pre-miRNA Information
pre-miRNA mmu-mir-324   
Genomic Coordinates chr11: 70012043 - 70012131
Synonyms Mirn324, mir-324, mmu-mir-324, Mir324
Description Mus musculus miR-324 stem-loop
Comment Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-324-3p
Sequence 53| CCACUGCCCCAGGUGCUGCU |72
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Osbpl9   
Synonyms 2600011I06Rik, AU015843, Orp-9
Description oxysterol binding protein-like 9
Transcript NM_001134791   
Other Transcripts NM_133885 , NM_173350   
Expression
Putative miRNA Targets on Osbpl9
3'UTR of Osbpl9
(miRNA target sites are highlighted)
>Osbpl9|NM_001134791|3'UTR
   1 GCCGACAACCGAGTCCACACCTGGTGACCAGGGCAGTAGGCGTAATTAAGCAACAATCGATCTTCCTTCAGGAGAGCTTG
  81 TCACTTCCTTCTTAACGCAGTGGTTCCTATCTCAGGGATACTGGACTTGACGACACAGATGAACAATTAAAGTGGAAACC
 161 GCTTCCCTTTTCTCCTCTGTGGCAGTTACAATTTTGACTTCAGGCCTGAGAAAAACTTCAGGTTTCGAAACATGACATCT
 241 CTTCCTTTTCCAGATCCCATGCTTTGAAAAATATTTATAGACAGTTCCAGGTCTCAGCTTCCTGTCCTCTAGTTCTGCTG
 321 TTCGGGCATAAAATCTTTATCTCCAGTTCATATAATCTTGAGTTTTAGATATACACACATGCGTAACAGCTGACAGTTTT
 401 TCACAAGTACACCCACCTGTAAATACTGTATCCTCAGTTTAGAAAATTAGTGCAATGTATGAAAATCAAGTGTTAGGAAA
 481 TTTCATGGTTTCACCTATAACCTTTATTTTAGAATTGAACTATGATTAGATTGTATCTAAACCTGAAGTATAATTATATG
 561 CAGTGCTTCTTAAGGCTTCATAAAATAATTTTCCAACCTTTTTAAAAATATGTTTCTTTCATTGTTTTATACCTAACCTT
 641 GCAGACCAACCTGGCAGCCTTTTCTGAGGCTCCCCGACTCAAGCCCTCCGGCTAGTCCTGGATGCCTTACTGCCTCGCAG
 721 GGCTGGAGGACTGCACTTCCCCCACCCCACCCCCAAAAAAGCCACGGCAGATGGCTTGATGTGAAGGGATATACAGAACT
 801 ATGTTTACTTTAAAGTACATTAAAAAAACAAAACCAGGGCAGTTTGGTGCTATAACAAATTAATTACAGATAGGCACACA
 881 AGAGCTGGGTTCTCCTCAGAGGACACAGGCCAGGGGCCCCCACATTGCTGACGTAAGTGTTTGGGTCACACTTGCCTACT
 961 ATCTCATTGCCATCCTGAGCTAATCTTGTAGAGGAAAGGTAAAAAGTAAATCAAATCCTAGGTTGCCATCGAAAAAATCC
1041 AATGGAAGCCCTAAGGCAGCAGTGTAACTCCATAAAATGCACACACGTCTTTAAATACACGTTGCTTCAGGCC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucGUCGUGGAC-------CCCGUCAcc 5'
            || ||||||       |||||||  
Target 5' tcCA-CACCTGGTGACCAGGGCAGTag 3'
14 - 39 137.00 -21.01
2
miRNA  3' ucgucGUGGACCCCGUCAcc 5'
               | :||| ||||||  
Target 5' tttctCCTCTGTGGCAGTta 3'
169 - 188 135.00 -13.20
3
miRNA  3' ucGUCGUGGACCCCGUCAcc 5'
            ||  |||  |||||||  
Target 5' aaCAAAACC-AGGGCAGTtt 3'
827 - 845 133.00 -15.60
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
351 mmu-miR-324-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT010726 March8 membrane-associated ring finger (C3HC4) 8 1 1
MIRT010727 Lix1 limb and CNS expressed 1 1 1
MIRT010728 Cplx1 complexin 1 1 1
MIRT010729 Mapk6 mitogen-activated protein kinase 6 1 1
MIRT010730 Fam19a5 family with sequence similarity 19, member A5 1 1
MIRT010731 Myo6 myosin VI 1 1
MIRT010732 Galnt7 UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 7 1 1
MIRT010733 Fam195b MAPK regulated corepressor interacting protein 1 1 1
MIRT010734 Syp synaptophysin 1 1
