCACTCTATATGTGACTGTGACTTTCAAGGGTATTTGTTTGCCATTTCCTGATTTAGGGAGGGGAATAATTTCTA
 801 ACTTCTTTCATTGATAAATGAAAAGTATTGCACCTTTGAAATACACCAAATGGATTGAGTTCCTAATTAAAAAAAGTTCT
 881 TTTGCCCCTGTCAGTCATTTTCTTACATGCTTAGCACAGATTCACAACTCACTGTGTAGTGTTCCTAGATTCAGCTGAAG
 961 ACCTGGTACCTAGGGTTCCTAACGGGATGGTGTTAGGAAACACATCATGGCTGATGATTGCCATCTCCTTTCAGGTGATG
1041 AGGTCACAGGCCTGCTTCCTTAAGAAGCTATGAGCATGGGGTGGGGAGCATACTTTTAACCAACATGGGGACCAGTCAGG
1121 GCTATCCCCTTTTTTCTTCCATGCCTATGAGGAACCTTTGAACAACTGGCTGAAGCTTTCGCAAGAAAAATGGCGAGAGC
1201 CTCATGATTCTTTATAAGTGTTAATAGAGACTTTATCAGATTATTTTGTTTGCAGGTTCCAGTTTTTAAAAAATGTTTAG
1281 ATAATCTCCTTCCCCAGTCCTGATCTTGTGGATTCGTTAGTGCCGAACCAATGCTTTCTTGTGTCTCAACTCTTTGTATA
1361 TGAATTCTTTTCAGATGTATTAAACAAACAAAACCCTTCACAAGTGAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgaAACUG-UUA----UGGUAACGUGac 5'
             ||||: |||    | :|||||||  
Target 5' tcaTTGATAAATGAAAAGTATTGCACct 3'
 808 - 835 142.00 -11.00
2 
miRNA  3' cgaaaCUG--UUAUG-----GUAACGUGAc 5'
               |||  |:||:     |||| |||| 
Target 5' aggagGACAGAGTATTTCCACATTCCACTc 3'
 515 - 544 124.00 -9.50
3 
miRNA  3' cgaaacuguuaugguaACGUGAc 5'
                          |||||| 
Target 5' cctgcacctacccacaTGCACTc 3'
 115 - 137 120.00 -8.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
392 mmu-miR-301b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006125 Meox1 mesenchyme homeobox 1 3 1
MIRT007716 Tmx4 thioredoxin-related transmembrane protein 4 1 1
MIRT007717 Sephs1 selenophosphate synthetase 1 1 1
MIRT007718 Mprip myosin phosphatase Rho interacting protein 1 1
MIRT007719 Usp32 ubiquitin specific peptidase 32 1 1
MIRT007720 Zdhhc20 zinc finger, DHHC domain containing 20 1 1
MIRT007721 Traf3 TNF receptor-associated factor 3 1 1
MIRT007722 Cd81 CD81 antigen 1 1
MIRT007723 Tspan9 tetraspanin 9 1 1
MIRT007724 Itm2b integral membrane protein 2B 1 1
MIRT007725 Ubap2l ubiquitin-associated protein 2-like 1 2
MIRT007726 Slc9a2 solute carrier family 9 (sodium/hydrogen exchanger), member 2 1 1
MIRT007727 Pik3c2b phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 1 1
MIRT007728 Arxes2 adipocyte-related X-chromosome expressed sequence 2 1 1
MIRT007729 Lrrc55 leucine rich repeat containing 55 1 1
MIRT007730 Fam63b MINDY lysine 48 deubiquitinase 2 1 1
MIRT007731 Wdr44 WD repeat domain 44 1 1
MIRT007732 Cdc42 cell division cycle 42 1 1
MIRT007733 Zfp41 zinc finger protein 41 1 1
MIRT007734 Sema4g sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G 1 1
MIRT007735 Mcm7 minichromosome maintenance complex component 7 1 1
MIRT007736 Tmed4 transmembrane p24 trafficking protein 4 1 1
MIRT007737 Gid4 GID complex subunit 4, VID24 homolog 1 1
MIRT007738 Cep112 centrosomal protein 112 1 1
MIRT007739 Slc17a6 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 1 1
MIRT007740 Cmtm3 CKLF-like MARVEL transmembrane domain containing 3 1 1
MIRT007741 Dsel dermatan sulfate epimerase-like 1 1
MIRT007742 Aspscr1 alveolar soft part sarcoma chromosome region, candidate 1 (human) 1 1
