pre-miRNA Information
pre-miRNA mmu-mir-17   
Genomic Coordinates chr14: 115043671 - 115043754
Synonyms Mirn17, mmu-mir-17, Mir17
Description Mus musculus miR-17 stem-loop
Comment Mouse mir-17 is predicted .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-17-5p
Sequence 14| CAAAGUGCUUACAGUGCAGGUAG |36
Evidence Experimental
Experiments Cloned
Putative Targets

Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B0I1LA miR-17 Predictive Biomarker (PRD) Clinical/Experimental Data Expression Decrease Tumor tissue Quantitative real-time PCR
BL85QR miR-17-5p Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Real-time polymerase chain reaction
Gene Information
Gene Symbol Brms1l   
Synonyms 0710008O11Rik, AI159718, BRMS1, D12Ertd407e
Description breast cancer metastasis-suppressor 1-like
Transcript NM_001037756   
Expression
Putative miRNA Targets on Brms1l
3'UTR of Brms1l
(miRNA target sites are highlighted)
>Brms1l|NM_001037756|3'UTR
   1 TCACGCTCTAAGTGTTCCCCACATCTACCTTGTTAGTGTTACCAAGTGTAATGTGCCATGGAAGCCAAGAGAATGCACTC
  81 AGCAGCTTAATAATTTCATCCAGTCATGAGAGACTGTGTCTTCTAGGTAGTACTCCAAGTAGACCCCACATTAGTAAGTC
 161 ATTAAGAGAAATAGTGATAAACTCTAATCATGACCATCGCGTTTATTTGCCTCGCAGGTCCCGTGCCAACAGGTCTGTTT
 241 GGTATGTATTTCTTTCTCAGTGTTGCTTCATTCTGTGTCTTACTCACGTGAGTGTGTCTCACCTCTAATGGACTACCGTG
 321 CAGTCGCCTGCAGTTTTAAATCCCCGCCTCCGCTGCCACTCTTGTGTTTGTACAGATGGAAGACTTCCTATGAATGATTT
 401 CTATTAGTGCATTCGTTTCAATCAGAACTGAAATTTATACATACATGTGTGAGTGCGTCTATACAGTGTCCCCAGCAGGC
 481 TTAGAACTGATGGCCTACCTGTACAACCTCCTTTTACCCCAAATTCAACTGCTGGGTTTTCGAAGAAAAGGGAGCACTTT
 561 TCTAGACTGCTTTTCCTTCTCTTCTTCCTGGATGGCGGTGACCTCTTTTGCAGATCATATTTGGTGTTTATTAGTAGCAG
 641 TGTGTCAAGTGTGACCATGTTGCTGCCTGTGTTTCTTCTGAGCTTTTAGAGGGGCAGGTATCCTGCCTGGTGTTTATGAT
 721 GCGCAGTGCCAGAGTGACAAGTGGCTGGCAGTATTGTCGTGCTTTCTGCACATCTGAACTTTTGAAGATTTTACTAAGCA
 801 TTATCTAGAGGCAAAACTAGATCCTTATTCTAATTTTATTGCTAGAGTGGAATACATATAGATACTTCCCTTAACTCTAC
 881 CATCCCCCAAATTAGCTTTTTTTTTTAAGTGTTTTTAACACTTTAAGGCCATTTGGTGCAATTTAGAAAATGTTGGCCTC
 961 CCTTCCCTTAGCCATATTCAGAATGAACTTGGAAGCCTCTGGAACTGTGCAGGAAACCGGAGCCCTCAGCCCGGAGGCAC
1041 AGTGGGCTACAGTGTGTACGCAGGGTACAGCCAAATGAAGTGCTCTGCTGGTCTCATGCACTTTAATTTCTGTTACAGTG
1121 TATTTAAGAGGATGAGGAAGACTCACTCAACACTCCTCAAAGGAGTCTCTGCATGATTCCGTTAGTTCCTTATGACTTCA
1201 CCTCTGCAGACATTCCCTGCAGGTATACTCCACAGTTGCCAAATTGTAACCATCTGACTTTCGAAGTTCAGTATCAGCAA
1281 CATTGTGCTGCTCTGTTCTGTTTCTGATCACCCTTAGCGGCTGTGCAGACTGTCCCAATCCAGTAGCATTTGGCAGTGCT
1361 TATAAATATATATATATATATGATGTTTGATAAGCATTTTTAATGAGATTTGTATTTTTAAATTTAGTATGTAATAAAAA
1441 GAAGTGTTTGAGCGTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gauGGACG-UGACA-UUCGUGAAAc 5'
             :|||| : | | | ||||||| 
Target 5' tgcTCTGCTGGTCTCATGCACTTTa 3'
1081 - 1105 152.00 -11.90
2
miRNA  3' gauggaCGUGACAUUCGUGAAAc 5'
                | |  | :|||||||| 
Target 5' ttcgaaGAAAAGGGAGCACTTTt 3'
539 - 561 149.00 -8.30
3
miRNA  3' gauggACGUGAC-AUUCGUGAAAc 5'
               ||: :|| ||||||:||| 
Target 5' tatgaTGT-TTGATAAGCATTTTt 3'
1379 - 1401 145.00 -9.90
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
411 mmu-miR-17-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001083 Stat3 signal transducer and activator of transcription 3 4 2
MIRT003387 Mapk14 mitogen-activated protein kinase 14 5 2
MIRT004122 Rbl2 RB transcriptional corepressor like 2 5 2
MIRT006702 Bcl2l11 BCL2-like 11 (apoptosis facilitator) 2 1
MIRT006736 Sqstm1 sequestosome 1 3 1
MIRT009812 Ankrd29 ankyrin repeat domain 29 1 1
MIRT009813 Eef2k eukaryotic elongation factor-2 kinase 1 1
MIRT009814 Neurod1 neurogenic differentiation 1 1 1
MIRT009815 Ankhd1 ankyrin repeat and KH domain containing 1 1 1
MIRT009816 Mrc1 mannose receptor, C type 1 1 1