MIRT010735 Gspt2 G1 to S phase transition 2 1 1
MIRT010736 Gpam glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT010737 Tln1 talin 1 1 1
MIRT010738 Gja1 gap junction protein, alpha 1 1 1
MIRT010739 Gprin3 GPRIN family member 3 1 1
MIRT010740 Cd99l2 CD99 antigen-like 2 1 1
MIRT010741 Lfng LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT010742 Katnbl1 katanin p80 subunit B like 1 1 1
MIRT010743 Clock circadian locomotor output cycles kaput 1 1
MIRT010744 Garnl3 GTPase activating RANGAP domain-like 3 1 1
MIRT010745 Lsamp limbic system-associated membrane protein 1 1
MIRT010746 Zkscan8 zinc finger with KRAB and SCAN domains 8 1 1
MIRT010747 Lipa lysosomal acid lipase A 1 1
MIRT010748 Acot7 acyl-CoA thioesterase 7 1 1
MIRT010749 Stx17 syntaxin 17 1 1
MIRT010750 Smad3 SMAD family member 3 1 1
MIRT010751 Fbxo18 F-box protein 18 1 1
MIRT010752 Fam171b family with sequence similarity 171, member B 1 1
MIRT010753 Kif1b kinesin family member 1B 1 1
MIRT010754 Slc17a6 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 1 1
MIRT010755 Gga3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT010756 Vat1 vesicle amine transport 1 1 1
MIRT010757 Eif1a eukaryotic translation initiation factor 1A 1 1
MIRT010758 Heg1 heart development protein with EGF-like domains 1 1 1
MIRT010759 Itm2c integral membrane protein 2C 1 1
MIRT010760 Nr2c2 nuclear receptor subfamily 2, group C, member 2 1 1
MIRT010761 Tor1aip2 torsin A interacting protein 2 1 1
MIRT010762 Rmnd5a required for meiotic nuclear division 5 homolog A 1 1
MIRT010763 Cav2 caveolin 2 1 1
MIRT010764 March6 membrane-associated ring finger (C3HC4) 6 2 2
MIRT010765 Zfp516 zinc finger protein 516 1 1
MIRT010766 4931428F04Rik RIKEN cDNA 4931428F04 gene 1 1
MIRT010767 Cln8 ceroid-lipofuscinosis, neuronal 8 1 1
MIRT010768 Ccdc50 coiled-coil domain containing 50 1 1
MIRT010769 Gpc1 glypican 1 1 1
MIRT010770 Gabra1 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 1 1
MIRT010771 Rap2c RAP2C, member of RAS oncogene family 1 1
MIRT010772 Ttc3 tetratricopeptide repeat domain 3 1 1
MIRT010773 Rabgap1l RAB GTPase activating protein 1-like 1 1
MIRT010774 Shc4 SHC (Src homology 2 domain containing) family, member 4 1 1
MIRT010775 Canx calnexin 1 1
MIRT010776 Hyal1 hyaluronoglucosaminidase 1 1 1
MIRT010777 Acss1 acyl-CoA synthetase short-chain family member 1 1 1
MIRT010778 Zfp521 zinc finger protein 521 1 1
MIRT010779 Sytl2 synaptotagmin-like 2 1 1
MIRT010780 Tpra1 transmembrane protein, adipocyte asscociated 1 1 1
MIRT010781 Lnpep leucyl/cystinyl aminopeptidase 1 1
MIRT010782 Fem1b feminization 1 homolog b (C. elegans) 1 1
MIRT010783 Gabrb2 gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 1 1
MIRT010784 Smad4 SMAD family member 4 1 1
MIRT010785 Cadm3 cell adhesion molecule 3 1 1
MIRT010786 Tm9sf4 transmembrane 9 superfamily protein member 4 1 1
MIRT010787 Tmem131 transmembrane protein 131 1 1
