miRTarBase - #MIRT011993


—
pre-miRNA Information
pre-miRNA mmu-let-7b   
Genomic Coordinates chr15: 85707319 - 85707403
Synonyms Mirnlet7b, mmu-let-7b, Mirlet7b
Description Mus musculus let-7b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-let-7b-5p
Sequence 7| UGAGGUAGUAGGUUGUGUGGUU |28
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol 4933411K20Rik
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
353 mmu-let-7b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001730 Mtpn myotrophin 3 1
MIRT001731 Rpia ribose 5-phosphate isomerase A 1 1
MIRT001732 Actg1 actin, gamma, cytoplasmic 1 1 1
MIRT003784 Bsg basigin 4 2
MIRT011986 Slc29a3 solute carrier family 29 (nucleoside transporters), member 3 1 1
MIRT011987 Maneal mannosidase, endo-alpha-like 1 1
MIRT011988 Pld3 phospholipase D family, member 3 1 1
MIRT011989 Ddx10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 1 1
MIRT011990 Scara3 scavenger receptor class A, member 3 1 1
MIRT011991 Epb4.1l5 erythrocyte membrane protein band 4.1 like 5 1 1
MIRT011992 Zfp109 zinc finger protein 109 1 1
MIRT011993 4933411K20Rik cilia and flagella associated protein 97 1 1
MIRT011994 Slc2a6 solute carrier family 2 (facilitated glucose transporter), member 6 1 1
MIRT011995 Homer1 homer scaffolding protein 1 1 1
MIRT011996 Zfp9 zinc finger protein 9 1 1
MIRT011997 Srcin1 SRC kinase signaling inhibitor 1 1 1
MIRT011998 Lfng LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT011999 4931428F04Rik RIKEN cDNA 4931428F04 gene 1 1
MIRT012000 E2f3 E2F transcription factor 3 1 1
MIRT012001 Tug1 taurine upregulated gene 1 1 1
MIRT012002 Lsamp limbic system-associated membrane protein 1 1
MIRT012003 Cald1 caldesmon 1 1 1
MIRT012004 Eif2ak3 eukaryotic translation initiation factor 2 alpha kinase 3 1 1
MIRT012005 Egln2 egl-9 family hypoxia-inducible factor 2 1 1
MIRT012006 Gtf3c2 general transcription factor IIIC, polypeptide 2, beta 1 1
MIRT012007 Tor1aip2 torsin A interacting protein 2 1 1
MIRT012008 Gad1 glutamate decarboxylase 1 1 1
MIRT012009 Kpna1 karyopherin (importin) alpha 1 1 1
MIRT012010 Prdm1 PR domain containing 1, with ZNF domain 1 1
MIRT012011 Ankrd52 ankyrin repeat domain 52 1 1
MIRT012012 Slc25a18 solute carrier family 25 (mitochondrial carrier), member 18 1 1
MIRT012013 Msi2 musashi RNA-binding protein 2 1 2
MIRT012014 Otud5 OTU domain containing 5 1 1
MIRT012015 Gns glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT012016 Kcnc2 potassium voltage gated channel, Shaw-related subfamily, member 2 1 1
MIRT012017 Slc2a3 solute carrier family 2 (facilitated glucose transporter), member 3 1 1
MIRT012018 Ssh1 slingshot homolog 1 (Drosophila) 1 1
MIRT012019 Nova1 neuro-oncological ventral antigen 1 1 1
MIRT012020 Scn8a sodium channel, voltage-gated, type VIII, alpha 1 1
MIRT012021 Gga3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT012022 Zfp462 zinc finger protein 462 1 1
MIRT012023 Col4a2 collagen, type IV, alpha 2 1 1
MIRT012024 Cpeb4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT012025 Sema4g sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G 1 1
MIRT012026 Stx17 syntaxin 17 1 1
MIRT012027 Dusp1 dual specificity phosphatase 1 1 1
MIRT012028 Slco5a1 solute carrier organic anion transporter family, member 5A1 1 1