MIRT009817 Nsg2 neuron specific gene family member 2 1 1
MIRT009818 Zic2 zinc finger protein of the cerebellum 2 1 1
MIRT009819 Dhx36 DEAH (Asp-Glu-Ala-His) box polypeptide 36 1 1
MIRT009820 Adam19 a disintegrin and metallopeptidase domain 19 (meltrin beta) 1 1
MIRT009821 Gabra1 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 1 1
MIRT009822 Yipf6 Yip1 domain family, member 6 1 1
MIRT009823 Sdccag3 serologically defined colon cancer antigen 3 1 1
MIRT009824 Dgkd diacylglycerol kinase, delta 1 1
MIRT009825 Itm2c integral membrane protein 2C 1 1
MIRT009826 Ptprg protein tyrosine phosphatase, receptor type, G 1 1
MIRT009827 Pik3r4 phosphoinositide-3-kinase regulatory subunit 4 1 1
MIRT009828 Rsrc2 arginine/serine-rich coiled-coil 2 1 1
MIRT009829 Napb N-ethylmaleimide sensitive fusion protein attachment protein beta 1 1
MIRT009830 Serpinb9 serine (or cysteine) peptidase inhibitor, clade B, member 9 1 1
MIRT009831 Islr2 immunoglobulin superfamily containing leucine-rich repeat 2 1 1
MIRT009832 Aspscr1 alveolar soft part sarcoma chromosome region, candidate 1 (human) 1 1
MIRT009833 Tmem230 transmembrane protein 230 1 1
MIRT009834 Tor1aip2 torsin A interacting protein 2 1 1
MIRT009835 Slc44a5 solute carrier family 44, member 5 1 1
MIRT009836 Cops2 COP9 signalosome subunit 2 1 1
MIRT009837 Tomm34 translocase of outer mitochondrial membrane 34 1 1
MIRT009838 Lcorl ligand dependent nuclear receptor corepressor-like 1 1
MIRT009839 Gabrb3 gamma-aminobutyric acid (GABA) A receptor, subunit beta 3 1 1
MIRT009840 Ubtf upstream binding transcription factor, RNA polymerase I 1 1
MIRT009841 Ppig peptidyl-prolyl isomerase G (cyclophilin G) 1 1
MIRT009842 Fam120c family with sequence similarity 120, member C 1 1
MIRT009843 Rapgefl1 Rap guanine nucleotide exchange factor (GEF)-like 1 1 1
MIRT009844 Ranbp2 RAN binding protein 2 1 1
MIRT009845 Spast spastin 1 1
MIRT009846 C2cd4c C2 calcium-dependent domain containing 4C 1 1
MIRT009847 Zdhhc16 zinc finger, DHHC domain containing 16 1 1
MIRT009848 Nfe2l2 nuclear factor, erythroid derived 2, like 2 1 1
MIRT009849 Shh sonic hedgehog 1 1
MIRT009850 Lsamp limbic system-associated membrane protein 1 1
MIRT009851 Eml1 echinoderm microtubule associated protein like 1 1 1
MIRT009852 Lrp11 low density lipoprotein receptor-related protein 11 1 1
MIRT009853 Tgfa transforming growth factor alpha 1 1
MIRT009854 Dcbld2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT009855 Mcm7 minichromosome maintenance complex component 7 1 1
MIRT009856 Fam49b family with sequence similarity 49, member B 1 1
MIRT009857 Zfp62 zinc finger protein 62 1 1
MIRT009858 Epb4.1l5 erythrocyte membrane protein band 4.1 like 5 1 1
MIRT009859 Cpeb4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT009860 Cyld CYLD lysine 63 deubiquitinase 1 1
MIRT009861 March6 membrane-associated ring finger (C3HC4) 6 1 1
MIRT009862 Lrrc55 leucine rich repeat containing 55 1 1
MIRT009863 Nrip1 nuclear receptor interacting protein 1 1 1
MIRT009864 Cxcl12 chemokine (C-X-C motif) ligand 12 1 1
MIRT009865 Luc7l3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT009866 Ankrd9 ankyrin repeat domain 9 1 1
MIRT009867 Cpe carboxypeptidase E 1 1
MIRT009868 Akt3 thymoma viral proto-oncogene 3 1 1
MIRT009869 Kbtbd8 kelch repeat and BTB (POZ) domain containing 8 1 1
MIRT009870 Etnk1 ethanolamine kinase 1 1 1
MIRT009871 Dnmt3a DNA methyltransferase 3A 1 1
MIRT009872 Tspan9 tetraspanin 9 1 1
MIRT009873 Col4a2 collagen, type IV, alpha 2 1 1
MIRT009874 Polq polymerase (DNA directed), theta 1 1
MIRT009875 2810055G20Rik Mir99a and Mirlet7c-1 host gene (non-protein coding) 1 1
