pre-miRNA Information
pre-miRNA mmu-mir-297a-1   
Genomic Coordinates chr7: 10958437 - 10958512
Description Mus musculus miR-297a-1 stem-loop
Comment Houbaviy et al. report that the cloned sequence of miR-297 is found over 20 times in the mouse genomic sequence . The ends of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
pre-miRNA mmu-mir-297a-2   
Genomic Coordinates chr2: 10472254 - 10472343
Description Mus musculus miR-297a-2 stem-loop
Comment Houbaviy et al. report that the cloned sequence of miR-297 is found over 20 times in the mouse genomic sequence . This sequence appears to match several low complexity repetitive regions. Confidence in which loci actually express miR-297 is low because of the low complexity nature of the sequence.
RNA Secondary Structure
pre-miRNA mmu-mir-297a-3   
Genomic Coordinates chr2: 10515820 - 10515921
Description Mus musculus miR-297a-3 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA mmu-mir-297a-4   
Genomic Coordinates chr2: 10517067 - 10517164
Description Mus musculus miR-297a-4 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-297a-5p
Sequence 11| AUGUAUGUGUGCAUGUGCAUGU |32
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Ptprr   
Synonyms Gmcp1, PTP-SL, PTPBR7, RPTPRR, mPTP213
Description protein tyrosine phosphatase, receptor type, R
Transcript NM_001161838   
Other Transcripts NM_001161839 , NM_001161840 , NM_011217   
Expression
Putative miRNA Targets on Ptprr
3'UTR of Ptprr
(miRNA target sites are highlighted)
>Ptprr|NM_001161838|3'UTR
   1 CTCCGAAGATTTACCAGAGTGTCAATCTCTCACCGGGTGATTCATCAAATTACCTACCAAGAGCTCCAAGAGGGGCTCCC
  81 TGCAATGGACGAGGAGGCTCTAAAGCCAGCCTAAGGCACTGATTGTGGAAGATCTGGCAACATGAAAGATTGCCAGCCTT
 161 TGTGTATAGGACTGCGTTCGTAGGCATCCCCCCAGTTATTCTGAAGGTCCTGTGCTGATGGAGGCATGACAGTCCTCTCG
 241 CAGCCTGAGGAGGGTTTTGTTCTGTCTGTGTCGCCTCTCCGCCGCACAGAATCGATGTGTGTGATATTCAGAGACTGGAG
 321 GAGCTGCTGACATTATCCTGTGTTTAGATGCTTTAATGTTCATAAAGCCTGTCTTGTGACTGGACTGTCAGCTGTCCAAC
 401 TGTCCCTGTTGTAAGTGCTATTAACTATCTCAGTTACCAGAATCTTGCTGCTCAAGTTTCGAGTGATCGACAATGGATTT
 481 TTAACCAAGACATTTTTGTTTTTGGAAAAAAAAAAAAAATCAAATGCAGTGACTATTTTATATGGACATGTGTCTTGATT
 561 ATATCTATTAAGTGTGCATTTATAGTATCTCCTATGGATCAATTACAGAGCACAATGACTGTCGTTGGATATATATGTAT
 641 ATGTATATGTATATTATATGTATATGTACACATATATATTCTATTATTAGGCATACAAGTGGCTCCTGTTCCACAATACT
 721 AACTACTATATTTCTACATTGTGACTTGTTTTACTTTAAAAGGGGATAAACAAATTTATAGCAACTATAAAGTATCAATA
 801 ATTTTAAATACTCATCTCTCTTTTACTAAGAAGGGATTTTTAAATATGGTGTCTACCTGGTATCTCTCTCCCAATAAGAA
 881 GCAGGTGCCTTTGGGGAATGCTCCAACCTGTTTCATCCCCAAAAGTTTTTCCGAGGACACTGTCATGCACGACCTCACAT
 961 TTCTAAAAGACCTCCTTCCTCAAGAGACAAATGAAGGCAAAATAATCACACTCAGCAAACAGGAGATGTTCTGCTCAGAT
1041 ATGAATTTTCAATGCAGCAAAGCTGACTTTCTTTCGTACTCCCAATAAATGACTCTTAACAGT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ugUACGUGUACGUGUGUAUGUa 5'
            |||:|:|||:|||||||:| 
Target 5' atATGTATATGTACACATATAt 3'
656 - 677 172.00 -25.90
2
miRNA  3' ugUACGUGUACGUGUGUAUGUa 5'
            |||:|:|||:|:|::||:| 
Target 5' atATGTATATGTATATGTATAt 3'