MIRT012029 Fndc3a fibronectin type III domain containing 3A 1 1
MIRT012030 Trim6 tripartite motif-containing 6 1 1
MIRT012031 Igdcc3 immunoglobulin superfamily, DCC subclass, member 3 1 1
MIRT012032 Fras1 Fraser extracellular matrix complex subunit 1 1 1
MIRT012033 Msra methionine sulfoxide reductase A 1 1
MIRT012034 Slitrk5 SLIT and NTRK-like family, member 5 1 1
MIRT012035 Hoxb4 homeobox B4 1 1
MIRT012036 Slc35a4 solute carrier family 35, member A4 1 1
MIRT012037 2700081O15Rik RIKEN cDNA 2700081O15 gene 1 1
MIRT012038 Zeb2 zinc finger E-box binding homeobox 2 1 1
MIRT012039 Ylpm1 YLP motif containing 1 1 1
MIRT012040 Unc80 unc-80, NALCN activator 1 1
MIRT012041 Gabrb2 gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 1 1
MIRT012042 Pbrm1 polybromo 1 1 1
MIRT012043 Itsn2 intersectin 2 1 1
MIRT012044 Tbc1d24 TBC1 domain family, member 24 1 1
MIRT012045 Flywch1 FLYWCH-type zinc finger 1 1 1
MIRT012046 Smg1 SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans) 1 1
MIRT012047 Kifc2 kinesin family member C2 1 1
MIRT012048 Elp2 elongator acetyltransferase complex subunit 2 1 1
MIRT012049 Jph4 junctophilin 4 1 1
MIRT012050 Car2 carbonic anhydrase 2 1 1
MIRT012051 Tubb4a tubulin, beta 4A class IVA 1 1
MIRT012052 Eif4ebp2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT012053 Adra2a adrenergic receptor, alpha 2a 1 1
MIRT012054 Reep4 receptor accessory protein 4 1 1
MIRT012055 Cdr2l cerebellar degeneration-related protein 2-like 1 1
MIRT012056 Ikbkg inhibitor of kappaB kinase gamma 1 1
MIRT012057 Cnr1 cannabinoid receptor 1 (brain) 1 1
MIRT012058 Slc9a2 solute carrier family 9 (sodium/hydrogen exchanger), member 2 1 1
MIRT012059 Pigw phosphatidylinositol glycan anchor biosynthesis, class W 1 1
MIRT012060 Slc24a2 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 1 1
MIRT012061 Zfp12 zinc finger protein 12 1 1
MIRT012062 Rbm33 RNA binding motif protein 33 1 1
MIRT012063 Tbc1d14 TBC1 domain family, member 14 1 1
MIRT012064 Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 1 2
MIRT012065 Slc23a2 solute carrier family 23 (nucleobase transporters), member 2 1 1
MIRT012066 Ppm1e protein phosphatase 1E (PP2C domain containing) 1 1
MIRT012067 Slc15a2 solute carrier family 15 (H+/peptide transporter), member 2 1 1
MIRT012068 1700052N19Rik acidic residue methyltransferase 1 1 1
MIRT012069 Zfp664 zinc finger protein 664 1 1
MIRT012070 Patl1 protein associated with topoisomerase II homolog 1 (yeast) 1 1
MIRT012071 Itga4 integrin alpha 4 1 1
MIRT012072 Jam2 junction adhesion molecule 2 1 1
MIRT012073 Ppp3r1 protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type I) 1 1
MIRT012074 Ptpru protein tyrosine phosphatase, receptor type, U 1 1
MIRT012075 Acn9 succinate dehydrogenase complex assembly factor 3 1 1
MIRT012076 Mtmr4 myotubularin related protein 4 1 1
MIRT012077 Ephb3 Eph receptor B3 1 1
MIRT012078 Syn3 synapsin III 1 1
MIRT012079 Bahcc1 BAH domain and coiled-coil containing 1 1 1
MIRT012080 Sned1 sushi, nidogen and EGF-like domains 1 1 1
MIRT012081 Fgd4 FYVE, RhoGEF and PH domain containing 4 1 1
MIRT012082 Hdgfrp3 HDGF like 3 1 1
MIRT012083 Crk v-crk avian sarcoma virus CT10 oncogene homolog 1 1
MIRT012084 Chd9 chromodomain helicase DNA binding protein 9 1 1