MIRT009876 Scn8a sodium channel, voltage-gated, type VIII, alpha 1 1
MIRT009877 Atf2 activating transcription factor 2 1 1
MIRT009878 Gtf2h2 general transcription factor II H, polypeptide 2 1 1
MIRT009879 Heg1 heart development protein with EGF-like domains 1 1 1
MIRT009880 Ppp1r21 protein phosphatase 1, regulatory subunit 21 1 1
MIRT009881 C1qa complement component 1, q subcomponent, alpha polypeptide 1 1
MIRT009882 Tnrc6b trinucleotide repeat containing 6b 1 1
MIRT009883 Klf10 Kruppel-like factor 10 1 1
MIRT009884 Rsf1 remodeling and spacing factor 1 1 1
MIRT009885 Cald1 caldesmon 1 1 1
MIRT009886 Fam63b MINDY lysine 48 deubiquitinase 2 1 1
MIRT009887 Rab12 RAB12, member RAS oncogene family 1 1
MIRT009888 Epha7 Eph receptor A7 1 1
MIRT009889 Xrn1 5'-3' exoribonuclease 1 1 1
MIRT009890 Rnf103 ring finger protein 103 1 1
MIRT009891 Srcin1 SRC kinase signaling inhibitor 1 1 1
MIRT009892 March8 membrane-associated ring finger (C3HC4) 8 1 1
MIRT009893 Mcl1 myeloid cell leukemia sequence 1 1 1
MIRT009894 Zfp704 zinc finger protein 704 1 1
MIRT009895 Fcho2 FCH domain only 2 1 1
MIRT009896 Derl2 Der1-like domain family, member 2 1 1
MIRT009897 Socs6 suppressor of cytokine signaling 6 1 1
MIRT009898 Itgb8 integrin beta 8 1 1
MIRT009899 Bmp4 bone morphogenetic protein 4 1 1
MIRT009900 Pten phosphatase and tensin homolog 2 1
MIRT009901 Insm1 insulinoma-associated 1 1 1
MIRT009902 Zfp84 zinc finger protein 84 1 1
MIRT009903 Map4k2 mitogen-activated protein kinase kinase kinase kinase 2 1 1
MIRT009904 B4galnt1 beta-1,4-N-acetyl-galactosaminyl transferase 1 1 1
MIRT009905 Map1a microtubule-associated protein 1 A 1 1
MIRT009906 Pappa pregnancy-associated plasma protein A 1 1
MIRT009907 Gng4 guanine nucleotide binding protein (G protein), gamma 4 1 1
MIRT009908 Slc10a7 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 1 1
MIRT009909 Robo2 roundabout guidance receptor 2 1 1
MIRT009910 Ttc14 tetratricopeptide repeat domain 14 1 1
MIRT009911 Taok2 TAO kinase 2 1 1
MIRT009912 Pgrmc2 progesterone receptor membrane component 2 1 1
MIRT009913 Rasal1 RAS protein activator like 1 (GAP1 like) 1 1
MIRT009914 Eps15 epidermal growth factor receptor pathway substrate 15 1 1
MIRT009915 Slc7a14 solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 1 1
MIRT009916 Aplp2 amyloid beta (A4) precursor-like protein 2 1 1
MIRT009917 Cd164 CD164 antigen 1 1
MIRT009918 St6galnac5 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 1 1
MIRT009919 Nipa2 non imprinted in Prader-Willi/Angelman syndrome 2 homolog (human) 1 1
MIRT009920 En2 engrailed 2 1 1
MIRT009921 Pum1 pumilio RNA-binding family member 1 1 1
MIRT009922 Ppp2r2c protein phosphatase 2, regulatory subunit B, gamma 1 1
MIRT009923 Zfp317 zinc finger protein 317 1 1
MIRT009924 Whsc1l1 nuclear receptor binding SET domain protein 3 1 1
MIRT009925 Reep1 receptor accessory protein 1 1 1
MIRT009926 Cpeb3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT009927 Ncam1 neural cell adhesion molecule 1 1 1
MIRT009928 Qser1 glutamine and serine rich 1 1 1
MIRT009929 A330021E22Rik cilia and flagella associated protein 69 1 1
MIRT009930 Ubxn2a UBX domain protein 2A 1 2
MIRT009931 1700052N19Rik acidic residue methyltransferase 1 1 1
MIRT009932 Nefh neurofilament, heavy polypeptide 1 1
MIRT009933 Necab1 N-terminal EF-hand calcium binding protein 1 1 1
MIRT009934 Map7d2 MAP7 domain containing 2 1 1
MIRT009935 Igsf3 immunoglobulin superfamily, member 3 1 1
MIRT009936 Ift88 intraflagellar transport 88 1 1
MIRT009937 Ap3d1 adaptor-related protein complex 3, delta 1 subunit 1 1
MIRT009938 Zeb2 zinc finger E-box binding homeobox 2 1 1
MIRT009939 Aifm1 apoptosis-inducing factor, mitochondrion-associated 1 1 1