633 - 654 136.00 -19.10
3
miRNA  3' ugUACGUGUACG-------UGUGUAUGUA- 5'
            || :|:|| |       | :||||||  
Target 5' acATATATATTCTATTATTAGGCATACAAG 3'
670 - 699 124.00 -8.80
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
357 mmu-miR-297a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT012924 Akap9 A kinase (PRKA) anchor protein (yotiao) 9 1 1
MIRT012925 Syngr3 synaptogyrin 3 1 1
MIRT012926 Tspan9 tetraspanin 9 1 1
MIRT012927 Slk STE20-like kinase 1 1
MIRT012928 Scd1 stearoyl-Coenzyme A desaturase 1 1 1
MIRT012929 Fam110b family with sequence similarity 110, member B 1 1
MIRT012930 Ptprr protein tyrosine phosphatase, receptor type, R 1 1
MIRT012931 Fam101b refilin B 1 1
MIRT012932 Zc3h12b zinc finger CCCH-type containing 12B 1 1
MIRT012933 Dusp22 dual specificity phosphatase 22 1 1
MIRT012934 Klhdc8a kelch domain containing 8A 1 1
MIRT012935 Cdh7 cadherin 7, type 2 1 1
MIRT012936 Cab39 calcium binding protein 39 1 1
MIRT012937 Mfsd4 major facilitator superfamily domain containing 4A 1 1
MIRT012938 Nr2f2 nuclear receptor subfamily 2, group F, member 2 1 1
MIRT012939 Fras1 Fraser extracellular matrix complex subunit 1 1 1
MIRT012940 Sulf2 sulfatase 2 1 1
MIRT012941 Elk3 ELK3, member of ETS oncogene family 1 1
MIRT012942 Celf1 CUGBP, Elav-like family member 1 1 1
MIRT012943 Slc39a9 solute carrier family 39 (zinc transporter), member 9 1 1
MIRT012944 Arrb1 arrestin, beta 1 1 1
MIRT012945 Spire1 spire homolog 1 (Drosophila) 1 1
MIRT012946 Oxtr oxytocin receptor 1 1
MIRT012947 Leprotl1 leptin receptor overlapping transcript-like 1 1 1
MIRT012948 Mical3 microtubule associated monooxygenase, calponin and LIM domain containing 3 1 1
MIRT012949 Tgfa transforming growth factor alpha 1 1
MIRT012950 Paqr8 progestin and adipoQ receptor family member VIII 1 1
MIRT012951 Pak2 p21 protein (Cdc42/Rac)-activated kinase 2 1 1
MIRT012952 Kif1b kinesin family member 1B 1 1
MIRT012953 Zfp160 zinc finger protein 160 1 1
MIRT012954 Rsf1 remodeling and spacing factor 1 1 1
MIRT012955 Pura purine rich element binding protein A 1 1
MIRT012956 Iars isoleucine-tRNA synthetase 1 1
MIRT012957 Rad21 RAD21 cohesin complex component 1 1
MIRT012958 Kctd21 potassium channel tetramerisation domain containing 21 1 1
MIRT012959 Zbtb34 zinc finger and BTB domain containing 34 1 1
MIRT012960 Cav2 caveolin 2 1 1
MIRT012961 Uck2 uridine-cytidine kinase 2 1 1
MIRT012962 Nudt19 nudix (nucleoside diphosphate linked moiety X)-type motif 19 1 1
MIRT012963 Vps39 VPS39 HOPS complex subunit 1 1
MIRT012964 Lss lanosterol synthase 1 1
MIRT012965 Smek2 protein phosphatase 4 regulatory subunit 3B 1 1
MIRT012966 Ing3 inhibitor of growth family, member 3 1 1
MIRT012967 Rnf103 ring finger protein 103 1 1
MIRT012968 Serpini1 serine (or cysteine) peptidase inhibitor, clade I, member 1 1 1
MIRT012969 Vezt vezatin, adherens junctions transmembrane protein 1 1
MIRT012970 Wsb1 WD repeat and SOCS box-containing 1 1 1
MIRT012971 Ncoa2 nuclear receptor coactivator 2 1 1