MIRT012085 Lnp lunapark, ER junction formation factor 1 1
MIRT012086 Tmed5 transmembrane p24 trafficking protein 5 1 1
MIRT012087 Dip2b disco interacting protein 2 homolog B 1 1
MIRT012088 Smcr8 Smith-Magenis syndrome chromosome region, candidate 8 homolog (human) 1 1
MIRT012089 Cd164 CD164 antigen 1 1
MIRT012090 Slc4a7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1 1
MIRT012091 Zc3h11a zinc finger CCCH type containing 11A 1 1
MIRT012092 Srgap3 SLIT-ROBO Rho GTPase activating protein 3 1 1
MIRT012093 Fut9 fucosyltransferase 9 1 1
MIRT012094 Trib2 tribbles pseudokinase 2 1 1
MIRT012095 Apba1 amyloid beta (A4) precursor protein binding, family A, member 1 1 1
MIRT012096 Arl5a ADP-ribosylation factor-like 5A 1 1
MIRT012097 Ttc14 tetratricopeptide repeat domain 14 1 1
MIRT012098 Donson downstream neighbor of SON 1 1
MIRT012099 Slc8a2 solute carrier family 8 (sodium/calcium exchanger), member 2 1 1
MIRT012100 Fam118a family with sequence similarity 118, member A 1 1
MIRT012101 Ddn dendrin 1 1
MIRT012102 Usp32 ubiquitin specific peptidase 32 1 1
MIRT012103 Flna filamin, alpha 1 1
MIRT012104 Pik3ip1 phosphoinositide-3-kinase interacting protein 1 1 1
MIRT012105 Pgrmc1 progesterone receptor membrane component 1 1 1
MIRT012106 Acvr1b activin A receptor, type 1B 1 1
MIRT012107 Fnip2 folliculin interacting protein 2 1 1
MIRT012108 Arpp19 cAMP-regulated phosphoprotein 19 1 1
MIRT012109 1600012H06Rik RIKEN cDNA 1600012H06 gene 1 1
MIRT012110 Adipor2 adiponectin receptor 2 1 1
MIRT012111 Chd7 chromodomain helicase DNA binding protein 7 1 1
MIRT012112 Lcor ligand dependent nuclear receptor corepressor 1 1
MIRT012113 Gabra6 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 6 1 1
MIRT012114 Dnajc1 DnaJ heat shock protein family (Hsp40) member C1 1 1
MIRT012115 Epha4 Eph receptor A4 1 1
MIRT012116 Snx30 sorting nexin family member 30 1 1
MIRT012117 Ptprd protein tyrosine phosphatase, receptor type, D 1 1
MIRT012118 Kctd21 potassium channel tetramerisation domain containing 21 1 1
MIRT012119 Xkr8 X-linked Kx blood group related 8 1 1
MIRT012120 Ppargc1b peroxisome proliferative activated receptor, gamma, coactivator 1 beta 1 1
MIRT012121 Ercc6 excision repair cross-complementing rodent repair deficiency, complementation group 6 1 1
MIRT012122 Greb1l growth regulation by estrogen in breast cancer-like 1 1
MIRT012123 Igdcc4 immunoglobulin superfamily, DCC subclass, member 4 1 1
MIRT012124 Frmd5 FERM domain containing 5 1 1
MIRT012125 1700017B05Rik RIKEN cDNA 1700017B05 gene 1 1
MIRT012126 Sowaha sosondowah ankyrin repeat domain family member A 1 1
MIRT012127 Zfp583 zinc finger protein 583 1 1
MIRT012128 4931406C07Rik RIKEN cDNA 4931406C07 gene 1 1
MIRT012129 Zfp174 zinc finger protein 174 1 1
MIRT012130 Wnk1 WNK lysine deficient protein kinase 1 1 1
MIRT012131 Kctd7 potassium channel tetramerisation domain containing 7 1 1
MIRT012132 Nf2 neurofibromin 2 1 3
MIRT012133 2700089E24Rik small integral membrane protein 10 like 1 1 1
MIRT012134 Celf5 CUGBP, Elav-like family member 5 1 1
MIRT012135 Rffl ring finger and FYVE like domain containing protein 1 1
MIRT012136 Limd1 LIM domains containing 1 1 1
MIRT012137 Akt1 thymoma viral proto-oncogene 1 1 1
MIRT012138 Atp6v1b2 ATPase, H+ transporting, lysosomal V1 subunit B2 1 1
