pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-301b |
Genomic Coordinates | chr16: 17124400 - 17124496 |
Synonyms | Mirn301b, mir-301b, Mir301b |
Description | Mus musculus miR-301b stem-loop |
Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-301b-3p |
Sequence | 55| CAGUGCAAUGGUAUUGUCAAAGC |77 |
Evidence | Experimental |
Experiments | MiRAP-cloned |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Nup62 | ||||||||||||||||||||
Synonyms | D7Ertd649e, Nupc1, p62 | ||||||||||||||||||||
Description | nucleoporin 62 | ||||||||||||||||||||
Transcript | NM_053074 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Nup62 | |||||||||||||||||||||
3'UTR of Nup62 (miRNA target sites are highlighted) |
>Nup62|NM_053074|3'UTR 1 CCACGCGTGAGTGGGGGGAGGGGCTCCTTGGGTTGCAGGGCTGCTGCCTTTCCCGTGGTTGGTTGTTGAGAAAAATGCTC 81 TTTGTTTTGATTCCCTGTTATCAGAAGTGTTTTGCAAAGGCATGATGTTCATGGATATAACCTGTGTGCTCTGGAGACCA 161 ATGTGAAGGTCACTGAACTCTCGGCCAGCATTTAAAGAACAAGGGCAAGTGGTGAATCCAGCGCTCCCTTGCAAGCTTCA 241 GCTCTCCTTGTGGCAGAACTCATCCTTCAGCCACTCCAGTACTACTGTGAGGGTGGATAGGTGCTCCAGACGAGAGACTC 321 ACCTGGGGTGGAGACAGGCTTCTGTGCGTCTCTAATTCCTGTCAAGCCCGTGTCCTCCAGAGGCTCTGGCACATAGAGTG 401 GAGTCACCAAAGCACCACTTTTGCACTGGCTACCTCTCACTCCTATCTTGTGCGCTTCTGTGGCAGGGACTGACTGCTGA 481 TACGTCTTTGAGGCCAAAGTGGATGCAGATTTGCTTCTGAATATCCCAGTGTCAAACCTATCTTAGATCCACAGTGGTGA 561 AGCTGGCAGTCATGTCTATTTTATTTCTCTGCACTCTATTGTAGCCTTTGTGGTCCCTGATCAAAATGTTTGTTGCTTTT 641 CTAAATAAAGGAAGATTTGTGAAACCAGACTTGCTGTGAGTATGGGTAGTGGGTCCAAGCTTTGGCAGGATAGGGCAGGA 721 CACAGCTGGTGTGGTGGTGGTACTCCTATGCCGCCCGGGTTGGAAGCGCTGGCTGAGCCATAGGGCCCAGTCTCTACCTT 801 CATGGGGTGGGCAGGCTGCAGGTGTGAGAAGAGTCCTGTCTACCATTGTGCCTAAGTGGTAAGTCATCCATTACCCTAAT 881 ACGTGCAGGTGTCATTGTGATGTCATCAGCAGTGGGAAATGAACACTGAGGGGTGATTTCCAGATGCTGGTCTCACTTAG 961 GCCCGGCACTTGGCTATAGGACTGGGGGACCTTGAACCAGCAGTGGGGCCACTTGGGTCATGTTGGGTCATGTTGGCACA 1041 GGAGAAAGCTGGGGGTGGGATGAGCGGCTAGATAGAGAGGTAGTCGCTCAGTGGCTAAGAACACAGGTTGGCTGCTCTTC 1121 CAAGGACAGGACCCTATTTTGATTCAATGCACCCACGTGGTAGCTTACAACCACCCTGTAATTCAGTCCCAGGTTATCTG 1201 ACCTCTTCTGGGCAGCTTGGGTACCGTCTGCACATAGTGCAGAGATACACATGTAGGCAGAGTCATAAAATCTCAAAGCG 1281 TAAAGAACTGGCATTGTGAACGCCTGTCACCCCAGTACTCTGGAATTCCAGATCATCTTGAACTACATTGCTACATAACC 1361 ACGTAGAGGCAGGGCCAGTGAACTGGGAGGACGCAAGTCCTGACGACCCCAGTGGCCTTCCTGTGATGTGTGACATTTCA 1441 TTGGTCTAAGACAGGATCCCCCCACTCTAGCCCAAGTTCTTGAATTGTTGTGAACTTCCTGCCTTAGCCACCTAAGCTCT 1521 AAGACTATGGGCAAGACACTACAGCCCAGCCCTGCACTCCATGACTTGACTCCCAATTGATTATGATGCTTAGGTCTCAG 1601 TTCCTCTAAAGATGTGTCTTATATACATGATTGTCATTGGTGGGCTCAAACAATAAGGGTGTGCGTTTTAATAAAAATGC 1681 ATTTTAATGTGTG Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
392 mmu-miR-301b-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT006125 | Meox1 | mesenchyme homeobox 1 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT007716 | Tmx4 | thioredoxin-related transmembrane protein 4 | ![]() |
1 | 1 | |||||||
MIRT007717 | Sephs1 | selenophosphate synthetase 1 | ![]() |
1 | 1 | |||||||
MIRT007718 | Mprip | myosin phosphatase Rho interacting protein | ![]() |
1 | 1 | |||||||
MIRT007719 | Usp32 | ubiquitin specific peptidase 32 | ![]() |
1 | 1 | |||||||
MIRT007720 | Zdhhc20 | zinc finger, DHHC domain containing 20 | ![]() |
1 | 1 | |||||||
MIRT007721 | Traf3 | TNF receptor-associated factor 3 | ![]() |
1 | 1 | |||||||
MIRT007722 | Cd81 | CD81 antigen | ![]() |
1 | 1 | |||||||
MIRT007723 | Tspan9 | tetraspanin 9 | ![]() |
1 | 1 | |||||||
MIRT007724 | Itm2b | integral membrane protein 2B | ![]() |
1 | 1 | |||||||
MIRT007725 | Ubap2l | ubiquitin-associated protein 2-like | ![]() |
1 | 2 | |||||||
MIRT007726 | Slc9a2 | solute carrier family 9 (sodium/hydrogen exchanger), member 2 | ![]() |
1 | 1 | |||||||
MIRT007727 | Pik3c2b | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta | ![]() |
1 | 1 | |||||||
MIRT007728 | Arxes2 | adipocyte-related X-chromosome expressed sequence 2 | ![]() |
1 | 1 | |||||||
MIRT007729 | Lrrc55 | leucine rich repeat containing 55 | ![]() |
1 | 1 | |||||||
MIRT007730 | Fam63b | MINDY lysine 48 deubiquitinase 2 | ![]() |
1 | 1 | |||||||
MIRT007731 | Wdr44 | WD repeat domain 44 | ![]() |
1 | 1 | |||||||
MIRT007732 | Cdc42 | cell division cycle 42 | ![]() |
1 | 1 | |||||||
MIRT007733 | Zfp41 | zinc finger protein 41 | ![]() |
1 | 1 | |||||||
MIRT007734 | Sema4g | sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G | ![]() |
1 | 1 | |||||||
MIRT007735 | Mcm7 | minichromosome maintenance complex component 7 | ![]() |
1 | 1 | |||||||