MIRT009940 Cdh2 cadherin 2 1 1
MIRT009941 B3galt2 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 1 1
MIRT009942 Cbx2 chromobox 2 1 1
MIRT009943 Lnp lunapark, ER junction formation factor 1 1
MIRT009944 Adam17 a disintegrin and metallopeptidase domain 17 1 1
MIRT009945 Gas7 growth arrest specific 7 1 1
MIRT009946 Dync1li2 dynein, cytoplasmic 1 light intermediate chain 2 1 1
MIRT009947 Rab30 RAB30, member RAS oncogene family 1 1
MIRT009948 Rap1gds1 RAP1, GTP-GDP dissociation stimulator 1 1 1
MIRT009949 Atxn3 ataxin 3 1 1
MIRT009950 Dpysl2 dihydropyrimidinase-like 2 1 1
MIRT009951 Pbrm1 polybromo 1 1 1
MIRT009952 Papolg poly(A) polymerase gamma 1 1
MIRT009953 Cav1 caveolin 1, caveolae protein 1 1
MIRT009954 Lmbrd1 LMBR1 domain containing 1 1 1
MIRT009955 Klf9 Kruppel-like factor 9 1 1
MIRT009956 Lpp LIM domain containing preferred translocation partner in lipoma 1 1
MIRT009957 Tmx4 thioredoxin-related transmembrane protein 4 1 1
MIRT009958 Rasa1 RAS p21 protein activator 1 1 1
MIRT009959 Fam117b family with sequence similarity 117, member B 1 1
MIRT009960 Rb1 RB transcriptional corepressor 1 1 1
MIRT009961 Syt1 synaptotagmin I 1 1
MIRT009962 Crebrf CREB3 regulatory factor 1 1
MIRT009963 Acvr1b activin A receptor, type 1B 1 1
MIRT009964 Spag9 sperm associated antigen 9 1 1
MIRT009965 Usp3 ubiquitin specific peptidase 3 1 1
MIRT009966 Bmp2k BMP2 inducible kinase 1 1
MIRT009967 Cnot6l CCR4-NOT transcription complex, subunit 6-like 1 1
MIRT009968 Kif5c kinesin family member 5C 1 1
MIRT009969 Camta1 calmodulin binding transcription activator 1 1 1
MIRT009970 Klhl2 kelch-like 2, Mayven 1 1
MIRT009971 Casc4 cancer susceptibility candidate 4 1 1
MIRT009972 F3 coagulation factor III 1 1
MIRT009973 1600012H06Rik RIKEN cDNA 1600012H06 gene 1 1
MIRT009974 6030458C11Rik RIKEN cDNA 6030458C11 gene 1 1
MIRT009975 Kif5a kinesin family member 5A 1 1
MIRT009976 Camk2n1 calcium/calmodulin-dependent protein kinase II inhibitor 1 1 1
MIRT009977 Zfp367 zinc finger protein 367 1 1
MIRT009978 Slc24a2 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 1 1
MIRT009979 Ccser2 coiled-coil serine rich 2 1 1
MIRT009980 Zfand4 zinc finger, AN1-type domain 4 1 1
MIRT009981 Fam134c reticulophagy regulator family member 3 1 1
MIRT009982 Tnfrsf21 tumor necrosis factor receptor superfamily, member 21 1 1
MIRT009983 Rev3l REV3 like, DNA directed polymerase zeta catalytic subunit 1 1
MIRT009984 Wfs1 wolframin ER transmembrane glycoprotein 1 1
MIRT009985 Smim20 small integral membrane protein 20 1 1
MIRT009986 Nbea neurobeachin 1 1
MIRT009987 Map3k5 mitogen-activated protein kinase kinase kinase 5 1 1
MIRT009988 Plagl2 pleiomorphic adenoma gene-like 2 1 1
MIRT009989 Brms1l breast cancer metastasis-suppressor 1-like 1 1
MIRT009990 Zfp597 zinc finger protein 597 1 1
MIRT009991 Smoc2 SPARC related modular calcium binding 2 1 1
MIRT009992 Ezh1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 1
MIRT009993 Ppp3r1 protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type I) 1 1
MIRT009994 Znfx1 zinc finger, NFX1-type containing 1 1 1
MIRT009995 Pim3 proviral integration site 3 1 1
MIRT009996 Mlxip MLX interacting protein 1 1
MIRT009997 Adcyap1r1 adenylate cyclase activating polypeptide 1 receptor 1 1 1
MIRT009998 Ryr2 ryanodine receptor 2, cardiac 1 1
MIRT009999 Scp2 sterol carrier protein 2, liver 1 1
MIRT010000 Nf1 neurofibromin 1 1 1
MIRT010001 Rundc3b RUN domain containing 3B 1 1
MIRT010002 Dhcr24 24-dehydrocholesterol reductase 1 1
MIRT010003 Wdr37 WD repeat domain 37 1 1
MIRT010004 Slc1a4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 1 1
MIRT010005 Ugcg UDP-glucose ceramide glucosyltransferase 1 1