MIRT010788 Zeb2 zinc finger E-box binding homeobox 2 1 1
MIRT010789 Zfp414 zinc finger protein 414 1 1
MIRT010790 Pygb brain glycogen phosphorylase 1 1
MIRT010791 Gnptab N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits 1 1
MIRT010792 Prrt1 proline-rich transmembrane protein 1 1 1
MIRT010793 Jam2 junction adhesion molecule 2 1 1
MIRT010794 Ppp3r1 protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type I) 1 1
MIRT010795 Utrn utrophin 1 1
MIRT010796 H2-D1 histocompatibility 2, D region locus 1 1 1
MIRT010797 Lrrc4 leucine rich repeat containing 4 1 1
MIRT010798 Epb4.1l2 erythrocyte membrane protein band 4.1 like 2 1 1
MIRT010799 Patl1 protein associated with topoisomerase II homolog 1 (yeast) 1 1
MIRT010800 Ppig peptidyl-prolyl isomerase G (cyclophilin G) 1 1
MIRT010801 Evl Ena-vasodilator stimulated phosphoprotein 1 1
MIRT010802 Ralgapb Ral GTPase activating protein, beta subunit (non-catalytic) 1 1
MIRT010803 Clcn4-2 chloride channel, voltage-sensitive 4 1 1
MIRT010804 Anxa5 annexin A5 1 1
MIRT010805 Akap9 A kinase (PRKA) anchor protein (yotiao) 9 1 1
MIRT010806 Hdac6 histone deacetylase 6 1 1
MIRT010807 Nuak1 NUAK family, SNF1-like kinase, 1 1 1
MIRT010808 Rela v-rel reticuloendotheliosis viral oncogene homolog A (avian) 1 1
MIRT010809 Impad1 inositol monophosphatase domain containing 1 1 1
MIRT010810 Ncan neurocan 1 1
MIRT010811 Usp6nl USP6 N-terminal like 1 1
MIRT010812 2700081O15Rik RIKEN cDNA 2700081O15 gene 1 1
MIRT010813 Slc24a2 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 1 1
MIRT010814 Mbip MAP3K12 binding inhibitory protein 1 1 1
MIRT010815 Bag4 BCL2-associated athanogene 4 1 1
MIRT010816 Eps15 epidermal growth factor receptor pathway substrate 15 1 1
MIRT010817 Gnao1 guanine nucleotide binding protein, alpha O 1 1
MIRT010818 Ncam1 neural cell adhesion molecule 1 1 1
MIRT010819 Bola2 bolA-like 2 (E. coli) 1 1
MIRT010820 Lin7c lin-7 homolog C (C. elegans) 1 1
MIRT010821 Whsc1l1 nuclear receptor binding SET domain protein 3 1 1
MIRT010822 Enpp4 ectonucleotide pyrophosphatase/phosphodiesterase 4 1 1
MIRT010823 Slc4a8 solute carrier family 4 (anion exchanger), member 8 1 1
MIRT010824 Pptc7 PTC7 protein phosphatase homolog 1 1
MIRT010825 Fbxl18 F-box and leucine-rich repeat protein 18 1 1
MIRT010826 Mtmr4 myotubularin related protein 4 1 1
MIRT010827 Chd4 chromodomain helicase DNA binding protein 4 1 1
MIRT010828 Intu inturned planar cell polarity protein 1 1
MIRT010829 Faf2 Fas associated factor family member 2 1 1
MIRT010830 Vezt vezatin, adherens junctions transmembrane protein 1 1
MIRT010831 Tacc1 transforming, acidic coiled-coil containing protein 1 1 1
MIRT010832 Zzef1 zinc finger, ZZ-type with EF hand domain 1 1 1
MIRT010833 Frmd5 FERM domain containing 5 1 1
MIRT010834 Ocln occludin 1 1
MIRT010835 Dpysl2 dihydropyrimidinase-like 2 1 1
MIRT010836 Baz2a bromodomain adjacent to zinc finger domain, 2A 1 1