MIRT007736 | Tmed4 | transmembrane p24 trafficking protein 4 | ![]() |
1 | 1 | |||||||
MIRT007737 | Gid4 | GID complex subunit 4, VID24 homolog | ![]() |
1 | 1 | |||||||
MIRT007738 | Cep112 | centrosomal protein 112 | ![]() |
1 | 1 | |||||||
MIRT007739 | Slc17a6 | solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 | ![]() |
1 | 1 | |||||||
MIRT007740 | Cmtm3 | CKLF-like MARVEL transmembrane domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT007741 | Dsel | dermatan sulfate epimerase-like | ![]() |
1 | 1 | |||||||
MIRT007742 | Aspscr1 | alveolar soft part sarcoma chromosome region, candidate 1 (human) | ![]() |
1 | 1 | |||||||
MIRT007743 | Socs6 | suppressor of cytokine signaling 6 | ![]() |
1 | 1 | |||||||
MIRT007744 | Klf10 | Kruppel-like factor 10 | ![]() |
1 | 1 | |||||||
MIRT007745 | Lsamp | limbic system-associated membrane protein | ![]() |
1 | 1 | |||||||
MIRT007746 | Adam19 | a disintegrin and metallopeptidase domain 19 (meltrin beta) | ![]() |
1 | 1 | |||||||
MIRT007747 | Cln6 | ceroid-lipofuscinosis, neuronal 6 | ![]() |
1 | 1 | |||||||
MIRT007748 | Adamts8 | a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8 | ![]() |
1 | 1 | |||||||
MIRT007749 | Fat3 | FAT atypical cadherin 3 | ![]() |
1 | 1 | |||||||
MIRT007750 | Ankrd26 | ankyrin repeat domain 26 | ![]() |
1 | 1 | |||||||
MIRT007751 | Pianp | PILR alpha associated neural protein | ![]() |
1 | 1 | |||||||
MIRT007752 | Xrn1 | 5'-3' exoribonuclease 1 | ![]() |
1 | 1 | |||||||
MIRT007753 | Haus6 | HAUS augmin-like complex, subunit 6 | ![]() |
1 | 1 | |||||||
MIRT007754 | Slc47a1 | solute carrier family 47, member 1 | ![]() |
1 | 1 | |||||||
MIRT007755 | Ube3b | ubiquitin protein ligase E3B | ![]() |
1 | 1 | |||||||
MIRT007756 | Cyb5d2 | cytochrome b5 domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT007757 | Ppp6r3 | protein phosphatase 6, regulatory subunit 3 | ![]() |
1 | 1 | |||||||
MIRT007758 | Rnf103 | ring finger protein 103 | ![]() |
1 | 1 | |||||||
MIRT007759 | Ppp1r21 | protein phosphatase 1, regulatory subunit 21 | ![]() |
1 | 1 | |||||||
MIRT007760 | Ankrd52 | ankyrin repeat domain 52 | ![]() |
1 | 1 | |||||||
MIRT007761 | Dcbld2 | discoidin, CUB and LCCL domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT007762 | Atf2 | activating transcription factor 2 | ![]() |
1 | 1 | |||||||
MIRT007763 | Slc1a2 | solute carrier family 1 (glial high affinity glutamate transporter), member 2 | ![]() |
1 | 1 | |||||||
MIRT007764 | Cald1 | caldesmon 1 | ![]() |
1 | 1 | |||||||
MIRT007765 | Adarb1 | adenosine deaminase, RNA-specific, B1 | ![]() |
1 | 1 | |||||||
MIRT007766 | AU040320 | expressed sequence AU040320 | ![]() |
1 | 1 | |||||||
MIRT007767 | Nudt10 | nudix (nucleoside diphosphate linked moiety X)-type motif 10 | ![]() |
1 | 1 | |||||||
MIRT007768 | Cnr1 | cannabinoid receptor 1 (brain) | ![]() |
1 | 1 | |||||||
MIRT007769 | Picalm | phosphatidylinositol binding clathrin assembly protein | ![]() |
1 | 1 | |||||||
MIRT007770 | Strip2 | striatin interacting protein 2 | ![]() |
1 | 1 | |||||||
MIRT007771 | BC005537 | cDNA sequence BC005537 | ![]() |
1 | 1 | |||||||
MIRT007772 | Mtss1l | metastasis suppressor 1-like | ![]() |
1 | 1 | |||||||
MIRT007773 | Polq | polymerase (DNA directed), theta | ![]() |
1 | 1 | |||||||
MIRT007774 | Msi2 | musashi RNA-binding protein 2 | ![]() |
1 | 1 | |||||||
MIRT007775 | Etnk1 | ethanolamine kinase 1 | ![]() |
1 | 1 | |||||||
MIRT007776 | Iqgap2 | IQ motif containing GTPase activating protein 2 | ![]() |
1 | 1 | |||||||
MIRT007777 | Ythdc2 | YTH domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT007778 | Fcho2 | FCH domain only 2 | ![]() |
1 | 1 | |||||||
MIRT007779 | Rnf128 | ring finger protein 128 | ![]() |
1 | 1 | |||||||
MIRT007780 | Dynll2 | dynein light chain LC8-type 2 | ![]() |
1 | 1 | |||||||
MIRT007781 | Srsf2 | serine/arginine-rich splicing factor 2 | ![]() |
1 | 1 | |||||||
MIRT007782 | Htr5a | 5-hydroxytryptamine (serotonin) receptor 5A | ![]() |
1 | 1 | |||||||
MIRT007783 | Arl6ip1 | ADP-ribosylation factor-like 6 interacting protein 1 | ![]() |
1 | 1 | |||||||
MIRT007784 | Cpeb4 | cytoplasmic polyadenylation element binding protein 4 | ![]() |
1 | 1 | |||||||
MIRT007785 | Heg1 | heart development protein with EGF-like domains 1 | ![]() |
1 | 1 | |||||||
MIRT007786 | Zkscan8 | zinc finger with KRAB and SCAN domains 8 | ![]() |
1 | 1 | |||||||
MIRT007787 | Nhsl2 | NHS-like 2 | ![]() |
1 | 1 | |||||||
MIRT007788 | Kdm2a | lysine (K)-specific demethylase 2A | ![]() |