MIRT012972 Scn8a sodium channel, voltage-gated, type VIII, alpha 1 1
MIRT012973 Pde10a phosphodiesterase 10A 1 1
MIRT012974 Vldlr very low density lipoprotein receptor 1 1
MIRT012975 Ccnt2 cyclin T2 1 1
MIRT012976 Cpeb4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT012977 Cplx2 complexin 2 1 1
MIRT012978 Kcnj3 potassium inwardly-rectifying channel, subfamily J, member 3 1 1
MIRT012979 Eea1 early endosome antigen 1 1 1
MIRT012980 Tmem19 transmembrane protein 19 1 1
MIRT012981 Rabep1 rabaptin, RAB GTPase binding effector protein 1 1 1
MIRT012982 Slc1a4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 1 1
MIRT012983 Fermt2 fermitin family member 2 1 1
MIRT012984 Kcnc1 potassium voltage gated channel, Shaw-related subfamily, member 1 1 1
MIRT012985 Rdx radixin 1 1
MIRT012986 Nup35 nucleoporin 35 1 1
MIRT012987 Qk quaking 1 1
MIRT012988 Foxj1 forkhead box J1 1 1
MIRT012989 B4galt6 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 1 1
MIRT012990 Vamp4 vesicle-associated membrane protein 4 1 1
MIRT012991 Csnk1a1 casein kinase 1, alpha 1 1 1
MIRT012992 Foxo3 forkhead box O3 1 1
MIRT012993 Zfp748 zinc finger protein 748 1 1
MIRT012994 Zfp521 zinc finger protein 521 1 1
MIRT012995 Grm5 glutamate receptor, metabotropic 5 1 1
MIRT012996 Xpot exportin, tRNA (nuclear export receptor for tRNAs) 1 1
MIRT012997 Ncan neurocan 1 1
MIRT012998 Ttyh1 tweety family member 1 1 1
MIRT012999 Sharpin SHANK-associated RH domain interacting protein 1 1
MIRT013000 Zfp108 zinc finger protein 108 1 1
MIRT013001 Spag9 sperm associated antigen 9 1 1
MIRT013002 S100b S100 protein, beta polypeptide, neural 1 1
MIRT013003 Cyb561d2 cytochrome b-561 domain containing 2 1 1
MIRT013004 Wdr13 WD repeat domain 13 1 1
MIRT013005 Haus2 HAUS augmin-like complex, subunit 2 1 1
MIRT013006 Arf2 ADP-ribosylation factor 2 1 1
MIRT013007 Ctgf connective tissue growth factor 1 1
MIRT013008 Zfp260 zinc finger protein 260 1 1
MIRT013009 Nipa2 non imprinted in Prader-Willi/Angelman syndrome 2 homolog (human) 1 1
MIRT013010 Gmeb1 glucocorticoid modulatory element binding protein 1 1 1
MIRT013011 1600012H06Rik RIKEN cDNA 1600012H06 gene 1 1
MIRT013012 Trp53bp1 transformation related protein 53 binding protein 1 1 1
MIRT013013 Shank2 SH3/ankyrin domain gene 2 1 1
MIRT013014 Slc4a10 solute carrier family 4, sodium bicarbonate cotransporter-like, member 10 1 1
MIRT013015 Dnajb4 DnaJ heat shock protein family (Hsp40) member B4 1 1
MIRT013016 Bmp2k BMP2 inducible kinase 1 1
MIRT013017 Ccdc127 coiled-coil domain containing 127 1 2
MIRT013018 Adam12 a disintegrin and metallopeptidase domain 12 (meltrin alpha) 1 1
MIRT013019 Ago1 argonaute RISC catalytic subunit 1 1 1
MIRT013020 Ank3 ankyrin 3, epithelial 1 1
MIRT013021 Klhl24 kelch-like 24 1 1
MIRT013022 Zfp697 zinc finger protein 697 1 1
MIRT013023 Fmn1 formin 1 1 1
MIRT013024 Srgap3 SLIT-ROBO Rho GTPase activating protein 3 1 1
MIRT013025 Idnk idnK gluconokinase homolog (E. coli) 1 1
MIRT013026 Chp1 calcineurin-like EF hand protein 1 1 1