MIRT010837 Syt1 synaptotagmin I 1 1
MIRT010838 Reep1 receptor accessory protein 1 1 1
MIRT010839 Ankrd46 ankyrin repeat domain 46 1 1
MIRT010840 Narg2 interactor of little elongation complex ELL subunit 2 1 1
MIRT010841 C230081A13Rik pseudopodium-enriched atypical kinase 1 1 1
MIRT010842 Kif5c kinesin family member 5C 1 1
MIRT010843 Pip4k2c phosphatidylinositol-5-phosphate 4-kinase, type II, gamma 1 1
MIRT010844 Ugt8a UDP galactosyltransferase 8A 1 1
MIRT010845 Klf9 Kruppel-like factor 9 1 1
MIRT010846 Ppapdc1b phospholipid phosphatase 5 1 1
MIRT010847 Iqsec2 IQ motif and Sec7 domain 2 1 1
MIRT010848 Dvl2 dishevelled segment polarity protein 2 1 1
MIRT010849 Tmx4 thioredoxin-related transmembrane protein 4 1 1
MIRT010850 Slc31a1 solute carrier family 31, member 1 1 1
MIRT010851 Oxsr1 oxidative-stress responsive 1 1 1
MIRT010852 Snx30 sorting nexin family member 30 1 1
MIRT010853 Klhl23 kelch-like 23 1 1
MIRT010854 Zmat4 zinc finger, matrin type 4 1 1
MIRT010855 Ap2a2 adaptor-related protein complex 2, alpha 2 subunit 1 1
MIRT010856 Cbx5 chromobox 5 1 1
MIRT010857 Slc25a46 solute carrier family 25, member 46 1 1
MIRT010858 Ryk receptor-like tyrosine kinase 1 1
MIRT010859 Lmbrd1 LMBR1 domain containing 1 1 1
MIRT010860 Spred2 sprouty-related, EVH1 domain containing 2 1 1
MIRT010861 Frs2 fibroblast growth factor receptor substrate 2 1 1
MIRT010862 Acvr1b activin A receptor, type 1B 1 1
MIRT010863 Snn stannin 1 1
MIRT010864 Dgcr2 DiGeorge syndrome critical region gene 2 1 1
MIRT010865 Col12a1 collagen, type XII, alpha 1 1 1
MIRT010866 Fam104a family with sequence similarity 104, member A 1 1
MIRT010867 Cbfb core binding factor beta 1 1
MIRT010868 Sdc2 syndecan 2 1 1
MIRT010869 Cdc27 cell division cycle 27 1 1
MIRT010870 G3bp2 GTPase activating protein (SH3 domain) binding protein 2 1 1
MIRT010871 Riok3 RIO kinase 3 1 1
MIRT010872 Osbpl9 oxysterol binding protein-like 9 1 1
MIRT010873 Prkcb protein kinase C, beta 1 1
MIRT010874 Chrna4 cholinergic receptor, nicotinic, alpha polypeptide 4 1 1
MIRT010875 Padi2 peptidyl arginine deiminase, type II 1 1
MIRT010876 Cd200 CD200 antigen 1 1
MIRT010877 Nck1 non-catalytic region of tyrosine kinase adaptor protein 1 1 1
MIRT010878 Pan3 PAN3 poly(A) specific ribonuclease subunit 1 1
MIRT010879 Pex19 peroxisomal biogenesis factor 19 1 1
MIRT010880 Ywhab tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 1 1
MIRT010881 Cfl2 cofilin 2, muscle 1 1
MIRT010882 Ppp1r1a protein phosphatase 1, regulatory (inhibitor) subunit 1A 1 1
MIRT010883 Dos calcium channel, voltage-dependent, beta subunit associated regulatory protein 1 1
MIRT010884 Zmym4 zinc finger, MYM-type 4 1 1
MIRT010885 Rabl3 RAB, member RAS oncogene family-like 3 1 1
MIRT010886 Laptm4a lysosomal-associated protein transmembrane 4A 1 1
MIRT010887 Mmp24 matrix metallopeptidase 24 1 1