MIRT007743 Socs6 suppressor of cytokine signaling 6 1 1
MIRT007744 Klf10 Kruppel-like factor 10 1 1
MIRT007745 Lsamp limbic system-associated membrane protein 1 1
MIRT007746 Adam19 a disintegrin and metallopeptidase domain 19 (meltrin beta) 1 1
MIRT007747 Cln6 ceroid-lipofuscinosis, neuronal 6 1 1
MIRT007748 Adamts8 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8 1 1
MIRT007749 Fat3 FAT atypical cadherin 3 1 1
MIRT007750 Ankrd26 ankyrin repeat domain 26 1 1
MIRT007751 Pianp PILR alpha associated neural protein 1 1
MIRT007752 Xrn1 5'-3' exoribonuclease 1 1 1
MIRT007753 Haus6 HAUS augmin-like complex, subunit 6 1 1
MIRT007754 Slc47a1 solute carrier family 47, member 1 1 1
MIRT007755 Ube3b ubiquitin protein ligase E3B 1 1
MIRT007756 Cyb5d2 cytochrome b5 domain containing 2 1 1
MIRT007757 Ppp6r3 protein phosphatase 6, regulatory subunit 3 1 1
MIRT007758 Rnf103 ring finger protein 103 1 1
MIRT007759 Ppp1r21 protein phosphatase 1, regulatory subunit 21 1 1
MIRT007760 Ankrd52 ankyrin repeat domain 52 1 1
MIRT007761 Dcbld2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT007762 Atf2 activating transcription factor 2 1 1
MIRT007763 Slc1a2 solute carrier family 1 (glial high affinity glutamate transporter), member 2 1 1
MIRT007764 Cald1 caldesmon 1 1 1
MIRT007765 Adarb1 adenosine deaminase, RNA-specific, B1 1 1
MIRT007766 AU040320 expressed sequence AU040320 1 1
MIRT007767 Nudt10 nudix (nucleoside diphosphate linked moiety X)-type motif 10 1 1
MIRT007768 Cnr1 cannabinoid receptor 1 (brain) 1 1
MIRT007769 Picalm phosphatidylinositol binding clathrin assembly protein 1 1
MIRT007770 Strip2 striatin interacting protein 2 1 1
MIRT007771 BC005537 cDNA sequence BC005537 1 1
MIRT007772 Mtss1l metastasis suppressor 1-like 1 1
MIRT007773 Polq polymerase (DNA directed), theta 1 1
MIRT007774 Msi2 musashi RNA-binding protein 2 1 1
MIRT007775 Etnk1 ethanolamine kinase 1 1 1
MIRT007776 Iqgap2 IQ motif containing GTPase activating protein 2 1 1
MIRT007777 Ythdc2 YTH domain containing 2 1 1
MIRT007778 Fcho2 FCH domain only 2 1 1
MIRT007779 Rnf128 ring finger protein 128 1 1
MIRT007780 Dynll2 dynein light chain LC8-type 2 1 1
MIRT007781 Srsf2 serine/arginine-rich splicing factor 2 1 1
MIRT007782 Htr5a 5-hydroxytryptamine (serotonin) receptor 5A 1 1
MIRT007783 Arl6ip1 ADP-ribosylation factor-like 6 interacting protein 1 1 1
MIRT007784 Cpeb4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT007785 Heg1 heart development protein with EGF-like domains 1 1 1
MIRT007786 Zkscan8 zinc finger with KRAB and SCAN domains 8 1 1
MIRT007787 Nhsl2 NHS-like 2 1 1
MIRT007788 Kdm2a lysine (K)-specific demethylase 2A 1 2
MIRT007789 Chst1 carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 1 1
MIRT007790 Fam179b TOG array regulator of axonemal microtubules 1 1 1
MIRT007791 Tmem9b TMEM9 domain family, member B 1 1
MIRT007792 Acvr1 activin A receptor, type 1 1 1
MIRT007793 Gadd45a growth arrest and DNA-damage-inducible 45 alpha 1 1
MIRT007794 Prnp prion protein 1 1