1 | 2 | |||||||
MIRT007789 | Chst1 | carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 | ![]() |
1 | 1 | |||||||
MIRT007790 | Fam179b | TOG array regulator of axonemal microtubules 1 | ![]() |
1 | 1 | |||||||
MIRT007791 | Tmem9b | TMEM9 domain family, member B | ![]() |
1 | 1 | |||||||
MIRT007792 | Acvr1 | activin A receptor, type 1 | ![]() |
1 | 1 | |||||||
MIRT007793 | Gadd45a | growth arrest and DNA-damage-inducible 45 alpha | ![]() |
1 | 1 | |||||||
MIRT007794 | Prnp | prion protein | ![]() |
1 | 1 | |||||||
MIRT007795 | Ubl3 | ubiquitin-like 3 | ![]() |
1 | 1 | |||||||
MIRT007796 | Sgcb | sarcoglycan, beta (dystrophin-associated glycoprotein) | ![]() |
1 | 1 | |||||||
MIRT007797 | Npnt | nephronectin | ![]() |
1 | 1 | |||||||
MIRT007798 | Phf3 | PHD finger protein 3 | ![]() |
1 | 1 | |||||||
MIRT007799 | Ap1m1 | adaptor-related protein complex AP-1, mu subunit 1 | ![]() |
1 | 1 | |||||||
MIRT007800 | Dnajc9 | DnaJ heat shock protein family (Hsp40) member C9 | ![]() |
1 | 1 | |||||||
MIRT007801 | Epdr1 | ependymin related protein 1 (zebrafish) | ![]() |
1 | 1 | |||||||
MIRT007802 | Usp3 | ubiquitin specific peptidase 3 | ![]() |
1 | 1 | |||||||
MIRT007803 | Fam173b | family with sequence similarity 173, member B | ![]() |
1 | 1 | |||||||
MIRT007804 | Scaper | S phase cyclin A-associated protein in the ER | ![]() |
1 | 1 | |||||||
MIRT007805 | Map1b | microtubule-associated protein 1B | ![]() |
1 | 1 | |||||||
MIRT007806 | Adpgk | ADP-dependent glucokinase | ![]() |
1 | 1 | |||||||
MIRT007807 | Mlh3 | mutL homolog 3 | ![]() |
1 | 1 | |||||||
MIRT007808 | B3galt2 | UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 | ![]() |
1 | 1 | |||||||
MIRT007809 | Brms1l | breast cancer metastasis-suppressor 1-like | ![]() |
1 | 1 | |||||||
MIRT007810 | Etv5 | ets variant 5 | ![]() |
1 | 1 | |||||||
MIRT007811 | Prrg3 | proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) | ![]() |
1 | 1 | |||||||
MIRT007812 | Adh5 | alcohol dehydrogenase 5 (class III), chi polypeptide | ![]() |
1 | 1 | |||||||
MIRT007813 | Cnot10 | CCR4-NOT transcription complex, subunit 10 | ![]() |
1 | 1 | |||||||
MIRT007814 | Aplp2 | amyloid beta (A4) precursor-like protein 2 | ![]() |
1 | 1 | |||||||
MIRT007815 | Cox5b | cytochrome c oxidase subunit Vb | ![]() |
1 | 1 | |||||||
MIRT007816 | Papola | poly (A) polymerase alpha | ![]() |
1 | 1 | |||||||
MIRT007817 | Setd7 | SET domain containing (lysine methyltransferase) 7 | ![]() |
1 | 1 | |||||||
MIRT007818 | Dcaf12l1 | DDB1 and CUL4 associated factor 12-like 1 | ![]() |
1 | 1 | |||||||
MIRT007819 | 1600012H06Rik | RIKEN cDNA 1600012H06 gene | ![]() |
1 | 1 | |||||||
MIRT007820 | Rnf11 | ring finger protein 11 | ![]() |
1 | 1 | |||||||
MIRT007821 | Kif5c | kinesin family member 5C | ![]() |
1 | 1 | |||||||
MIRT007822 | Fyn | Fyn proto-oncogene | ![]() |
1 | 1 | |||||||
MIRT007823 | Cyp4x1 | cytochrome P450, family 4, subfamily x, polypeptide 1 | ![]() |
1 | 1 | |||||||
MIRT007824 | Cntn3 | contactin 3 | ![]() |
1 | 1 | |||||||
MIRT007825 | 6030458C11Rik | RIKEN cDNA 6030458C11 gene | ![]() |
1 | 1 | |||||||
MIRT007826 | Tmem245 | transmembrane protein 245 | ![]() |
1 | 1 | |||||||
MIRT007827 | Hspa12a | heat shock protein 12A | ![]() |
1 | 1 | |||||||
MIRT007828 | Syt1 | synaptotagmin I | ![]() |
1 | 1 | |||||||
MIRT007829 | Fam117b | family with sequence similarity 117, member B | ![]() |
1 | 1 | |||||||
MIRT007830 | Foxo3 | forkhead box O3 | ![]() |
1 | 1 | |||||||
MIRT007831 | Sorbs2 | sorbin and SH3 domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT007832 | Whsc1l1 | nuclear receptor binding SET domain protein 3 | ![]() |
1 | 1 | |||||||
MIRT007833 | Zmym2 | zinc finger, MYM-type 2 | ![]() |
1 | 1 | |||||||
MIRT007834 | Dirc2 | disrupted in renal carcinoma 2 (human) | ![]() |
1 | 1 | |||||||
MIRT007835 | Ski | ski sarcoma viral oncogene homolog (avian) | ![]() |
1 | 1 | |||||||
MIRT007836 | Camk2n1 | calcium/calmodulin-dependent protein kinase II inhibitor 1 | ![]() |
1 | 1 | |||||||
MIRT007837 | Zbtb37 | zinc finger and BTB domain containing 37 | ![]() |
1 | 1 | |||||||
MIRT007838 | Zfand4 | zinc finger, AN1-type domain 4 | ![]() |
1 | 1 | |||||||
MIRT007839 | Sp1 | trans-acting transcription factor 1 | ![]() |
1 | 1 | |||||||
MIRT007840 | Slitrk5 | SLIT and NTRK-like family, member 5 | ![]() |
1 | 1 | |||||||
MIRT007841 | Rb1 | RB transcriptional corepressor 1 | ![]() |
1 | 1 | |||||||