MIRT010888 Pfkfb2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT010889 Atp6v1b2 ATPase, H+ transporting, lysosomal V1 subunit B2 1 1
MIRT010890 Arhgdia Rho GDP dissociation inhibitor (GDI) alpha 1 1
MIRT010891 Pard6g par-6 family cell polarity regulator gamma 1 1
MIRT010892 Igbp1 immunoglobulin (CD79A) binding protein 1 1 1
MIRT010893 Arpp21 cyclic AMP-regulated phosphoprotein, 21 1 1
MIRT010894 Scn3b sodium channel, voltage-gated, type III, beta 1 1
MIRT010895 Nmb neuromedin B 1 1
MIRT010896 Rab5b RAB5B, member RAS oncogene family 1 1
MIRT010897 Tgfbr2 transforming growth factor, beta receptor II 1 1
MIRT010898 Trps1 transcriptional repressor GATA binding 1 1 1
MIRT010899 Snhg11 small nucleolar RNA host gene 11 1 1
MIRT010900 Rock2 Rho-associated coiled-coil containing protein kinase 2 1 1
MIRT010901 Ccdc25 coiled-coil domain containing 25 1 1
MIRT010902 Ash1l ash1 (absent, small, or homeotic)-like (Drosophila) 1 1
MIRT010903 Ralgds ral guanine nucleotide dissociation stimulator 1 1
MIRT010904 Nlgn2 neuroligin 2 1 1
MIRT010905 Ankrd12 ankyrin repeat domain 12 1 1
MIRT010906 Gtf2i general transcription factor II I 1 1
MIRT010907 Lrrc58 leucine rich repeat containing 58 1 1
MIRT010908 Macf1 microtubule-actin crosslinking factor 1 1 1
MIRT010909 Alkbh5 alkB homolog 5, RNA demethylase 1 1
MIRT010910 Cldn25 claudin domain containing 1 1 1
MIRT010911 Nfxl1 nuclear transcription factor, X-box binding-like 1 1 1
MIRT010912 Ttpal tocopherol (alpha) transfer protein-like 1 1
MIRT010913 Antxr1 anthrax toxin receptor 1 1 1
MIRT010914 Hook1 hook microtubule tethering protein 1 1 1
MIRT010915 Fam135a family with sequence similarity 135, member A 1 1
MIRT010916 Slc22a23 solute carrier family 22, member 23 1 1
MIRT010917 Asxl2 additional sex combs like 2 (Drosophila) 1 1
MIRT010918 Caln1 calneuron 1 1 1
MIRT010919 Gpm6b glycoprotein m6b 1 1
MIRT010920 Igf1r insulin-like growth factor I receptor 1 1
MIRT010921 Rhov ras homolog family member V 1 1
MIRT010922 Tmem135 transmembrane protein 135 1 1
MIRT010923 Astn1 astrotactin 1 1 1
MIRT010924 Etv3 ets variant 3 1 1
MIRT010925 Crat carnitine acetyltransferase 1 1
MIRT010926 Pim3 proviral integration site 3 1 1
MIRT010927 Klhl32 kelch-like 32 1 1
MIRT010928 Ppp6c protein phosphatase 6, catalytic subunit 1 1
MIRT010929 Abl1 c-abl oncogene 1, non-receptor tyrosine kinase 1 1
MIRT010930 Kitl kit ligand 1 1
MIRT010931 Scn4b sodium channel, type IV, beta 1 1
MIRT010932 Pcmtd2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 1 1
MIRT010933 Pcnx pecanex homolog (Drosophila) 1 1
MIRT010934 Tcf4 transcription factor 4 1 1
MIRT010935 Ntrk2 neurotrophic tyrosine kinase, receptor, type 2 1 1
MIRT010936 Rc3h2 ring finger and CCCH-type zinc finger domains 2 1 1
MIRT010937 Pik3ca phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha 1 1
MIRT010938 Zfp652 zinc finger protein 652 1 1
MIRT010939 Mecp2 methyl CpG binding protein 2 1 1