MIRT010006 Ralgds ral guanine nucleotide dissociation stimulator 1 1
MIRT010007 Cdc42se2 CDC42 small effector 2 1 1
MIRT010008 Hdac8 histone deacetylase 8 1 1
MIRT010009 Extl3 exostoses (multiple)-like 3 1 1
MIRT010010 Ftsjd2 cap methyltransferase 1 1 1
MIRT010011 Kras Kirsten rat sarcoma viral oncogene homolog 1 1
MIRT010012 Draxin dorsal inhibitory axon guidance protein 1 1
MIRT010013 Cyth1 cytohesin 1 1 1
MIRT010014 Polr3k polymerase (RNA) III (DNA directed) polypeptide K 1 1
MIRT010015 Map4 microtubule-associated protein 4 1 1
MIRT010016 Rabgap1l RAB GTPase activating protein 1-like 1 1
MIRT010017 Pabpc5 poly(A) binding protein, cytoplasmic 5 1 1
MIRT010018 Slc7a2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1 1
MIRT010019 Sepp1 selenoprotein P 1 1
MIRT010020 Capn2 calpain 2 1 1
MIRT010021 Zmat3 zinc finger matrin type 3 1 1
MIRT010022 Extl2 exostoses (multiple)-like 2 1 1
MIRT010023 Zhx3 zinc fingers and homeoboxes 3 1 1
MIRT010024 Rassf4 Ras association (RalGDS/AF-6) domain family member 4 1 1
MIRT010025 Kpnb1 karyopherin (importin) beta 1 1 1
MIRT010026 Tex2 testis expressed gene 2 1 1
MIRT010027 Xpc xeroderma pigmentosum, complementation group C 1 1
MIRT010028 Oprl1 opioid receptor-like 1 1 1
MIRT010029 Sh3bgrl SH3-binding domain glutamic acid-rich protein like 1 1
MIRT010030 Nptx1 neuronal pentraxin 1 1 1
MIRT010031 Hsd17b10 hydroxysteroid (17-beta) dehydrogenase 10 1 1
MIRT010032 Nt5dc3 5'-nucleotidase domain containing 3 1 1
MIRT010033 Rdx radixin 1 1
MIRT010034 Alkbh5 alkB homolog 5, RNA demethylase 1 1
MIRT010035 Fchsd2 FCH and double SH3 domains 2 1 1
MIRT010036 Rnf213 ring finger protein 213 1 1
MIRT010037 Gpm6b glycoprotein m6b 1 1
MIRT010038 Dio2 deiodinase, iodothyronine, type II 1 1
MIRT010039 Ptpn11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT010040 Scn3b sodium channel, voltage-gated, type III, beta 1 1
MIRT010041 Anp32a acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 1 1
MIRT010042 Dnm1l dynamin 1-like 1 1
MIRT010043 Kdelr2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 1 1
MIRT010044 Fn1 fibronectin 1 1 1
MIRT010045 Nudt18 nudix (nucleoside diphosphate linked moiety X)-type motif 18 1 1
MIRT010046 Gpatch8 G patch domain containing 8 1 1
MIRT010047 Msantd4 Myb/SANT-like DNA-binding domain containing 4 with coiled-coils 1 1
MIRT010048 Acap2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT010049 Slc36a1 solute carrier family 36 (proton/amino acid symporter), member 1 1 1
MIRT010050 Klhl42 kelch-like 42 1 1
MIRT010051 Ogfod1 2-oxoglutarate and iron-dependent oxygenase domain containing 1 1 1
MIRT010052 Zfhx3 zinc finger homeobox 3 1 1
MIRT010053 Rab33b RAB33B, member RAS oncogene family 1 1
MIRT010054 Rasgef1a RasGEF domain family, member 1A 1 1
MIRT010055 M6pr mannose-6-phosphate receptor, cation dependent 1 1
MIRT010056 Aff4 AF4/FMR2 family, member 4 1 1
MIRT010057 Med17 mediator complex subunit 17 1 1
MIRT010058 Sema3c sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C 1 1
MIRT010059 Scara5 scavenger receptor class A, member 5 1 1
MIRT010060 Cadm2 cell adhesion molecule 2 1 1
MIRT010061 Dmd dystrophin, muscular dystrophy 1 1
MIRT010062 Tbc1d12 TBC1D12: TBC1 domain family, member 12 1 1
MIRT010063 Mylip myosin regulatory light chain interacting protein 1 1
MIRT010064 Frmpd4 FERM and PDZ domain containing 4 1 1
MIRT010065 Celf2 CUGBP, Elav-like family member 2 1 1
MIRT010066 Mga MAX gene associated 1 1
MIRT010067 Entpd7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT010068 Macf1 microtubule-actin crosslinking factor 1 1 1
MIRT010069 Msl1 male-specific lethal 1 homolog (Drosophila) 1 1