MIRT007842 | D430041D05Rik | RIKEN cDNA D430041D05 gene | ![]() |
1 | 1 | |||||||
MIRT007843 | Lrtm2 | leucine-rich repeats and transmembrane domains 2 | ![]() |
1 | 1 | |||||||
MIRT007844 | Tacc1 | transforming, acidic coiled-coil containing protein 1 | ![]() |
1 | 1 | |||||||
MIRT007845 | Cav1 | caveolin 1, caveolae protein | ![]() |
1 | 1 | |||||||
MIRT007846 | Tnfrsf21 | tumor necrosis factor receptor superfamily, member 21 | ![]() |
1 | 1 | |||||||
MIRT007847 | Aff4 | AF4/FMR2 family, member 4 | ![]() |
1 | 1 | |||||||
MIRT007848 | Prkch | protein kinase C, eta | ![]() |
1 | 1 | |||||||
MIRT007849 | Pafah1b1 | platelet-activating factor acetylhydrolase, isoform 1b, subunit 1 | ![]() |
1 | 1 | |||||||
MIRT007850 | Soga3 | SOGA family member 3 | ![]() |
1 | 1 | |||||||
MIRT007851 | Suv420h1 | lysine methyltransferase 5B | ![]() |
1 | 1 | |||||||
MIRT007852 | Gng12 | guanine nucleotide binding protein (G protein), gamma 12 | ![]() |
1 | 1 | |||||||
MIRT007853 | D130043K22Rik | RIKEN cDNA D130043K22 gene | ![]() |
1 | 1 | |||||||
MIRT007854 | Atp2b2 | ATPase, Ca++ transporting, plasma membrane 2 | ![]() |
1 | 1 | |||||||
MIRT007855 | Trib2 | tribbles pseudokinase 2 | ![]() |
1 | 1 | |||||||
MIRT007856 | Aldh3a2 | aldehyde dehydrogenase family 3, subfamily A2 | ![]() |
1 | 1 | |||||||
MIRT007857 | Znfx1 | zinc finger, NFX1-type containing 1 | ![]() |
1 | 1 | |||||||
MIRT007858 | Cttnbp2nl | CTTNBP2 N-terminal like | ![]() |
1 | 1 | |||||||
MIRT007859 | Kcnt2 | potassium channel, subfamily T, member 2 | ![]() |
1 | 1 | |||||||
MIRT007860 | Hmgcll1 | 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 | ![]() |
1 | 1 | |||||||
MIRT007861 | Fnbp1 | formin binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT007862 | Zfp597 | zinc finger protein 597 | ![]() |
1 | 1 | |||||||
MIRT007863 | Nap1l3 | nucleosome assembly protein 1-like 3 | ![]() |
1 | 1 | |||||||
MIRT007864 | Pbxip1 | pre B cell leukemia transcription factor interacting protein 1 | ![]() |
1 | 1 | |||||||
MIRT007865 | Snip1 | Smad nuclear interacting protein 1 | ![]() |
1 | 1 | |||||||
MIRT007866 | Lrp1b | low density lipoprotein-related protein 1B (deleted in tumors) | ![]() |
1 | 1 | |||||||
MIRT007867 | Klf9 | Kruppel-like factor 9 | ![]() |
1 | 1 | |||||||
MIRT007868 | Ezh1 | enhancer of zeste 1 polycomb repressive complex 2 subunit | ![]() |
1 | 1 | |||||||
MIRT007869 | Enpp4 | ectonucleotide pyrophosphatase/phosphodiesterase 4 | ![]() |
1 | 1 | |||||||
MIRT007870 | Patl1 | protein associated with topoisomerase II homolog 1 (yeast) | ![]() |
1 | 1 | |||||||
MIRT007871 | Grin3a | glutamate receptor ionotropic, NMDA3A | ![]() |
1 | 1 | |||||||
MIRT007872 | Map3k5 | mitogen-activated protein kinase kinase kinase 5 | ![]() |
1 | 1 | |||||||
MIRT007873 | Kif5a | kinesin family member 5A | ![]() |
1 | 1 | |||||||
MIRT007874 | Golt1b | golgi transport 1B | ![]() |
1 | 1 | |||||||
MIRT007875 | Lnpep | leucyl/cystinyl aminopeptidase | ![]() |
1 | 1 | |||||||
MIRT007876 | Snn | stannin | ![]() |
1 | 1 | |||||||
MIRT007877 | Naa50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | ![]() |
1 | 1 | |||||||
MIRT007878 | Smoc2 | SPARC related modular calcium binding 2 | ![]() |
1 | 1 | |||||||
MIRT007879 | Hlf | hepatic leukemia factor | ![]() |
1 | 1 | |||||||
MIRT007880 | Txnip | thioredoxin interacting protein | ![]() |
1 | 1 | |||||||
MIRT007881 | Cep120 | centrosomal protein 120 | ![]() |
1 | 1 | |||||||
MIRT007882 | Rnf216 | ring finger protein 216 | ![]() |
1 | 1 | |||||||
MIRT007883 | Wdr47 | WD repeat domain 47 | ![]() |
1 | 1 | |||||||
MIRT007884 | Il6st | interleukin 6 signal transducer | ![]() |
1 | 1 | |||||||
MIRT007885 | Dpysl2 | dihydropyrimidinase-like 2 | ![]() |
1 | 1 | |||||||
MIRT007886 | Eogt | EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase | ![]() |
1 | 1 | |||||||
MIRT007887 | C1galt1 | core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 | ![]() |
1 | 1 | |||||||
MIRT007888 | Ppp1cb | protein phosphatase 1, catalytic subunit, beta isoform | ![]() |
1 | 1 | |||||||
MIRT007889 | Ralbp1 | ralA binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT007890 | Mtmr4 | myotubularin related protein 4 | ![]() |
1 | 1 | |||||||
MIRT007891 | Stam | signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 | ![]() |
1 | 1 | |||||||
MIRT007892 | Zeb2 | zinc finger E-box binding homeobox 2 | ![]() |
1 | 1 | |||||||
MIRT007893 | Fstl5 | follistatin-like 5 | ![]() |
1 | 1 | |||||||