MIRT013027 Tmem87b transmembrane protein 87B 1 1
MIRT013028 Tgoln1 trans-golgi network protein 1 1
MIRT013029 2700081O15Rik RIKEN cDNA 2700081O15 gene 1 1
MIRT013030 Epb4.1l1 erythrocyte membrane protein band 4.1 like 1 1 1
MIRT013031 Nxt2 nuclear transport factor 2-like export factor 2 1 1
MIRT013032 Mxi1 MAX interactor 1, dimerization protein 1 1
MIRT013033 Ski ski sarcoma viral oncogene homolog (avian) 1 2
MIRT013034 Dlg3 discs, large homolog 3 (Drosophila) 1 1
MIRT013035 Nptx1 neuronal pentraxin 1 1 1
MIRT013036 Larp4b La ribonucleoprotein domain family, member 4B 1 1
MIRT013037 Celf2 CUGBP, Elav-like family member 2 1 1
MIRT013038 Pbrm1 polybromo 1 1 1
MIRT013039 Ssr3 signal sequence receptor, gamma 1 1
MIRT013040 Xiap X-linked inhibitor of apoptosis 1 2
MIRT013041 Elovl2 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 1 1
MIRT013042 Tardbp TAR DNA binding protein 1 1
MIRT013043 Azin1 antizyme inhibitor 1 1 1
MIRT013044 Lingo3 leucine rich repeat and Ig domain containing 3 1 1
MIRT013045 Kcnab1 potassium voltage-gated channel, shaker-related subfamily, beta member 1 1 1
MIRT013046 Synj1 synaptojanin 1 1 1
MIRT013047 Zmat3 zinc finger matrin type 3 1 1
MIRT013048 Skiv2l2 superkiller viralicidic activity 2-like 2 (S. cerevisiae) 1 1
MIRT013049 Robo2 roundabout guidance receptor 2 1 1
MIRT013050 Pde5a phosphodiesterase 5A, cGMP-specific 1 1
MIRT013051 Pdcl phosducin-like 1 1
MIRT013052 Cav1 caveolin 1, caveolae protein 1 1
MIRT013053 Zhx1 zinc fingers and homeoboxes 1 1 1
MIRT013054 Ugt8a UDP galactosyltransferase 8A 1 1
MIRT013055 Lims1 LIM and senescent cell antigen-like domains 1 1 1
MIRT013056 Pja1 praja ring finger ubiquitin ligase 1 1 1
MIRT013057 Slc31a1 solute carrier family 31, member 1 1 1
MIRT013058 Sos1 son of sevenless homolog 1 (Drosophila) 1 1
MIRT013059 Neto2 neuropilin (NRP) and tolloid (TLL)-like 2 1 1
MIRT013060 Pde6d phosphodiesterase 6D, cGMP-specific, rod, delta 1 1
MIRT013061 Snap25 synaptosomal-associated protein 25 1 3
MIRT013062 Fzd1 frizzled class receptor 1 1 1
MIRT013063 Prex2 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 1 1
MIRT013064 Camta2 calmodulin binding transcription activator 2 1 1
MIRT013065 Chd7 chromodomain helicase DNA binding protein 7 1 1
MIRT013066 Ankrd28 ankyrin repeat domain 28 1 1
MIRT013067 Ostm1 osteopetrosis associated transmembrane protein 1 1 1
MIRT013068 Slc6a7 solute carrier family 6 (neurotransmitter transporter, L-proline), member 7 1 1
MIRT013069 Dio2 deiodinase, iodothyronine, type II 1 1
MIRT013070 Slc24a2 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 1 2
MIRT013071 Aff4 AF4/FMR2 family, member 4 1 1
MIRT013072 Fut9 fucosyltransferase 9 1 1
MIRT013073 Ccnc cyclin C 1 1
MIRT013074 Cdh11 cadherin 11 1 1
MIRT013075 Tceb3 elongin A 1 1
MIRT013076 Fmn2 formin 2 1 1
MIRT013077 D4Wsu53e arginine/serine rich protein 1 1 1
MIRT013078 Rasgrp1 RAS guanyl releasing protein 1 1 1
MIRT013079 Gltp glycolipid transfer protein 1 1
MIRT013080 Stk3 serine/threonine kinase 3 1 1