MIRT007795 Ubl3 ubiquitin-like 3 1 1
MIRT007796 Sgcb sarcoglycan, beta (dystrophin-associated glycoprotein) 1 1
MIRT007797 Npnt nephronectin 1 1
MIRT007798 Phf3 PHD finger protein 3 1 1
MIRT007799 Ap1m1 adaptor-related protein complex AP-1, mu subunit 1 1 1
MIRT007800 Dnajc9 DnaJ heat shock protein family (Hsp40) member C9 1 1
MIRT007801 Epdr1 ependymin related protein 1 (zebrafish) 1 1
MIRT007802 Usp3 ubiquitin specific peptidase 3 1 1
MIRT007803 Fam173b family with sequence similarity 173, member B 1 1
MIRT007804 Scaper S phase cyclin A-associated protein in the ER 1 1
MIRT007805 Map1b microtubule-associated protein 1B 1 1
MIRT007806 Adpgk ADP-dependent glucokinase 1 1
MIRT007807 Mlh3 mutL homolog 3 1 1
MIRT007808 B3galt2 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 1 1
MIRT007809 Brms1l breast cancer metastasis-suppressor 1-like 1 1
MIRT007810 Etv5 ets variant 5 1 1
MIRT007811 Prrg3 proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) 1 1
MIRT007812 Adh5 alcohol dehydrogenase 5 (class III), chi polypeptide 1 1
MIRT007813 Cnot10 CCR4-NOT transcription complex, subunit 10 1 1
MIRT007814 Aplp2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT007815 Cox5b cytochrome c oxidase subunit Vb 1 1
MIRT007816 Papola poly (A) polymerase alpha 1 1
MIRT007817 Setd7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT007818 Dcaf12l1 DDB1 and CUL4 associated factor 12-like 1 1 1
MIRT007819 1600012H06Rik RIKEN cDNA 1600012H06 gene 1 1
MIRT007820 Rnf11 ring finger protein 11 1 1
MIRT007821 Kif5c kinesin family member 5C 1 1
MIRT007822 Fyn Fyn proto-oncogene 1 1
MIRT007823 Cyp4x1 cytochrome P450, family 4, subfamily x, polypeptide 1 1 1
MIRT007824 Cntn3 contactin 3 1 1
MIRT007825 6030458C11Rik RIKEN cDNA 6030458C11 gene 1 1
MIRT007826 Tmem245 transmembrane protein 245 1 1
MIRT007827 Hspa12a heat shock protein 12A 1 1
MIRT007828 Syt1 synaptotagmin I 1 1
MIRT007829 Fam117b family with sequence similarity 117, member B 1 1
MIRT007830 Foxo3 forkhead box O3 1 1
MIRT007831 Sorbs2 sorbin and SH3 domain containing 2 1 1
MIRT007832 Whsc1l1 nuclear receptor binding SET domain protein 3 1 1
MIRT007833 Zmym2 zinc finger, MYM-type 2 1 1
MIRT007834 Dirc2 disrupted in renal carcinoma 2 (human) 1 1
MIRT007835 Ski ski sarcoma viral oncogene homolog (avian) 1 1
MIRT007836 Camk2n1 calcium/calmodulin-dependent protein kinase II inhibitor 1 1 1
MIRT007837 Zbtb37 zinc finger and BTB domain containing 37 1 1
MIRT007838 Zfand4 zinc finger, AN1-type domain 4 1 1
MIRT007839 Sp1 trans-acting transcription factor 1 1 1
MIRT007840 Slitrk5 SLIT and NTRK-like family, member 5 1 1
MIRT007841 Rb1 RB transcriptional corepressor 1 1 1
MIRT007842 D430041D05Rik RIKEN cDNA D430041D05 gene 1 1
MIRT007843 Lrtm2 leucine-rich repeats and transmembrane domains 2 1 1
MIRT007844 Tacc1 transforming, acidic coiled-coil containing protein 1 1 1
MIRT007845 Cav1 caveolin 1, caveolae protein 1 1
MIRT007846 Tnfrsf21 tumor necrosis factor receptor superfamily, member 21 1 1