MIRT012139 Ptgds prostaglandin D2 synthase (brain) 1 1
MIRT012140 Ncor1 nuclear receptor co-repressor 1 1 1
MIRT012141 Kif1a kinesin family member 1A 1 1
MIRT012142 Sacm1l SAC1 suppressor of actin mutations 1-like (yeast) 1 1
MIRT012143 Mast2 microtubule associated serine/threonine kinase 2 1 1
MIRT012144 Arrdc3 arrestin domain containing 3 1 1
MIRT012145 Trps1 transcriptional repressor GATA binding 1 1 1
MIRT012146 Prickle1 prickle planar cell polarity protein 1 1 1
MIRT012147 Nup35 nucleoporin 35 1 1
MIRT012148 Chd3 chromodomain helicase DNA binding protein 3 1 1
MIRT012149 Wdtc1 WD and tetratricopeptide repeats 1 1 1
MIRT012150 Fmn2 formin 2 1 1
MIRT012151 Sptbn2 spectrin beta, non-erythrocytic 2 1 1
MIRT012152 Rock2 Rho-associated coiled-coil containing protein kinase 2 1 1
MIRT012153 Usp45 ubiquitin specific petidase 45 1 1
MIRT012154 Braf Braf transforming gene 1 1
MIRT012155 Dnhd1 dynein heavy chain domain 1 1 1
MIRT012156 Arpp21 cyclic AMP-regulated phosphoprotein, 21 1 1
MIRT012157 Ccnd1 cyclin D1 1 1
MIRT012158 Slc4a8 solute carrier family 4 (anion exchanger), member 8 1 1
MIRT012159 Stim1 stromal interaction molecule 1 1 1
MIRT012160 Cat catalase 1 1
MIRT012161 Synj1 synaptojanin 1 1 1
MIRT012162 Cadm2 cell adhesion molecule 2 1 1
MIRT012163 Knop1 lysine rich nucleolar protein 1 1 1
MIRT012164 Tram1l1 translocation associated membrane protein 1-like 1 1 1
MIRT012165 Gpr137 G protein-coupled receptor 137 1 1
MIRT012166 Nfxl1 nuclear transcription factor, X-box binding-like 1 1 1
MIRT012167 Csrnp2 cysteine-serine-rich nuclear protein 2 1 1
MIRT012168 Nid1 nidogen 1 1 1
MIRT012169 Gnal guanine nucleotide binding protein, alpha stimulating, olfactory type 1 1
MIRT012170 Slc22a6 solute carrier family 22 (organic anion transporter), member 6 1 1
MIRT012171 Epb4.1l1 erythrocyte membrane protein band 4.1 like 1 1 1
MIRT012172 Ctsb cathepsin B 1 1
MIRT012173 Zfp740 zinc finger protein 740 1 1
MIRT012174 Kcnc1 potassium voltage gated channel, Shaw-related subfamily, member 1 1 1
MIRT012175 Rdh10 retinol dehydrogenase 10 (all-trans) 1 1
MIRT012176 Ubxn4 UBX domain protein 4 1 1
MIRT012177 Rnf213 ring finger protein 213 1 1
MIRT012178 Ppme1 protein phosphatase methylesterase 1 1 1
MIRT012179 Nrp2 neuropilin 2 1 1
MIRT012180 Mnt max binding protein 1 1
MIRT012181 Gramd1b GRAM domain containing 1B 1 1
MIRT012182 Cacna1e calcium channel, voltage-dependent, R type, alpha 1E subunit 1 1
MIRT012183 Mex3a mex3 RNA binding family member A 1 1
MIRT012184 Piga phosphatidylinositol glycan anchor biosynthesis, class A 1 1
MIRT012185 AI464131 expressed sequence AI464131 1 1
MIRT012186 Tenm2 teneurin transmembrane protein 2 1 1
MIRT012187 Nlk nemo like kinase 1 1
MIRT012188 Cep120 centrosomal protein 120 1 1
MIRT012189 Vsnl1 visinin-like 1 1 1
MIRT012190 Kctd12b potassium channel tetramerisation domain containing 12b 1 1
MIRT012191 Igf1r insulin-like growth factor I receptor 1 1
MIRT012192 Grik2 glutamate receptor, ionotropic, kainate 2 (beta 2) 1 1
MIRT012193 Abcg1 ATP-binding cassette, sub-family G (WHITE), member 1 1 1
MIRT012194 Zfp318 zinc finger protein 318 1 1
MIRT012195 Eea1 early endosome antigen 1 1 1
MIRT012196 Rnf167 ring finger protein 167 1 1