MIRT010070 N4bp2l2 NEDD4 binding protein 2-like 2 1 1
MIRT010071 Cds1 CDP-diacylglycerol synthase 1 1 1
MIRT010072 Prune2 prune homolog 2 1 1
MIRT010073 Ski ski sarcoma viral oncogene homolog (avian) 1 1
MIRT010074 D15Ertd621e family with sequence similarity 91, member A1 1 1
MIRT010075 Wnk1 WNK lysine deficient protein kinase 1 1 1
MIRT010076 Ptprj protein tyrosine phosphatase, receptor type, J 1 1
MIRT010077 Gramd1a GRAM domain containing 1A 1 1
MIRT010078 Tceb3 elongin A 1 1
MIRT010079 Npat nuclear protein in the AT region 1 1
MIRT010080 Cacna2d1 calcium channel, voltage-dependent, alpha2/delta subunit 1 1 1
MIRT010081 Dip2a disco interacting protein 2 homolog A 1 1
MIRT010082 Ajuba ajuba LIM protein 1 1
MIRT010083 Tmem64 transmembrane protein 64 1 1
MIRT010084 Zfp652 zinc finger protein 652 1 1
MIRT010085 Pfn2 profilin 2 1 1
MIRT010086 Tbc1d8b TBC1 domain family, member 8B 1 1
MIRT010087 Scn1a sodium channel, voltage-gated, type I, alpha 1 1
MIRT010088 Ppp6c protein phosphatase 6, catalytic subunit 1 1
MIRT010089 Hid1 HID1 domain containing 1 1
MIRT010090 Trip12 thyroid hormone receptor interactor 12 1 1
MIRT010091 Nr1d2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT010092 Nudcd3 NudC domain containing 3 1 1
MIRT010093 Cend1 cell cycle exit and neuronal differentiation 1 1 1
MIRT010094 Aldh6a1 aldehyde dehydrogenase family 6, subfamily A1 1 1
MIRT010095 Scn2a1 sodium channel, voltage-gated, type II, alpha 1 1
MIRT010096 Lrrn3 leucine rich repeat protein 3, neuronal 1 1
MIRT010097 Rnf220 ring finger protein 220 1 1
MIRT010098 Fbxo9 f-box protein 9 1 1
MIRT010099 Pcf11 PCF11 cleavage and polyadenylation factor subunit 1 1
MIRT010100 Flnb filamin, beta 1 1
MIRT010101 Rogdi rogdi homolog 1 1
MIRT010102 March9 membrane-associated ring finger (C3HC4) 9 1 1
MIRT010103 Ildr2 immunoglobulin-like domain containing receptor 2 1 1
MIRT010104 Limch1 LIM and calponin homology domains 1 1 1
MIRT010105 Cdc7 cell division cycle 7 (S. cerevisiae) 1 1
MIRT010106 Yy1 YY1 transcription factor 1 1
MIRT010107 Arhgef9 CDC42 guanine nucleotide exchange factor (GEF) 9 1 1
MIRT010108 Phlpp1 PH domain and leucine rich repeat protein phosphatase 1 1 1
MIRT010109 Tnks tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 1 1
MIRT010110 4931406C07Rik RIKEN cDNA 4931406C07 gene 1 1
MIRT010111 Kif21a kinesin family member 21A 1 1
MIRT010112 Plxna2 plexin A2 1 1
MIRT010113 Syt11 synaptotagmin XI 1 1
MIRT010114 Btg2 B cell translocation gene 2, anti-proliferative 1 1
MIRT010115 Skil SKI-like 1 1
MIRT010116 Megf9 multiple EGF-like-domains 9 1 1
MIRT010117 Wdr82 WD repeat domain containing 82 1 1
MIRT010118 D630045J12Rik RIKEN cDNA D630045J12 gene 1 1
MIRT010119 Igfbp7 insulin-like growth factor binding protein 7 1 1
MIRT010120 Tfe3 transcription factor E3 1 1
MIRT010121 Elovl6 ELOVL family member 6, elongation of long chain fatty acids (yeast) 1 1
MIRT010122 Ppap2b phospholipid phosphatase 3 1 1
MIRT010123 Sox8 SRY (sex determining region Y)-box 8 1 1
MIRT010124 Gxylt1 glucoside xylosyltransferase 1 1 1
MIRT010125 Mgll monoglyceride lipase 1 1
MIRT010126 Amot angiomotin 1 1
MIRT010127 Appl2 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 1 1
MIRT010128 Tenm4 teneurin transmembrane protein 4 1 1
MIRT010129 Myo10 myosin X 1 1
MIRT010130 Nfia nuclear factor I/A 1 1
MIRT010131 Mycbp MYC binding protein 1 1
MIRT010132 2510009E07Rik RIKEN cDNA 2510009E07 gene 1 1
MIRT010133 Ccdc88a coiled coil domain containing 88A 1 1
MIRT010134 Chl1 cell adhesion molecule L1-like 1 1
MIRT010135 Grb10 growth factor receptor bound protein 10 1 1
MIRT010136 Fat2 FAT atypical cadherin 2 1 1
MIRT010137 Map2 microtubule-associated protein 2 1 1