MIRT013081 Ulk1 unc-51 like kinase 1 1 1
MIRT013082 Gpr158 G protein-coupled receptor 158 1 1
MIRT013083 Pik3r1 phosphoinositide-3-kinase regulatory subunit 1 1 1
MIRT013084 Clk1 CDC-like kinase 1 1 1
MIRT013085 Pik3r3 phosphoinositide-3-kinase regulatory subunit 3 1 1
MIRT013086 Brwd1 bromodomain and WD repeat domain containing 1 1 1
MIRT013087 Tmem255a transmembrane protein 255A 1 1
MIRT013088 Plaa phospholipase A2, activating protein 1 1
MIRT013089 Rxfp1 relaxin/insulin-like family peptide receptor 1 1 1
MIRT013090 Mettl5 methyltransferase like 5 1 1
MIRT013091 Add1 adducin 1 (alpha) 1 1
MIRT013092 Kcnk10 potassium channel, subfamily K, member 10 1 1
MIRT013093 Agfg1 ArfGAP with FG repeats 1 1 1
MIRT013094 Tbc1d19 TBC1 domain family, member 19 1 1
MIRT013095 Scd2 stearoyl-Coenzyme A desaturase 2 1 1
MIRT013096 Tnks tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 1 1
MIRT013097 Ccdc47 coiled-coil domain containing 47 1 1
MIRT013098 Tgs1 trimethylguanosine synthase 1 1 1
MIRT013099 Taok1 TAO kinase 1 1 1
MIRT013100 Lmnb1 lamin B1 1 1
MIRT013101 Ssbp2 single-stranded DNA binding protein 2 1 1
MIRT013102 Slc29a4 solute carrier family 29 (nucleoside transporters), member 4 1 1
MIRT013103 Scrn1 secernin 1 1 1
MIRT013104 Prkcb protein kinase C, beta 1 1
MIRT013105 Suco SUN domain containing ossification factor 1 1
MIRT013106 Elovl4 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 1 1
MIRT013107 Wnk1 WNK lysine deficient protein kinase 1 1 1
MIRT013108 Capn2 calpain 2 1 1
MIRT013109 Amigo1 adhesion molecule with Ig like domain 1 1 1
MIRT013110 4931406P16Rik RIKEN cDNA 4931406P16 gene 1 1
MIRT013111 Kcnk1 potassium channel, subfamily K, member 1 1 1
MIRT013112 Zscan22 zinc finger and SCAN domain containing 22 1 1
MIRT013113 Sv2a synaptic vesicle glycoprotein 2 a 1 1
MIRT013114 Sep15 selenoprotein F 1 1
MIRT013115 Zfp652 zinc finger protein 652 1 1
MIRT013116 Fam73b mitoguardin 2 1 1
MIRT013117 Mtmr6 myotubularin related protein 6 1 1
MIRT013118 Erc2 ELKS/RAB6-interacting/CAST family member 2 1 1
MIRT013119 Insr insulin receptor 1 1
MIRT013120 Sc4mol methylsterol monoxygenase 1 1 1
MIRT013121 Cltc clathrin, heavy polypeptide (Hc) 1 1
MIRT013122 Atp8b2 ATPase, class I, type 8B, member 2 1 1
MIRT013123 Mansc1 MANSC domain containing 1 1 1
MIRT013124 Galnt3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 1 1
MIRT013125 Cap2 CAP, adenylate cyclase-associated protein, 2 (yeast) 1 1
MIRT013126 Stambp STAM binding protein 1 1
MIRT013127 Tgfbr1 transforming growth factor, beta receptor I 1 1
MIRT013128 P2ry12 purinergic receptor P2Y, G-protein coupled 12 1 1
MIRT013129 Ppap2b phospholipid phosphatase 3 1 1
MIRT013130 Scn2a1 sodium channel, voltage-gated, type II, alpha 1 1
MIRT013131 2810407C02Rik selenoprotein T 1 1
MIRT013132 Chsy1 chondroitin sulfate synthase 1 1 1
MIRT013133 Mpv17l Mpv17 transgene, kidney disease mutant-like 1 1
MIRT013134 Cct2 chaperonin containing Tcp1, subunit 2 (beta) 1 1
MIRT013135 Psd3 pleckstrin and Sec7 domain containing 3 1 1