MIRT007894 | Stim2 | stromal interaction molecule 2 | ![]() |
1 | 1 | |||||||
MIRT007895 | Inhbb | inhibin beta-B | ![]() |
1 | 1 | |||||||
MIRT007896 | Slc24a2 | solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 | ![]() |
1 | 1 | |||||||
MIRT007897 | Tspyl2 | TSPY-like 2 | ![]() |
1 | 1 | |||||||
MIRT007898 | Szrd1 | SUZ RNA binding domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT007899 | Adcyap1r1 | adenylate cyclase activating polypeptide 1 receptor 1 | ![]() |
1 | 1 | |||||||
MIRT007900 | Nfatc3 | nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3 | ![]() |
1 | 1 | |||||||
MIRT007901 | Arhgap29 | Rho GTPase activating protein 29 | ![]() |
1 | 1 | |||||||
MIRT007902 | Sec63 | SEC63-like (S. cerevisiae) | ![]() |
1 | 1 | |||||||
MIRT007903 | Gm11492 | uncharacterized protein C17orf47 homolog | ![]() |
1 | 1 | |||||||
MIRT007904 | Antxr1 | anthrax toxin receptor 1 | ![]() |
1 | 1 | |||||||
MIRT007905 | Sema3c | sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C | ![]() |
1 | 1 | |||||||
MIRT007906 | Tef | thyrotroph embryonic factor | ![]() |
1 | 1 | |||||||
MIRT007907 | Gtdc2 | protein O-linked mannose beta 1,4-N-acetylglucosaminyltransferase 2 | ![]() |
1 | 1 | |||||||
MIRT007908 | Gramd1a | GRAM domain containing 1A | ![]() |
1 | 1 | |||||||
MIRT007909 | Dph3 | diphthamine biosynthesis 3 | ![]() |
1 | 1 | |||||||
MIRT007910 | Fkbp1b | FK506 binding protein 1b | ![]() |
1 | 1 | |||||||
MIRT007911 | Ctso | cathepsin O | ![]() |
1 | 1 | |||||||
MIRT007912 | Ednrb | endothelin receptor type B | ![]() |
1 | 1 | |||||||
MIRT007913 | Arpc4 | actin related protein 2/3 complex, subunit 4 | ![]() |
1 | 1 | |||||||
MIRT007914 | Hdac8 | histone deacetylase 8 | ![]() |
1 | 1 | |||||||
MIRT007915 | Scara5 | scavenger receptor class A, member 5 | ![]() |
1 | 1 | |||||||
MIRT007916 | Lgals8 | lectin, galactose binding, soluble 8 | ![]() |
1 | 1 | |||||||
MIRT007917 | Cacna2d1 | calcium channel, voltage-dependent, alpha2/delta subunit 1 | ![]() |
1 | 1 | |||||||
MIRT007918 | Npy2r | neuropeptide Y receptor Y2 | ![]() |
1 | 1 | |||||||
MIRT007919 | Scn3b | sodium channel, voltage-gated, type III, beta | ![]() |
1 | 1 | |||||||
MIRT007920 | Them6 | thioesterase superfamily member 6 | ![]() |
1 | 1 | |||||||
MIRT007921 | Zfp191 | zinc finger protein 24 | ![]() |
1 | 1 | |||||||
MIRT007922 | Tex2 | testis expressed gene 2 | ![]() |
1 | 1 | |||||||
MIRT007923 | Auh | AU RNA binding protein/enoyl-coenzyme A hydratase | ![]() |
1 | 1 | |||||||
MIRT007924 | Frmpd4 | FERM and PDZ domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT007925 | Gtf2i | general transcription factor II I | ![]() |
1 | 1 | |||||||
MIRT007926 | Slc7a11 | solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 | ![]() |
1 | 1 | |||||||
MIRT007927 | B4galt6 | UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 | ![]() |
1 | 1 | |||||||
MIRT007928 | Asxl3 | additional sex combs like 3 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT007929 | Gm6792 | epididymal protein 13 | ![]() |
1 | 1 | |||||||
MIRT007930 | BC003331 | cDNA sequence BC003331 | ![]() |
1 | 1 | |||||||
MIRT007931 | Ubxn4 | UBX domain protein 4 | ![]() |
1 | 1 | |||||||
MIRT007932 | Gfra2 | glial cell line derived neurotrophic factor family receptor alpha 2 | ![]() |
1 | 1 | |||||||
MIRT007933 | Dpp6 | dipeptidylpeptidase 6 | ![]() |
1 | 1 | |||||||
MIRT007934 | Smap1 | small ArfGAP 1 | ![]() |
1 | 1 | |||||||
MIRT007935 | Drd1a | dopamine receptor D1 | ![]() |
1 | 1 | |||||||
MIRT007936 | Frmd4a | FERM domain containing 4A | ![]() |
1 | 1 | |||||||
MIRT007937 | Gria4 | glutamate receptor, ionotropic, AMPA4 (alpha 4) | ![]() |
1 | 1 | |||||||
MIRT007938 | Ralgps1 | Ral GEF with PH domain and SH3 binding motif 1 | ![]() |
1 | 1 | |||||||
MIRT007939 | Myh10 | myosin, heavy polypeptide 10, non-muscle | ![]() |
1 | 1 | |||||||
MIRT007940 | Arhgap24 | Rho GTPase activating protein 24 | ![]() |
1 | 1 | |||||||
MIRT007941 | Pros1 | protein S (alpha) | ![]() |
1 | 1 | |||||||
MIRT007942 | Cxcl14 | chemokine (C-X-C motif) ligand 14 | ![]() |
1 | 1 | |||||||
MIRT007943 | Cyp46a1 | cytochrome P450, family 46, subfamily a, polypeptide 1 | ![]() |
1 | 1 | |||||||
MIRT007944 | Nov | nephroblastoma overexpressed gene | ![]() |
1 | 1 | |||||||
MIRT007945 | Lamp1 | lysosomal-associated membrane protein 1 | ![]() |
1 | 1 | |||||||
MIRT007946 | 5730455P16Rik | RIKEN cDNA 5730455P16 gene | ![]() |
1 | 1 | |||||||
MIRT007947 | Zhx3 | zinc fingers and homeoboxes 3 | ![]() |