MIRT007847 Aff4 AF4/FMR2 family, member 4 1 1
MIRT007848 Prkch protein kinase C, eta 1 1
MIRT007849 Pafah1b1 platelet-activating factor acetylhydrolase, isoform 1b, subunit 1 1 1
MIRT007850 Soga3 SOGA family member 3 1 1
MIRT007851 Suv420h1 lysine methyltransferase 5B 1 1
MIRT007852 Gng12 guanine nucleotide binding protein (G protein), gamma 12 1 1
MIRT007853 D130043K22Rik RIKEN cDNA D130043K22 gene 1 1
MIRT007854 Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 1 1
MIRT007855 Trib2 tribbles pseudokinase 2 1 1
MIRT007856 Aldh3a2 aldehyde dehydrogenase family 3, subfamily A2 1 1
MIRT007857 Znfx1 zinc finger, NFX1-type containing 1 1 1
MIRT007858 Cttnbp2nl CTTNBP2 N-terminal like 1 1
MIRT007859 Kcnt2 potassium channel, subfamily T, member 2 1 1
MIRT007860 Hmgcll1 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 1 1
MIRT007861 Fnbp1 formin binding protein 1 1 1
MIRT007862 Zfp597 zinc finger protein 597 1 1
MIRT007863 Nap1l3 nucleosome assembly protein 1-like 3 1 1
MIRT007864 Pbxip1 pre B cell leukemia transcription factor interacting protein 1 1 1
MIRT007865 Snip1 Smad nuclear interacting protein 1 1 1
MIRT007866 Lrp1b low density lipoprotein-related protein 1B (deleted in tumors) 1 1
MIRT007867 Klf9 Kruppel-like factor 9 1 1
MIRT007868 Ezh1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT007869 Enpp4 ectonucleotide pyrophosphatase/phosphodiesterase 4 1 1
MIRT007870 Patl1 protein associated with topoisomerase II homolog 1 (yeast) 1 1
MIRT007871 Grin3a glutamate receptor ionotropic, NMDA3A 1 1
MIRT007872 Map3k5 mitogen-activated protein kinase kinase kinase 5 1 1
MIRT007873 Kif5a kinesin family member 5A 1 1
MIRT007874 Golt1b golgi transport 1B 1 1
MIRT007875 Lnpep leucyl/cystinyl aminopeptidase 1 1
MIRT007876 Snn stannin 1 1
MIRT007877 Naa50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT007878 Smoc2 SPARC related modular calcium binding 2 1 1
MIRT007879 Hlf hepatic leukemia factor 1 1
MIRT007880 Txnip thioredoxin interacting protein 1 1
MIRT007881 Cep120 centrosomal protein 120 1 1
MIRT007882 Rnf216 ring finger protein 216 1 1
MIRT007883 Wdr47 WD repeat domain 47 1 1
MIRT007884 Il6st interleukin 6 signal transducer 1 1
MIRT007885 Dpysl2 dihydropyrimidinase-like 2 1 1
MIRT007886 Eogt EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase 1 1
MIRT007887 C1galt1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 1 1
MIRT007888 Ppp1cb protein phosphatase 1, catalytic subunit, beta isoform 1 1
MIRT007889 Ralbp1 ralA binding protein 1 1 1
MIRT007890 Mtmr4 myotubularin related protein 4 1 1
MIRT007891 Stam signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 1 1
MIRT007892 Zeb2 zinc finger E-box binding homeobox 2 1 1
MIRT007893 Fstl5 follistatin-like 5 1 1
MIRT007894 Stim2 stromal interaction molecule 2 1 1
MIRT007895 Inhbb inhibin beta-B 1 1
MIRT007896 Slc24a2 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 1 1
MIRT007897 Tspyl2 TSPY-like 2 1 1
MIRT007898 Szrd1 SUZ RNA binding domain containing 1 1 1