MIRT010138 Sh3d19 SH3 domain protein D19 1 1
MIRT010139 Sall3 sal-like 3 (Drosophila) 1 1
MIRT010140 Taok1 TAO kinase 1 1 1
MIRT010141 Trim2 tripartite motif-containing 2 1 1
MIRT010142 Arap2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT010143 Slc35f3 solute carrier family 35, member F3 1 1
MIRT010144 Erbb4 erb-b2 receptor tyrosine kinase 4 1 1
MIRT010145 Ubr3 ubiquitin protein ligase E3 component n-recognin 3 1 1
MIRT010146 Brwd1 bromodomain and WD repeat domain containing 1 1 1
MIRT010147 Serinc1 serine incorporator 1 1 1
MIRT010148 Ep300 E1A binding protein p300 1 1
MIRT010149 Pank1 pantothenate kinase 1 1 1
MIRT010150 Rcan3 regulator of calcineurin 3 1 1
MIRT010151 Sez6l seizure related 6 homolog like 1 1
MIRT010152 Adam10 a disintegrin and metallopeptidase domain 10 1 1
MIRT010153 Pvr poliovirus receptor 1 1
MIRT010154 Tmed8 transmembrane p24 trafficking protein 8 1 1
MIRT010155 4930506M07Rik shootin 1 1 1
MIRT010156 Mapre3 microtubule-associated protein, RP/EB family, member 3 1 1
MIRT010157 Ankrd17 ankyrin repeat domain 17 1 1
MIRT010158 Celsr2 cadherin, EGF LAG seven-pass G-type receptor 2 1 1
MIRT010159 Gabbr2 gamma-aminobutyric acid (GABA) B receptor, 2 1 1
MIRT010160 Zfp217 zinc finger protein 217 1 1
MIRT010161 Sobp sine oculis-binding protein homolog (Drosophila) 1 1
MIRT010162 Ythdf3 YTH domain family 3 1 1
MIRT010163 Lrrc3 leucine rich repeat containing 3 1 1
MIRT010164 Klhl20 kelch-like 20 1 1
MIRT010165 Gpr63 G protein-coupled receptor 63 1 1
MIRT010166 Otud4 OTU domain containing 4 1 1
MIRT010167 Stxbp5 syntaxin binding protein 5 (tomosyn) 1 1
MIRT010168 Slc17a7 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 1 1
MIRT010169 Rab11fip4 RAB11 family interacting protein 4 (class II) 1 1
MIRT010170 Ttc9 tetratricopeptide repeat domain 9 1 1
MIRT010171 Tmod2 tropomodulin 2 1 1
MIRT010172 Fbxo21 F-box protein 21 1 1
MIRT010173 App amyloid beta (A4) precursor protein 1 1
MIRT010174 Rora RAR-related orphan receptor alpha 1 1
MIRT010175 Tmcc1 transmembrane and coiled coil domains 1 1 1
MIRT010176 D4Wsu53e arginine/serine rich protein 1 1 1
MIRT010177 Lrch1 leucine-rich repeats and calponin homology (CH) domain containing 1 1 1
MIRT010178 Dpysl5 dihydropyrimidinase-like 5 1 1
MIRT010179 Ficd FIC domain containing 1 1
MIRT010180 Fam134a reticulophagy regulator family member 2 1 1
MIRT010181 Pcdhac1 protocadherin alpha subfamily C, 1 1 1
MIRT010182 Rgma repulsive guidance molecule family member A 1 1
MIRT010183 Abca1 ATP-binding cassette, sub-family A (ABC1), member 1 1 1
MIRT010184 Foxp1 forkhead box P1 1 1
MIRT053654 Zfpm2 zinc finger protein, multitype 2 3 1
MIRT054318 Hbp1 high mobility group box transcription factor 1 3 1
MIRT054658 Trp53inp1 transformation related protein 53 inducible nuclear protein 1 3 1
MIRT054697 Tbx3 T-box 3 3 2
MIRT054700 Fgf10 fibroblast growth factor 10 3 1
MIRT054703 Shox2 short stature homeobox 2 3 2
MIRT054704 Osr1 odd-skipped related 1 (Drosophila) 3 1
MIRT437543 Timp2 tissue inhibitor of metalloproteinase 2 4 2
MIRT437544 Timp1 tissue inhibitor of metalloproteinase 1 3 1
MIRT438451 Tceal1 transcription elongation factor A (SII)-like 1 3 1
MIRT438660 Vegfa vascular endothelial growth factor A 2 1
MIRT579568 Fam227a family with sequence similarity 227, member A 1 2
MIRT579898 Zbtb41 zinc finger and BTB domain containing 41 1 1
MIRT581955 Pdp2 pyruvate dehyrogenase phosphatase catalytic subunit 2 1 1
MIRT582232 Neurl1b neuralized E3 ubiquitin protein ligase 1B 1 1
MIRT582243 Nedd4l neural precursor cell expressed, developmentally down-regulated gene 4-like 1 1
MIRT582785 Kdm2a lysine (K)-specific demethylase 2A 1 1