1 | 1 | |||||||
MIRT007948 | Ldhb | lactate dehydrogenase B | ![]() |
1 | 1 | |||||||
MIRT007949 | Xpnpep3 | X-prolyl aminopeptidase 3, mitochondrial | ![]() |
1 | 1 | |||||||
MIRT007950 | Ppp2ca | protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform | ![]() |
1 | 1 | |||||||
MIRT007951 | Adam22 | a disintegrin and metallopeptidase domain 22 | ![]() |
1 | 1 | |||||||
MIRT007952 | Csrnp2 | cysteine-serine-rich nuclear protein 2 | ![]() |
1 | 1 | |||||||
MIRT007953 | Scamp5 | secretory carrier membrane protein 5 | ![]() |
1 | 1 | |||||||
MIRT007954 | Nrarp | Notch-regulated ankyrin repeat protein | ![]() |
1 | 1 | |||||||
MIRT007955 | Rala | v-ral simian leukemia viral oncogene A (ras related) | ![]() |
1 | 1 | |||||||
MIRT007956 | Tecpr1 | tectonin beta-propeller repeat containing 1 | ![]() |
1 | 1 | |||||||
MIRT007957 | Jtb | jumping translocation breakpoint | ![]() |
1 | 1 | |||||||
MIRT007958 | Nup62 | nucleoporin 62 | ![]() |
1 | 1 | |||||||
MIRT007959 | Asic2 | acid-sensing (proton-gated) ion channel 2 | ![]() |
1 | 1 | |||||||
MIRT007960 | Fermt2 | fermitin family member 2 | ![]() |
1 | 1 | |||||||
MIRT007961 | Fbxw5 | F-box and WD-40 domain protein 5 | ![]() |
1 | 1 | |||||||
MIRT007962 | Tbc1d12 | TBC1D12: TBC1 domain family, member 12 | ![]() |
1 | 1 | |||||||
MIRT007963 | Rragd | Ras-related GTP binding D | ![]() |
1 | 1 | |||||||
MIRT007964 | Atp2a2 | ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 | ![]() |
1 | 1 | |||||||
MIRT007965 | Cmtm6 | CKLF-like MARVEL transmembrane domain containing 6 | ![]() |
1 | 1 | |||||||
MIRT007966 | Zbtb1 | zinc finger and BTB domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT007967 | Fzd6 | frizzled class receptor 6 | ![]() |
1 | 1 | |||||||
MIRT007968 | Cds2 | CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 | ![]() |
1 | 1 | |||||||
MIRT007969 | Pi4k2a | phosphatidylinositol 4-kinase type 2 alpha | ![]() |
1 | 1 | |||||||
MIRT007970 | Mfsd7c | major facilitator superfamily domain containing 7C | ![]() |
1 | 1 | |||||||
MIRT007971 | Rb1cc1 | RB1-inducible coiled-coil 1 | ![]() |
1 | 1 | |||||||
MIRT007972 | Pfn2 | profilin 2 | ![]() |
1 | 1 | |||||||
MIRT007973 | Ppm1l | protein phosphatase 1 (formerly 2C)-like | ![]() |
1 | 1 | |||||||
MIRT007974 | Ldlrad4 | low density lipoprotein receptor class A domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT007975 | Slc39a10 | solute carrier family 39 (zinc transporter), member 10 | ![]() |
1 | 1 | |||||||
MIRT007976 | Mtmr12 | myotubularin related protein 12 | ![]() |
1 | 1 | |||||||
MIRT007977 | Papss2 | 3'-phosphoadenosine 5'-phosphosulfate synthase 2 | ![]() |
1 | 1 | |||||||
MIRT007978 | Nf1 | neurofibromin 1 | ![]() |
1 | 1 | |||||||
MIRT007979 | Rasgef1a | RasGEF domain family, member 1A | ![]() |
1 | 1 | |||||||
MIRT007980 | Ficd | FIC domain containing | ![]() |
1 | 1 | |||||||
MIRT007981 | Rph3a | rabphilin 3A | ![]() |
1 | 1 | |||||||
MIRT007982 | Tgfbr1 | transforming growth factor, beta receptor I | ![]() |
1 | 1 | |||||||
MIRT007983 | Pea15a | phosphoprotein enriched in astrocytes 15A | ![]() |
1 | 1 | |||||||
MIRT007984 | Ywhab | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide | ![]() |
1 | 1 | |||||||
MIRT007985 | Pcnx | pecanex homolog (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT007986 | Btbd7 | BTB (POZ) domain containing 7 | ![]() |
1 | 1 | |||||||
MIRT007987 | Wnk1 | WNK lysine deficient protein kinase 1 | ![]() |
1 | 1 | |||||||
MIRT007988 | Nfya | nuclear transcription factor-Y alpha | ![]() |
1 | 1 | |||||||
MIRT007989 | Zmat3 | zinc finger matrin type 3 | ![]() |
1 | 1 | |||||||
MIRT007990 | Pex11a | peroxisomal biogenesis factor 11 alpha | ![]() |
1 | 1 | |||||||
MIRT007991 | Cds1 | CDP-diacylglycerol synthase 1 | ![]() |
1 | 1 | |||||||
MIRT007992 | Tnpo1 | transportin 1 | ![]() |
1 | 1 | |||||||
MIRT007993 | Epc2 | enhancer of polycomb homolog 2 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT007994 | Npat | nuclear protein in the AT region | ![]() |
1 | 1 | |||||||
MIRT007995 | Parg | poly (ADP-ribose) glycohydrolase | ![]() |
1 | 1 | |||||||
MIRT007996 | Slc24a3 | solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 | ![]() |
1 | 1 | |||||||
MIRT007997 | Sel1l3 | sel-1 suppressor of lin-12-like 3 (C. elegans) | ![]() |
1 | 1 | |||||||
MIRT007998 | Mul1 | mitochondrial ubiquitin ligase activator of NFKB 1 | ![]() |
1 | 1 | |||||||
MIRT007999 | Srrm2 | serine/arginine repetitive matrix 2 | ![]() |