MIRT007899 Adcyap1r1 adenylate cyclase activating polypeptide 1 receptor 1 1 1
MIRT007900 Nfatc3 nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3 1 1
MIRT007901 Arhgap29 Rho GTPase activating protein 29 1 1
MIRT007902 Sec63 SEC63-like (S. cerevisiae) 1 1
MIRT007903 Gm11492 uncharacterized protein C17orf47 homolog 1 1
MIRT007904 Antxr1 anthrax toxin receptor 1 1 1
MIRT007905 Sema3c sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C 1 1
MIRT007906 Tef thyrotroph embryonic factor 1 1
MIRT007907 Gtdc2 protein O-linked mannose beta 1,4-N-acetylglucosaminyltransferase 2 1 1
MIRT007908 Gramd1a GRAM domain containing 1A 1 1
MIRT007909 Dph3 diphthamine biosynthesis 3 1 1
MIRT007910 Fkbp1b FK506 binding protein 1b 1 1
MIRT007911 Ctso cathepsin O 1 1
MIRT007912 Ednrb endothelin receptor type B 1 1
MIRT007913 Arpc4 actin related protein 2/3 complex, subunit 4 1 1
MIRT007914 Hdac8 histone deacetylase 8 1 1
MIRT007915 Scara5 scavenger receptor class A, member 5 1 1
MIRT007916 Lgals8 lectin, galactose binding, soluble 8 1 1
MIRT007917 Cacna2d1 calcium channel, voltage-dependent, alpha2/delta subunit 1 1 1
MIRT007918 Npy2r neuropeptide Y receptor Y2 1 1
MIRT007919 Scn3b sodium channel, voltage-gated, type III, beta 1 1
MIRT007920 Them6 thioesterase superfamily member 6 1 1
MIRT007921 Zfp191 zinc finger protein 24 1 1
MIRT007922 Tex2 testis expressed gene 2 1 1
MIRT007923 Auh AU RNA binding protein/enoyl-coenzyme A hydratase 1 1
MIRT007924 Frmpd4 FERM and PDZ domain containing 4 1 1
MIRT007925 Gtf2i general transcription factor II I 1 1
MIRT007926 Slc7a11 solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 1 1
MIRT007927 B4galt6 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 1 1
MIRT007928 Asxl3 additional sex combs like 3 (Drosophila) 1 1
MIRT007929 Gm6792 epididymal protein 13 1 1
MIRT007930 BC003331 cDNA sequence BC003331 1 1
MIRT007931 Ubxn4 UBX domain protein 4 1 1
MIRT007932 Gfra2 glial cell line derived neurotrophic factor family receptor alpha 2 1 1
MIRT007933 Dpp6 dipeptidylpeptidase 6 1 1
MIRT007934 Smap1 small ArfGAP 1 1 1
MIRT007935 Drd1a dopamine receptor D1 1 1
MIRT007936 Frmd4a FERM domain containing 4A 1 1
MIRT007937 Gria4 glutamate receptor, ionotropic, AMPA4 (alpha 4) 1 1
MIRT007938 Ralgps1 Ral GEF with PH domain and SH3 binding motif 1 1 1
MIRT007939 Myh10 myosin, heavy polypeptide 10, non-muscle 1 1
MIRT007940 Arhgap24 Rho GTPase activating protein 24 1 1
MIRT007941 Pros1 protein S (alpha) 1 1
MIRT007942 Cxcl14 chemokine (C-X-C motif) ligand 14 1 1
MIRT007943 Cyp46a1 cytochrome P450, family 46, subfamily a, polypeptide 1 1 1
MIRT007944 Nov nephroblastoma overexpressed gene 1 1
MIRT007945 Lamp1 lysosomal-associated membrane protein 1 1 1
MIRT007946 5730455P16Rik RIKEN cDNA 5730455P16 gene 1 1
MIRT007947 Zhx3 zinc fingers and homeoboxes 3 1 1
MIRT007948 Ldhb lactate dehydrogenase B 1 1
MIRT007949 Xpnpep3 X-prolyl aminopeptidase 3, mitochondrial 1 1
MIRT007950 Ppp2ca protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform 1 1