MIRT010940 Ankrd28 ankyrin repeat domain 28 1 1
MIRT010941 Wnk1 WNK lysine deficient protein kinase 1 1 1
MIRT010942 Usp46 ubiquitin specific peptidase 46 1 1
MIRT010943 Csrnp2 cysteine-serine-rich nuclear protein 2 1 1
MIRT010944 Ablim1 actin-binding LIM protein 1 1 1
MIRT010945 Adcyap1r1 adenylate cyclase activating polypeptide 1 receptor 1 1 1
MIRT010946 Slc12a2 solute carrier family 12, member 2 1 1
MIRT010947 Rab6b RAB6B, member RAS oncogene family 1 1
MIRT010948 Mettl16 methyltransferase like 16 1 1
MIRT010949 Arl6ip5 ADP-ribosylation factor-like 6 interacting protein 5 1 1
MIRT010950 Usp7 ubiquitin specific peptidase 7 1 1
MIRT010951 Dag1 dystroglycan 1 1 1
MIRT010952 Maml1 mastermind like 1 (Drosophila) 1 1
MIRT010953 Tanc2 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 1 1
MIRT010954 Rab6a RAB6A, member RAS oncogene family 1 1
MIRT010955 Kmt2a lysine (K)-specific methyltransferase 2A 1 1
MIRT010956 Ric3 RIC3 acetylcholine receptor chaperone 1 1
MIRT010957 Pdzd2 PDZ domain containing 2 1 1
MIRT010958 Ccdc127 coiled-coil domain containing 127 1 1
MIRT010959 4933426M11Rik sushi domain containing 6 1 1
MIRT010960 Cnot6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT010961 Scamp1 secretory carrier membrane protein 1 1 1
MIRT010962 Rassf4 Ras association (RalGDS/AF-6) domain family member 4 1 1
MIRT010963 Rgl1 ral guanine nucleotide dissociation stimulator,-like 1 1 1
MIRT010964 Slc35d1 solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 1 1
MIRT010965 Fbxw7 F-box and WD-40 domain protein 7 1 1
MIRT010966 Dmtf1 cyclin D binding myb-like transcription factor 1 1 1
MIRT010967 Il1r1 interleukin 1 receptor, type I 1 1
MIRT010968 Zfyve26 zinc finger, FYVE domain containing 26 1 1
MIRT010969 Gpatch8 G patch domain containing 8 1 1
MIRT010970 Mapk14 mitogen-activated protein kinase 14 1 1
MIRT010971 Mkrn2 makorin, ring finger protein, 2 1 1
MIRT010972 Pip4k2b phosphatidylinositol-5-phosphate 4-kinase, type II, beta 1 1
MIRT010973 Syt11 synaptotagmin XI 1 1
MIRT010974 Myt1 myelin transcription factor 1 1 1
MIRT010975 Bmpr1a bone morphogenetic protein receptor, type 1A 1 1
MIRT010976 Tmod2 tropomodulin 2 1 1
MIRT010977 Tenm4 teneurin transmembrane protein 4 1 1
MIRT010978 Ccnjl cyclin J-like 1 1
MIRT010979 Nme1 NME/NM23 nucleoside diphosphate kinase 1 1 1
MIRT010980 Cpeb2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT010981 Gigyf2 GRB10 interacting GYF protein 2 1 1
MIRT010982 Lrrc57 leucine rich repeat containing 57 1 1
MIRT010983 Fndc5 fibronectin type III domain containing 5 1 1
MIRT010984 Ept1 selenoprotein I 1 1
MIRT010985 Slc12a7 solute carrier family 12, member 7 1 1
MIRT010986 Rbm39 RNA binding motif protein 39 1 1
MIRT010987 Esyt2 extended synaptotagmin-like protein 2 1 1
MIRT010988 Zmiz1 zinc finger, MIZ-type containing 1 1 1
MIRT010989 Rap1gap Rap1 GTPase-activating protein 1 1