MIRT012197 Ccdc127 coiled-coil domain containing 127 1 1
MIRT012198 Zfp248 zinc finger protein 248 1 1
MIRT012199 Dmd dystrophin, muscular dystrophy 1 1
MIRT012200 Srek1 splicing regulatory glutamine/lysine-rich protein 1 1 1
MIRT012201 Agap1 ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 1 1
MIRT012202 Sec14l1 SEC14-like lipid binding 1 1 1
MIRT012203 Cbx5 chromobox 5 1 1
MIRT012204 Serf2 small EDRK-rich factor 2 1 1
MIRT012205 Pxdn peroxidasin 1 1
MIRT012206 Arid3b AT rich interactive domain 3B (BRIGHT-like) 1 1
MIRT012207 Ago3 argonaute RISC catalytic subunit 3 1 1
MIRT012208 Khsrp KH-type splicing regulatory protein 1 1
MIRT012209 Slc22a23 solute carrier family 22, member 23 1 1
MIRT012210 Atp2a2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT012211 Tmem194 nuclear envelope integral membrane protein 1 1 1
MIRT012212 Mtf2 metal response element binding transcription factor 2 1 1
MIRT012213 Rdx radixin 1 1
MIRT012214 Abcc5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 1
MIRT012215 Zswim5 zinc finger SWIM-type containing 5 1 1
MIRT012216 Cldn12 claudin 12 1 1
MIRT012217 Fnip1 folliculin interacting protein 1 1 1
MIRT012218 Nras neuroblastoma ras oncogene 1 1
MIRT012219 Tgfbr1 transforming growth factor, beta receptor I 1 1
MIRT012220 Tgfbr3 transforming growth factor, beta receptor III 1 1
MIRT012221 Bach1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT012222 Apbb3 amyloid beta (A4) precursor protein-binding, family B, member 3 1 1
MIRT012223 Nr2e1 nuclear receptor subfamily 2, group E, member 1 3 1
MIRT012224 Prrc2c proline-rich coiled-coil 2C 1 1
MIRT012225 Slc6a8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 1 1
MIRT012226 Pigs phosphatidylinositol glycan anchor biosynthesis, class S 1 1
MIRT012227 Arhgap1 Rho GTPase activating protein 1 1 1
MIRT012228 Gba2 glucosidase beta 2 1 1
MIRT012229 Bmpr1a bone morphogenetic protein receptor, type 1A 1 1
MIRT012230 Gria3 glutamate receptor, ionotropic, AMPA3 (alpha 3) 1 1
MIRT012231 Capns1 calpain, small subunit 1 1 1
MIRT012232 Syt5 synaptotagmin V 1 1
MIRT012233 Gria2 glutamate receptor, ionotropic, AMPA2 (alpha 2) 1 1
MIRT012234 Cnih4 cornichon family AMPA receptor auxiliary protein 4 1 1
MIRT012235 Ubap2 ubiquitin-associated protein 2 1 1
MIRT012236 Zkscan2 zinc finger with KRAB and SCAN domains 2 1 1
MIRT012237 Stat2 signal transducer and activator of transcription 2 1 1
MIRT012238 Dbc1 bone morphogenic protein/retinoic acid inducible neural specific 1 1 1
MIRT012239 Usp22 ubiquitin specific peptidase 22 1 1
MIRT012240 Cnih cornichon family AMPA receptor auxiliary protein 1 1 1
MIRT012241 Fam175b BRISC complex subunit 1 1
MIRT012242 Dnm3 dynamin 3 1 1
MIRT012243 Dync1i2 dynein cytoplasmic 1 intermediate chain 2 1 1
MIRT012244 Cntn2 contactin 2 1 1
MIRT012245 Nol8 nucleolar protein 8 1 1
MIRT012246 Zscan22 zinc finger and SCAN domain containing 22 1 1
MIRT012247 Psme4 proteasome (prosome, macropain) activator subunit 4 1 1
MIRT012248 Kcnj10 potassium inwardly-rectifying channel, subfamily J, member 10 1 1
MIRT012249 Stk35 serine/threonine kinase 35 1 1
MIRT012250 Pdgfrb platelet derived growth factor receptor, beta polypeptide 1 1
MIRT012251 Tub tubby bipartite transcription factor 1 1
MIRT012252 Esam endothelial cell-specific adhesion molecule 1 1