MIRT007951 Adam22 a disintegrin and metallopeptidase domain 22 1 1
MIRT007952 Csrnp2 cysteine-serine-rich nuclear protein 2 1 1
MIRT007953 Scamp5 secretory carrier membrane protein 5 1 1
MIRT007954 Nrarp Notch-regulated ankyrin repeat protein 1 1
MIRT007955 Rala v-ral simian leukemia viral oncogene A (ras related) 1 1
MIRT007956 Tecpr1 tectonin beta-propeller repeat containing 1 1 1
MIRT007957 Jtb jumping translocation breakpoint 1 1
MIRT007958 Nup62 nucleoporin 62 1 1
MIRT007959 Asic2 acid-sensing (proton-gated) ion channel 2 1 1
MIRT007960 Fermt2 fermitin family member 2 1 1
MIRT007961 Fbxw5 F-box and WD-40 domain protein 5 1 1
MIRT007962 Tbc1d12 TBC1D12: TBC1 domain family, member 12 1 1
MIRT007963 Rragd Ras-related GTP binding D 1 1
MIRT007964 Atp2a2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT007965 Cmtm6 CKLF-like MARVEL transmembrane domain containing 6 1 1
MIRT007966 Zbtb1 zinc finger and BTB domain containing 1 1 1
MIRT007967 Fzd6 frizzled class receptor 6 1 1
MIRT007968 Cds2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT007969 Pi4k2a phosphatidylinositol 4-kinase type 2 alpha 1 1
MIRT007970 Mfsd7c major facilitator superfamily domain containing 7C 1 1
MIRT007971 Rb1cc1 RB1-inducible coiled-coil 1 1 1
MIRT007972 Pfn2 profilin 2 1 1
MIRT007973 Ppm1l protein phosphatase 1 (formerly 2C)-like 1 1
MIRT007974 Ldlrad4 low density lipoprotein receptor class A domain containing 4 1 1
MIRT007975 Slc39a10 solute carrier family 39 (zinc transporter), member 10 1 1
MIRT007976 Mtmr12 myotubularin related protein 12 1 1
MIRT007977 Papss2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 1 1
MIRT007978 Nf1 neurofibromin 1 1 1
MIRT007979 Rasgef1a RasGEF domain family, member 1A 1 1
MIRT007980 Ficd FIC domain containing 1 1
MIRT007981 Rph3a rabphilin 3A 1 1
MIRT007982 Tgfbr1 transforming growth factor, beta receptor I 1 1
MIRT007983 Pea15a phosphoprotein enriched in astrocytes 15A 1 1
MIRT007984 Ywhab tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 1 1
MIRT007985 Pcnx pecanex homolog (Drosophila) 1 1
MIRT007986 Btbd7 BTB (POZ) domain containing 7 1 1
MIRT007987 Wnk1 WNK lysine deficient protein kinase 1 1 1
MIRT007988 Nfya nuclear transcription factor-Y alpha 1 1
MIRT007989 Zmat3 zinc finger matrin type 3 1 1
MIRT007990 Pex11a peroxisomal biogenesis factor 11 alpha 1 1
MIRT007991 Cds1 CDP-diacylglycerol synthase 1 1 1
MIRT007992 Tnpo1 transportin 1 1 1
MIRT007993 Epc2 enhancer of polycomb homolog 2 (Drosophila) 1 1
MIRT007994 Npat nuclear protein in the AT region 1 1
MIRT007995 Parg poly (ADP-ribose) glycohydrolase 1 1
MIRT007996 Slc24a3 solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 1 1
MIRT007997 Sel1l3 sel-1 suppressor of lin-12-like 3 (C. elegans) 1 1
MIRT007998 Mul1 mitochondrial ubiquitin ligase activator of NFKB 1 1 1
MIRT007999 Srrm2 serine/arginine repetitive matrix 2 1 1
MIRT008000 Ndufs4 NADH dehydrogenase (ubiquinone) Fe-S protein 4 1 1