MIRT010990 Gnb1 guanine nucleotide binding protein (G protein), beta 1 1 1
MIRT010991 Gfap glial fibrillary acidic protein 1 1
MIRT010992 Zeb1 zinc finger E-box binding homeobox 1 1 1
MIRT010993 Clip1 CAP-GLY domain containing linker protein 1 1 1
MIRT010994 Ngfrap1 brain expressed X-linked 3 1 1
MIRT010995 Hs3st5 heparan sulfate (glucosamine) 3-O-sulfotransferase 5 1 1
MIRT010996 Drd2 dopamine receptor D2 1 1
MIRT010997 Ttyh3 tweety family member 3 1 1
MIRT010998 Lpgat1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT010999 Mtmr6 myotubularin related protein 6 1 1
MIRT011000 Nedd4 neural precursor cell expressed, developmentally down-regulated 4 1 1
MIRT011001 Slc6a6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1 1
MIRT011002 Nudcd3 NudC domain containing 3 1 1
MIRT011003 Mid2 midline 2 1 1
MIRT011004 Ank2 ankyrin 2, brain 1 1
MIRT011005 Ednra endothelin receptor type A 1 1
MIRT011006 Myo18a myosin XVIIIA 1 1
MIRT011007 Mtch1 mitochondrial carrier 1 1 1
MIRT011008 Ppm1f protein phosphatase 1F (PP2C domain containing) 1 1
MIRT011009 Cpm carboxypeptidase M 1 1
MIRT011010 Adam10 a disintegrin and metallopeptidase domain 10 1 1
MIRT011011 L1cam L1 cell adhesion molecule 1 1
MIRT011012 Lrp3 low density lipoprotein receptor-related protein 3 1 1
MIRT011013 Jazf1 JAZF zinc finger 1 1 1
MIRT011014 Hpcal4 hippocalcin-like 4 1 1
MIRT011015 Sfmbt1 Scm-like with four mbt domains 1 1 1
MIRT011016 Rit1 Ras-like without CAAX 1 1 1
MIRT011017 Fam73a mitoguardin 1 1 1
MIRT011018 Rnf44 ring finger protein 44 1 1
MIRT011019 Tmem109 transmembrane protein 109 1 1
MIRT011020 Dkk3 dickkopf WNT signaling pathway inhibitor 3 1 1
MIRT011021 Rogdi rogdi homolog 1 1
MIRT011022 Gria2 glutamate receptor, ionotropic, AMPA2 (alpha 2) 1 1
MIRT011023 Papd7 PAP associated domain containing 7 1 1
MIRT011024 Reep5 receptor accessory protein 5 1 1
MIRT011025 Gfod1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT011026 Ulk1 unc-51 like kinase 1 1 1
MIRT011027 Tsc1 tuberous sclerosis 1 1 1
MIRT011028 Adcy5 adenylate cyclase 5 1 1
MIRT011029 2810407C02Rik selenoprotein T 1 1
MIRT011030 Stx16 syntaxin 16 1 1
MIRT011031 Pacs2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT011032 Slc43a2 solute carrier family 43, member 2 1 1
MIRT011033 Atrn attractin 1 1
MIRT011034 Cnksr3 Cnksr family member 3 1 1
MIRT011035 Ctnnb1 catenin (cadherin associated protein), beta 1 1 1
MIRT011036 Zfp106 zinc finger protein 106 1 1
MIRT011037 Dnajc5 DnaJ heat shock protein family (Hsp40) member C5 1 1
MIRT011038 Cacna2d3 calcium channel, voltage-dependent, alpha2/delta subunit 3 1 1
MIRT011039 Prkdc protein kinase, DNA activated, catalytic polypeptide 1 1
MIRT011040 Gatsl2 GATS protein-like 2 1 1
MIRT011041 Rsbn1l round spermatid basic protein 1-like 1 1
MIRT011042 Map2k1 mitogen-activated protein kinase kinase 1 1 1
MIRT011043 Ap2b1 adaptor-related protein complex 2, beta 1 subunit 1 1