1 | 1 | |||||||
MIRT008000 | Ndufs4 | NADH dehydrogenase (ubiquinone) Fe-S protein 4 | ![]() |
1 | 1 | |||||||
MIRT008001 | Sh3rf3 | SH3 domain containing ring finger 3 | ![]() |
1 | 1 | |||||||
MIRT008002 | Psme4 | proteasome (prosome, macropain) activator subunit 4 | ![]() |
1 | 1 | |||||||
MIRT008003 | Sept4 | septin 4 | ![]() |
1 | 1 | |||||||
MIRT008004 | Simc1 | SUMO-interacting motifs containing 1 | ![]() |
1 | 1 | |||||||
MIRT008005 | Ppm1d | protein phosphatase 1D magnesium-dependent, delta isoform | ![]() |
1 | 1 | |||||||
MIRT008006 | Eno2 | enolase 2, gamma neuronal | ![]() |
1 | 1 | |||||||
MIRT008007 | Galc | galactosylceramidase | ![]() |
1 | 1 | |||||||
MIRT008008 | Clu | clusterin | ![]() |
1 | 1 | |||||||
MIRT008009 | Stxbp5l | syntaxin binding protein 5-like | ![]() |
1 | 1 | |||||||
MIRT008010 | Mgll | monoglyceride lipase | ![]() |
1 | 1 | |||||||
MIRT008011 | Fam175b | BRISC complex subunit | ![]() |
1 | 1 | |||||||
MIRT008012 | Grin2b | glutamate receptor, ionotropic, NMDA2B (epsilon 2) | ![]() |
1 | 1 | |||||||
MIRT008013 | Pigk | phosphatidylinositol glycan anchor biosynthesis, class K | ![]() |
1 | 1 | |||||||
MIRT008014 | Dcun1d2 | DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) | ![]() |
1 | 1 | |||||||
MIRT008015 | Atp6v1h | ATPase, H+ transporting, lysosomal V1 subunit H | ![]() |
1 | 1 | |||||||
MIRT008016 | Zdhhc8 | zinc finger, DHHC domain containing 8 | ![]() |
1 | 1 | |||||||
MIRT008017 | Incenp | inner centromere protein | ![]() |
1 | 1 | |||||||
MIRT008018 | Kif21a | kinesin family member 21A | ![]() |
1 | 1 | |||||||
MIRT008019 | Usp33 | ubiquitin specific peptidase 33 | ![]() |
1 | 1 | |||||||
MIRT008020 | 4930506M07Rik | shootin 1 | ![]() |
1 | 1 | |||||||
MIRT008021 | Arel1 | apoptosis resistant E3 ubiquitin protein ligase 1 | ![]() |
1 | 1 | |||||||
MIRT008022 | Nfia | nuclear factor I/A | ![]() |
1 | 2 | |||||||
MIRT008023 | Pygo2 | pygopus 2 | ![]() |
1 | 1 | |||||||
MIRT008024 | Mtmr6 | myotubularin related protein 6 | ![]() |
1 | 1 | |||||||
MIRT008025 | Rab11b | RAB11B, member RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT008026 | Pvr | poliovirus receptor | ![]() |
1 | 1 | |||||||
MIRT008027 | D4Wsu53e | arginine/serine rich protein 1 | ![]() |
1 | 1 | |||||||
MIRT008028 | Nudcd3 | NudC domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT008029 | Gpr158 | G protein-coupled receptor 158 | ![]() |
1 | 1 | |||||||
MIRT008030 | Cdc42bpa | CDC42 binding protein kinase alpha | ![]() |
1 | 1 | |||||||
MIRT008031 | Gabbr2 | gamma-aminobutyric acid (GABA) B receptor, 2 | ![]() |
1 | 1 | |||||||
MIRT008032 | Grem2 | gremlin 2, DAN family BMP antagonist | ![]() |
1 | 1 | |||||||
MIRT008033 | Car12 | carbonic anhydrase 12 | ![]() |
1 | 1 | |||||||
MIRT008034 | Ldlr | low density lipoprotein receptor | ![]() |
1 | 1 | |||||||
MIRT008035 | Zcchc24 | zinc finger, CCHC domain containing 24 | ![]() |
1 | 1 | |||||||
MIRT008036 | Rgs7bp | regulator of G-protein signalling 7 binding protein | ![]() |
1 | 1 | |||||||
MIRT008037 | Pde4b | phosphodiesterase 4B, cAMP specific | ![]() |
1 | 1 | |||||||
MIRT008038 | Atrn | attractin | ![]() |
1 | 1 | |||||||
MIRT008039 | Pank1 | pantothenate kinase 1 | ![]() |
1 | 1 | |||||||
MIRT008040 | Mfap3l | microfibrillar-associated protein 3-like | ![]() |
1 | 1 | |||||||
MIRT008041 | Stard13 | StAR-related lipid transfer (START) domain containing 13 | ![]() |
1 | 1 | |||||||
MIRT008042 | Tenm3 | teneurin transmembrane protein 3 | ![]() |
1 | 1 | |||||||
MIRT008043 | Gpcpd1 | glycerophosphocholine phosphodiesterase 1 | ![]() |
1 | 1 | |||||||
MIRT008044 | Slc17a7 | solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 | ![]() |
1 | 1 | |||||||
MIRT008045 | Rgma | repulsive guidance molecule family member A | ![]() |
1 | 1 | |||||||
MIRT008046 | Ttyh3 | tweety family member 3 | ![]() |
1 | 1 | |||||||
MIRT008047 | Nfix | nuclear factor I/X | ![]() |
1 | 1 | |||||||
MIRT008048 | Glrx5 | glutaredoxin 5 | ![]() |
1 | 1 | |||||||
MIRT008049 | Ankra2 | ankyrin repeat, family A (RFXANK-like), 2 | ![]() |
1 | 1 | |||||||
MIRT008050 | Hpca | hippocalcin | ![]() |
1 | 1 | |||||||
MIRT008051 | Ing2 | inhibitor of growth family, member 2 | ![]() |
1 | 1 | |||||||
MIRT008052 | Rab10 | RAB10, member RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT008053 | N4bp1 | NEDD4 binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT008054 | B3galnt1 | UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 | ![]() |