MIRT008001 Sh3rf3 SH3 domain containing ring finger 3 1 1
MIRT008002 Psme4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT008003 Sept4 septin 4 1 1
MIRT008004 Simc1 SUMO-interacting motifs containing 1 1 1
MIRT008005 Ppm1d protein phosphatase 1D magnesium-dependent, delta isoform 1 1
MIRT008006 Eno2 enolase 2, gamma neuronal 1 1
MIRT008007 Galc galactosylceramidase 1 1
MIRT008008 Clu clusterin 1 1
MIRT008009 Stxbp5l syntaxin binding protein 5-like 1 1
MIRT008010 Mgll monoglyceride lipase 1 1
MIRT008011 Fam175b BRISC complex subunit 1 1
MIRT008012 Grin2b glutamate receptor, ionotropic, NMDA2B (epsilon 2) 1 1
MIRT008013 Pigk phosphatidylinositol glycan anchor biosynthesis, class K 1 1
MIRT008014 Dcun1d2 DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) 1 1
MIRT008015 Atp6v1h ATPase, H+ transporting, lysosomal V1 subunit H 1 1
MIRT008016 Zdhhc8 zinc finger, DHHC domain containing 8 1 1
MIRT008017 Incenp inner centromere protein 1 1
MIRT008018 Kif21a kinesin family member 21A 1 1
MIRT008019 Usp33 ubiquitin specific peptidase 33 1 1
MIRT008020 4930506M07Rik shootin 1 1 1
MIRT008021 Arel1 apoptosis resistant E3 ubiquitin protein ligase 1 1 1
MIRT008022 Nfia nuclear factor I/A 1 2
MIRT008023 Pygo2 pygopus 2 1 1
MIRT008024 Mtmr6 myotubularin related protein 6 1 1
MIRT008025 Rab11b RAB11B, member RAS oncogene family 1 1
MIRT008026 Pvr poliovirus receptor 1 1
MIRT008027 D4Wsu53e arginine/serine rich protein 1 1 1
MIRT008028 Nudcd3 NudC domain containing 3 1 1
MIRT008029 Gpr158 G protein-coupled receptor 158 1 1
MIRT008030 Cdc42bpa CDC42 binding protein kinase alpha 1 1
MIRT008031 Gabbr2 gamma-aminobutyric acid (GABA) B receptor, 2 1 1
MIRT008032 Grem2 gremlin 2, DAN family BMP antagonist 1 1
MIRT008033 Car12 carbonic anhydrase 12 1 1
MIRT008034 Ldlr low density lipoprotein receptor 1 1
MIRT008035 Zcchc24 zinc finger, CCHC domain containing 24 1 1
MIRT008036 Rgs7bp regulator of G-protein signalling 7 binding protein 1 1
MIRT008037 Pde4b phosphodiesterase 4B, cAMP specific 1 1
MIRT008038 Atrn attractin 1 1
MIRT008039 Pank1 pantothenate kinase 1 1 1
MIRT008040 Mfap3l microfibrillar-associated protein 3-like 1 1
MIRT008041 Stard13 StAR-related lipid transfer (START) domain containing 13 1 1
MIRT008042 Tenm3 teneurin transmembrane protein 3 1 1
MIRT008043 Gpcpd1 glycerophosphocholine phosphodiesterase 1 1 1
MIRT008044 Slc17a7 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 1 1
MIRT008045 Rgma repulsive guidance molecule family member A 1 1
MIRT008046 Ttyh3 tweety family member 3 1 1
MIRT008047 Nfix nuclear factor I/X 1 1
MIRT008048 Glrx5 glutaredoxin 5 1 1
MIRT008049 Ankra2 ankyrin repeat, family A (RFXANK-like), 2 1 1
MIRT008050 Hpca hippocalcin 1 1
MIRT008051 Ing2 inhibitor of growth family, member 2 1 1
MIRT008052 Rab10 RAB10, member RAS oncogene family 1 1
MIRT008053 N4bp1 NEDD4 binding protein 1 1 1
MIRT008054 B3galnt1 UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 1 1
MIRT008055 Trove2 TROVE domain family, member 2 1 1