MIRT011044 Nrsn1 neurensin 1 1 1
MIRT011045 Ywhag tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 1 1
MIRT011046 Smarca4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 1 1
MIRT011047 Smg7 Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) 1 1
MIRT011048 Zfp148 zinc finger protein 148 1 1
MIRT011049 Zfp592 zinc finger protein 592 1 1
MIRT011050 Gda guanine deaminase 1 1
MIRT011051 Wasf2 WAS protein family, member 2 1 1
MIRT011052 Nploc4 NPL4 homolog, ubiquitin recognition factor 1 1
MIRT011053 Rab3c RAB3C, member RAS oncogene family 1 1
MIRT011054 Mdn1 midasin AAA ATPase 1 1 1
MIRT011055 Zzz3 zinc finger, ZZ domain containing 3 2 8
MIRT011056 Osbpl8 oxysterol binding protein-like 8 1 1
MIRT011057 Syncrip synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT011058 Pds5b PDS5 cohesin associated factor B 1 1
MIRT011059 Nup50 nucleoporin 50 1 1
MIRT011060 Wdr85 diphthamine biosynethesis 7 1 1
MIRT011061 Hadha hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit 1 1
MIRT011062 Stag1 stromal antigen 1 1 1
MIRT011063 Skil SKI-like 1 1
MIRT011064 Nos1 nitric oxide synthase 1, neuronal 1 1
MIRT011065 Psd3 pleckstrin and Sec7 domain containing 3 1 1
MIRT011066 Abl2 v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene) 1 1
MIRT011067 Wwtr1 WW domain containing transcription regulator 1 1 1
MIRT011068 Klhdc10 kelch domain containing 10 1 1
MIRT577616 Stx8 syntaxin 8 2 2
MIRT580733 Srrm4 serine/arginine repetitive matrix 4 2 2
MIRT591397 Cog7 component of oligomeric golgi complex 7 2 6
MIRT596081 Tfb2m transcription factor B2, mitochondrial 2 2
MIRT597622 Psmb11 proteasome (prosome, macropain) subunit, beta type, 11 2 2
MIRT598278 Mdp1 magnesium-dependent phosphatase 1 2 2
MIRT600595 Nfib nuclear factor I/B 2 2
MIRT601450 Tpmt thiopurine methyltransferase 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-324 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-324-3p Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-324-3p Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-324-3p Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 down-regulated
miR-324-3p FdUMP[10] NULL 25244711 Microarray NCI-60 cell-line 21159603 2011 up-regulated
miR-324-3p Floxuridine (FdU) approved 5790 Microarray NCI-60 cell-line 21159603 2011 up-regulated
miR-324-3p Irinotecan approved 60838 Microarray NCI-60 cell-line 21159603 2011 up-regulated
miR-324-3p Topotecan approved 60700 Microarray NCI-60 cell-line 21159603 2011 up-regulated
miR-324-3p Dexamethasone approved 5743 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-324-3p Mitoxantrone approved 4212 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-324-3p Paclitaxel approved 36314 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-324-3p Vinblastine approved 13342 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 down-regulated

Error report submission