1 | 1 | |||||||
MIRT008055 | Trove2 | TROVE domain family, member 2 | ![]() |
1 | 1 | |||||||
MIRT008056 | Kcna1 | potassium voltage-gated channel, shaker-related subfamily, member 1 | ![]() |
1 | 1 | |||||||
MIRT008057 | Tmcc1 | transmembrane and coiled coil domains 1 | ![]() |
1 | 1 | |||||||
MIRT008058 | Fam184a | family with sequence similarity 184, member A | ![]() |
1 | 1 | |||||||
MIRT008059 | Adam10 | a disintegrin and metallopeptidase domain 10 | ![]() |
1 | 1 | |||||||
MIRT008060 | Esyt2 | extended synaptotagmin-like protein 2 | ![]() |
1 | 1 | |||||||
MIRT008061 | Rab11fip4 | RAB11 family interacting protein 4 (class II) | ![]() |
1 | 1 | |||||||
MIRT008062 | Errfi1 | ERBB receptor feedback inhibitor 1 | ![]() |
1 | 1 | |||||||
MIRT008063 | Zfp275 | zinc finger protein 275 | ![]() |
1 | 1 | |||||||
MIRT008064 | Psd3 | pleckstrin and Sec7 domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT008065 | Grb10 | growth factor receptor bound protein 10 | ![]() |
1 | 1 | |||||||
MIRT008066 | Slc35f3 | solute carrier family 35, member F3 | ![]() |
1 | 1 | |||||||
MIRT008067 | Hecw2 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 | ![]() |
1 | 1 | |||||||
MIRT008068 | Taok1 | TAO kinase 1 | ![]() |
1 | 1 | |||||||
MIRT008069 | St8sia3 | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 | ![]() |
1 | 1 | |||||||
MIRT008070 | Ccdc88a | coiled coil domain containing 88A | ![]() |
1 | 1 | |||||||
MIRT008071 | Enpp5 | ectonucleotide pyrophosphatase/phosphodiesterase 5 | ![]() |
1 | 1 | |||||||
MIRT008072 | Lrch1 | leucine-rich repeats and calponin homology (CH) domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT008073 | Jmy | junction-mediating and regulatory protein | ![]() |
1 | 1 | |||||||
MIRT008074 | Sall3 | sal-like 3 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT008075 | Cltc | clathrin, heavy polypeptide (Hc) | ![]() |
1 | 1 | |||||||
MIRT008076 | Hprt | hypoxanthine guanine phosphoribosyl transferase | ![]() |
1 | 1 | |||||||
MIRT008077 | Csmd1 | CUB and Sushi multiple domains 1 | ![]() |
1 | 1 | |||||||
MIRT008078 | Cblb | Casitas B-lineage lymphoma b | ![]() |
1 | 1 | |||||||
MIRT008079 | Abl2 | v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) | ![]() |
1 | 1 | |||||||
MIRT008080 | Zfp217 | zinc finger protein 217 | ![]() |
1 | 1 | |||||||
MIRT008081 | Arap2 | ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 | ![]() |
1 | 1 | |||||||
MIRT008082 | Reps2 | RALBP1 associated Eps domain containing protein 2 | ![]() |
1 | 1 | |||||||
MIRT008083 | Klf7 | Kruppel-like factor 7 (ubiquitous) | ![]() |
1 | 1 | |||||||
MIRT008084 | Sik1 | salt inducible kinase 1 | ![]() |
1 | 1 | |||||||
MIRT008085 | Apcdd1 | adenomatosis polyposis coli down-regulated 1 | ![]() |
1 | 1 | |||||||
MIRT008086 | Robo1 | roundabout guidance receptor 1 | ![]() |
1 | 1 | |||||||
MIRT008087 | Rnf38 | ring finger protein 38 | ![]() |
1 | 1 | |||||||
MIRT008088 | Agfg1 | ArfGAP with FG repeats 1 | ![]() |
1 | 1 | |||||||
MIRT008089 | Abca1 | ATP-binding cassette, sub-family A (ABC1), member 1 | ![]() |
1 | 1 | |||||||
MIRT008090 | Arhgap21 | Rho GTPase activating protein 21 | ![]() |
1 | 1 | |||||||
MIRT008091 | Sh3d19 | SH3 domain protein D19 | ![]() |
1 | 1 | |||||||
MIRT008092 | Skida1 | SKI/DACH domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT580367 | Tmem25 | transmembrane protein 25 | ![]() |
1 | 1 | |||||||
MIRT580803 | Snx27 | sorting nexin family member 27 | ![]() |
1 | 1 | |||||||
MIRT590619 | Arrdc3 | arrestin domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT590763 | Acbd5 | acyl-Coenzyme A binding domain containing 5 | ![]() |
1 | 1 | |||||||
MIRT592544 | Mup7 | major urinary protein 7 | ![]() |
1 | 1 | |||||||
MIRT592587 | Mup13 | major urinary protein 13 | ![]() |
1 | 1 | |||||||
MIRT595105 | Timp2 | tissue inhibitor of metalloproteinase 2 | ![]() |
1 | 1 | |||||||
MIRT595361 | Fgfr1op2 | FGFR1 oncogene partner 2 | ![]() |
1 | 1 | |||||||
MIRT600787 | Homez | homeodomain leucine zipper-encoding gene | ![]() |
1 | 1 | |||||||
MIRT604877 | Map3k12 | mitogen-activated protein kinase kinase kinase 12 | ![]() |
1 | 1 | |||||||
MIRT606371 | Inpp5e | inositol polyphosphate-5-phosphatase E | ![]() |
1 | 1 | |||||||
MIRT755742 | Nos2 | nitric oxide synthase 2, inducible | 1 | 1 | ||||||||
MIRT755743 | Arg2 | arginase type II | 1 | 1 | ||||||||
MIRT755747 | Tnf | tumor necrosis factor | 1 | 1 |