MIRT584410 Cd28 CD28 antigen 1 2
MIRT585755 St8sia3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 1 1
MIRT589803 Id1 inhibitor of DNA binding 1 1 1
MIRT593371 Pcdh10 protocadherin 10 1 1
MIRT593560 Ppp1r3b protein phosphatase 1, regulatory (inhibitor) subunit 3B 1 1
MIRT594600 Ptp4a2 protein tyrosine phosphatase 4a2 1 1
MIRT594634 Morf4l1 mortality factor 4 like 1 1 1
MIRT595285 Mef2c myocyte enhancer factor 2C 1 1
MIRT595293 Mctp2 multiple C2 domains, transmembrane 2 1 1
MIRT595356 Fgfr1op2 FGFR1 oncogene partner 2 1 1
MIRT595987 Larp1 La ribonucleoprotein domain family, member 1 1 1
MIRT596213 Ago4 argonaute RISC catalytic subunit 4 1 1
MIRT603877 Il10rb interleukin 10 receptor, beta 1 1
MIRT731344 Ulk1 unc-51 like kinase 1 1 1
MIRT731807 Smad5 SMAD family member 5 3 1
MIRT756363 Tgfbr2 transforming growth factor, beta receptor II 4 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-17 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-17 Polylysine NULL 162282 Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-17 Trypaflavine NULL NULL Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-17 5-azacytidine (5-AzaC) approved 9444 Quantitative real-time PCR chronic myeloid leukemia (CML)K562 cell line 21176349 2011 down-regulated
miR-17 Testosterone + 1,25-Dihydroxyvitamin D3 approved NULL Microarray prostate cancer 21592394 2011 down-regulated
miR-17 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-17 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-17 Sulindac sulfide approved 5352624 Quantitative real-time PCR HCT116 colon tumor cells 22286762 2012 down-regulated
miR-17 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-17 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-17 Bicalutamide approved 2375 Quantitative real-time PCR LNCaP cells 22674191 2012 down-regulated
miR-17 Proanthocyanin NULL 108065 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-17 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-17 Dexamethasone approved 5743 Quantitative real-time PCR WEHI7.2 murine T-cell lymphoma cell line 21239610 2011 down-regulated
miR-17 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-17-5p cisplatin approved 84093 Quantitative real-time PCR K562 cell 20428827 2010 up-regulated
miR-17-5p Camptothecin NULL 24360 Microarray human cancer cells 24252850 2014 down-regulated
miR-17-5p 17beta-estradiol (E2) approved 5757 Quantitative real-time PCR endometrial stromal 19088369 2008 up-regulated
miR-17-5p 17beta-estradiol (E2) approved 5757 Quantitative real-time PCR glandular epithelial cells 19088369 2008 up-regulated
miR-17-5p Medroxyprogesterone acetate approved 6279 Quantitative real-time PCR endometrial stromal 19088369 2008 up-regulated
miR-17-5p Medroxyprogesterone acetate approved 6279 Quantitative real-time PCR glandular epithelial cells 19088369 2008 up-regulated
miR-17-5p 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
miR-17-5p Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-17-5p Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-17-5p Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-17-5p Tamoxifen approved 2733526 Quantitative real-time PCR rat liver 17343880 2007 up-regulated
miR-17-5p 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 up-regulated
miR-17-5p 17beta-estradiol (E2) approved 5757 Quantitative real-time PCR rat breast 17700064 2007 up-regulated
miR-17-5p Acarbose Approved 444254 Microarray diabetic rats cells 24260283 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-17-5p Etoposide 36462 NSC141540 approved resistant Low Leukemia tissue and cell line (K562, HL60)

Error report submission