MIRT012253 Gpr63 G protein-coupled receptor 63 1 1
MIRT012254 Naa40 N(alpha)-acetyltransferase 40, NatD catalytic subunit 1 1
MIRT012255 Kcna1 potassium voltage-gated channel, shaker-related subfamily, member 1 1 1
MIRT012256 Dusp6 dual specificity phosphatase 6 1 1
MIRT012257 Dnajc27 DnaJ heat shock protein family (Hsp40) member C27 1 1
MIRT012258 Slc25a23 solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 1 1
MIRT012259 Tspan2 tetraspanin 2 1 1
MIRT012260 Zdhhc24 zinc finger, DHHC domain containing 24 1 1
MIRT012261 Sh2b3 SH2B adaptor protein 3 1 1
MIRT012262 Slitrk4 SLIT and NTRK-like family, member 4 1 1
MIRT012263 Mtf1 metal response element binding transcription factor 1 1 1
MIRT012264 Srrm4 serine/arginine repetitive matrix 4 1 1
MIRT012265 Crem cAMP responsive element modulator 1 1
MIRT012266 Klf8 Kruppel-like factor 8 1 1
MIRT012267 Syncrip synaptotagmin binding, cytoplasmic RNA interacting protein 1 1
MIRT012268 Tgs1 trimethylguanosine synthase 1 1 1
MIRT012269 Stat3 signal transducer and activator of transcription 3 1 1
MIRT012270 Arc activity regulated cytoskeletal-associated protein 1 1
MIRT012271 Hr hairless 1 1
MIRT012272 Pnkd paroxysmal nonkinesiogenic dyskinesia 1 1
MIRT012273 Zfp641 zinc finger protein 641 1 1
MIRT012274 Slc25a4 solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 4 1 1
MIRT012275 D630045J12Rik RIKEN cDNA D630045J12 gene 1 1
MIRT012276 Fam171a1 family with sequence similarity 171, member A1 1 1
MIRT012277 Vav3 vav 3 oncogene 1 1
MIRT012278 Tmem214 transmembrane protein 214 1 1
MIRT012279 Eif4g2 eukaryotic translation initiation factor 4, gamma 2 1 1
MIRT012280 Rab11fip4 RAB11 family interacting protein 4 (class II) 1 1
MIRT012281 Zfp280b zinc finger protein 280B 1 1
MIRT012282 Csnk2a1 casein kinase 2, alpha 1 polypeptide 1 1
MIRT012283 Kif21b kinesin family member 21B 1 1
MIRT012284 Gpcpd1 glycerophosphocholine phosphodiesterase 1 1 1
MIRT012285 Snx5 sorting nexin 5 1 1
MIRT012286 Thrsp thyroid hormone responsive 1 1
MIRT012287 Usp47 ubiquitin specific peptidase 47 1 1
MIRT012288 Ndst3 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3 1 1
MIRT012289 Dlc1 deleted in liver cancer 1 1 1
MIRT012290 Syt11 synaptotagmin XI 1 1
MIRT012291 Btbd3 BTB (POZ) domain containing 3 1 1
MIRT012292 Farp1 FERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived) 1 1
MIRT012293 Slc20a1 solute carrier family 20, member 1 1 1
MIRT012294 Zfp354b zinc finger protein 354B 1 1
MIRT012295 Psd3 pleckstrin and Sec7 domain containing 3 1 1
MIRT012296 Sfmbt1 Scm-like with four mbt domains 1 1 1
MIRT012297 Rnf44 ring finger protein 44 1 1
MIRT012298 March9 membrane-associated ring finger (C3HC4) 9 1 1
MIRT012299 Thbs1 thrombospondin 1 1 1
MIRT012300 Pcgf3 polycomb group ring finger 3 1 1
MIRT012301 Fam135a family with sequence similarity 135, member A 1 1
MIRT012302 Bcl7c B cell CLL/lymphoma 7C 1 1
MIRT012303 Mycbp MYC binding protein 1 1
MIRT012304 Gxylt1 glucoside xylosyltransferase 1 1 1
MIRT012305 Lpgat1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT012306 Zfp644 zinc finger protein 644 1 1
MIRT012307 Rnf5 ring finger protein 5 1 1
MIRT012308 Hdx highly divergent homeobox 1 1
MIRT012309 Cpeb2 cytoplasmic polyadenylation element binding protein 2 1 1