MIRT008056 Kcna1 potassium voltage-gated channel, shaker-related subfamily, member 1 1 1
MIRT008057 Tmcc1 transmembrane and coiled coil domains 1 1 1
MIRT008058 Fam184a family with sequence similarity 184, member A 1 1
MIRT008059 Adam10 a disintegrin and metallopeptidase domain 10 1 1
MIRT008060 Esyt2 extended synaptotagmin-like protein 2 1 1
MIRT008061 Rab11fip4 RAB11 family interacting protein 4 (class II) 1 1
MIRT008062 Errfi1 ERBB receptor feedback inhibitor 1 1 1
MIRT008063 Zfp275 zinc finger protein 275 1 1
MIRT008064 Psd3 pleckstrin and Sec7 domain containing 3 1 1
MIRT008065 Grb10 growth factor receptor bound protein 10 1 1
MIRT008066 Slc35f3 solute carrier family 35, member F3 1 1
MIRT008067 Hecw2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT008068 Taok1 TAO kinase 1 1 1
MIRT008069 St8sia3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 1 1
MIRT008070 Ccdc88a coiled coil domain containing 88A 1 1
MIRT008071 Enpp5 ectonucleotide pyrophosphatase/phosphodiesterase 5 1 1
MIRT008072 Lrch1 leucine-rich repeats and calponin homology (CH) domain containing 1 1 1
MIRT008073 Jmy junction-mediating and regulatory protein 1 1
MIRT008074 Sall3 sal-like 3 (Drosophila) 1 1
MIRT008075 Cltc clathrin, heavy polypeptide (Hc) 1 1
MIRT008076 Hprt hypoxanthine guanine phosphoribosyl transferase 1 1
MIRT008077 Csmd1 CUB and Sushi multiple domains 1 1 1
MIRT008078 Cblb Casitas B-lineage lymphoma b 1 1
MIRT008079 Abl2 v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) 1 1
MIRT008080 Zfp217 zinc finger protein 217 1 1
MIRT008081 Arap2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT008082 Reps2 RALBP1 associated Eps domain containing protein 2 1 1
MIRT008083 Klf7 Kruppel-like factor 7 (ubiquitous) 1 1
MIRT008084 Sik1 salt inducible kinase 1 1 1
MIRT008085 Apcdd1 adenomatosis polyposis coli down-regulated 1 1 1
MIRT008086 Robo1 roundabout guidance receptor 1 1 1
MIRT008087 Rnf38 ring finger protein 38 1 1
MIRT008088 Agfg1 ArfGAP with FG repeats 1 1 1
MIRT008089 Abca1 ATP-binding cassette, sub-family A (ABC1), member 1 1 1
MIRT008090 Arhgap21 Rho GTPase activating protein 21 1 1
MIRT008091 Sh3d19 SH3 domain protein D19 1 1
MIRT008092 Skida1 SKI/DACH domain containing 1 1 1
MIRT580367 Tmem25 transmembrane protein 25 1 1
MIRT580803 Snx27 sorting nexin family member 27 1 1
MIRT590619 Arrdc3 arrestin domain containing 3 1 1
MIRT590763 Acbd5 acyl-Coenzyme A binding domain containing 5 1 1
MIRT592544 Mup7 major urinary protein 7 1 1
MIRT592587 Mup13 major urinary protein 13 1 1
MIRT595105 Timp2 tissue inhibitor of metalloproteinase 2 1 1
MIRT595361 Fgfr1op2 FGFR1 oncogene partner 2 1 1
MIRT600787 Homez homeodomain leucine zipper-encoding gene 1 1
MIRT604877 Map3k12 mitogen-activated protein kinase kinase kinase 12 1 1
MIRT606371 Inpp5e inositol polyphosphate-5-phosphatase E 1 1
MIRT755742 Nos2 nitric oxide synthase 2, inducible 1 1
MIRT755743 Arg2 arginase type II 1 1
MIRT755747 Tnf tumor necrosis factor 1 1

Error report submission