MIRT012310 Pqlc2 PQ loop repeat containing 2 1 1
MIRT012311 Sema4f sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain 1 1
MIRT012312 Hic2 hypermethylated in cancer 2 1 1
MIRT012313 Adamts15 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15 1 1
MIRT012314 Tmem2 transmembrane protein 2 1 1
MIRT012315 Stx3 syntaxin 3 1 1
MIRT012316 Nr6a1 nuclear receptor subfamily 6, group A, member 1 1 1
MIRT012317 Lrig2 leucine-rich repeats and immunoglobulin-like domains 2 1 1
MIRT012318 Skil SKI-like 1 1
MIRT012319 Map4k3 mitogen-activated protein kinase kinase kinase kinase 3 1 1
MIRT053616 ACVR1B activin A receptor type 1B 3 1
MIRT578704 Gnl3l guanine nucleotide binding protein-like 3 (nucleolar)-like 1 2
MIRT579035 Cts8 cathepsin 8 1 2
MIRT579374 Apc2 adenomatosis polyposis coli 2 1 3
MIRT583582 Fbxl14 F-box and leucine-rich repeat protein 14 1 1
MIRT586723 Lins lines homolog 1 1 1
MIRT592560 Mup17 major urinary protein 17 1 1
MIRT592597 Mup11 major urinary protein 11 1 1
MIRT592943 Armc2 armadillo repeat containing 2 1 2
MIRT594647 Meis2 Meis homeobox 2 1 1
MIRT596621 Zfp444 zinc finger protein 444 1 1
MIRT597965 Nup214 nucleoporin 214 1 1
MIRT601462 Tnfrsf26 tumor necrosis factor receptor superfamily, member 26 1 1
MIRT605691 Ifnar1 interferon (alpha and beta) receptor 1 1 1
MIRT756429 Hmga2 high mobility group AT-hook 2 4 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
let-7b Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 down-regulated
let-7b Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
let-7b Enoxacin approved 3229 Quantitative real-time PCR HEK293 cells 18641635 2008 up-regulated
let-7b 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
let-7b Etoposide approved 36462 Microarray Normal human fibroblasts (AG01522) 19633716 2009 down-regulated
let-7b Etoposide approved 36462 Quantitative real-time PCR Normal human fibroblasts (AG01522) 19633716 2009 down-regulated
let-7b Activin A NULL 229455 Quantitative real-time PCR Human embryonic stem (hES) cells 19885849 2010 down-regulated
let-7b Oxaliplatin (L-OHP) approved 5310940 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
let-7b Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
let-7b Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
let-7b Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
let-7b Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
let-7b CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer cells 22108826 2012 up-regulated
let-7b Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
let-7b N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 up-regulated
let-7b Lithium (Li) approved 3028194 Microarray rat hippocampus 18704095 2009 down-regulated
let-7b Lithium (Li) approved 3028194 Quantitative real-time PCR rat hippocampus 18704095 2009 down-regulated
let-7b Valproate approved 3121 Microarray rat hippocampus 18704095 2009 down-regulated
let-7b Valproate approved 3121 Quantitative real-time PCR rat hippocampus 18704095 2009 down-regulated
let-7b Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
let-7b 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
let-7b Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated

Error report submission