MIRT013136 Srl sarcalumenin 1 1
MIRT013137 Fgf11 fibroblast growth factor 11 1 1
MIRT013138 Glce glucuronyl C5-epimerase 1 1
MIRT013139 Lyrm9 LYR motif containing 9 1 1
MIRT013140 C030046E11Rik RAB6A GEF complex partner 1 1 1
MIRT013141 Mnt max binding protein 1 1
MIRT013142 Tm6sf1 transmembrane 6 superfamily member 1 1 1
MIRT013143 Macf1 microtubule-actin crosslinking factor 1 1 1
MIRT013144 Kcnh1 potassium voltage-gated channel, subfamily H (eag-related), member 1 1 1
MIRT013145 Itfg1 integrin alpha FG-GAP repeat containing 1 1 1
MIRT013146 Rsbn1l round spermatid basic protein 1-like 1 1
MIRT013147 Megf9 multiple EGF-like-domains 9 1 1
MIRT013148 Lgr4 leucine-rich repeat-containing G protein-coupled receptor 4 1 1
MIRT013149 Cbln3 cerebellin 3 precursor protein 1 1
MIRT013150 Son Son DNA binding protein 1 1
MIRT013151 Cfl2 cofilin 2, muscle 1 1
MIRT013152 Tspan2 tetraspanin 2 1 1
MIRT013153 Otud4 OTU domain containing 4 1 1
MIRT013154 Robo1 roundabout guidance receptor 1 1 1
MIRT013155 Gorasp1 golgi reassembly stacking protein 1 1 1
MIRT013156 Tmcc1 transmembrane and coiled coil domains 1 1 1
MIRT013157 Klhdc10 kelch domain containing 10 1 1
MIRT013158 Ppm1l protein phosphatase 1 (formerly 2C)-like 1 1
MIRT013159 Zfp217 zinc finger protein 217 1 1
MIRT013160 Ankrd12 ankyrin repeat domain 12 1 1
MIRT013161 Ranbp3l RAN binding protein 3-like 1 1
MIRT013162 Wwtr1 WW domain containing transcription regulator 1 1 1
MIRT013163 Slc39a10 solute carrier family 39 (zinc transporter), member 10 1 1
MIRT013164 Map4k3 mitogen-activated protein kinase kinase kinase kinase 3 1 1
MIRT013165 Micu2 mitochondrial calcium uptake 2 1 1
MIRT013166 Pbx3 pre B cell leukemia homeobox 3 1 1
MIRT013167 Acly ATP citrate lyase 1 1
MIRT013168 Kcna1 potassium voltage-gated channel, shaker-related subfamily, member 1 1 1
MIRT013169 Pcdh17 protocadherin 17 1 3
MIRT013170 Adam10 a disintegrin and metallopeptidase domain 10 1 1
MIRT013171 Dhx9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 1 1
MIRT013172 Atrn attractin 1 1
MIRT013173 Dnm3 dynamin 3 1 2
MIRT013174 Tenm2 teneurin transmembrane protein 2 1 1
MIRT013175 Rab9b RAB9B, member RAS oncogene family 1 3
MIRT577909 Prr11 proline rich 11 1 1
MIRT578172 Neu1 neuraminidase 1 1 1
MIRT578354 Lrrn4cl LRRN4 C-terminal like 1 2
MIRT578535 Htr1f 5-hydroxytryptamine (serotonin) receptor 1F 1 1
MIRT579061 Cpne9 copine family member IX 1 1
MIRT579071 Cox15 cytochrome c oxidase assembly protein 15 1 2
MIRT579090 Cnih3 cornichon family AMPA receptor auxiliary protein 3 1 2
MIRT579110 Clec2h C-type lectin domain family 2, member h 1 1
MIRT579204 Ccl28 chemokine (C-C motif) ligand 28 1 1
MIRT579356 Aplnr apelin receptor 1 1
MIRT579392 Alkbh1 alkB homolog 1, histone H2A dioxygenase 1 3
MIRT579922 Zbtb39 zinc finger and BTB domain containing 39 1 1
MIRT580010 Whsc1l1 nuclear receptor binding SET domain protein 3 1 2
MIRT580027 Whsc1 nuclear receptor binding SET domain protein 2 1 1
MIRT580118 Ubn2 ubinuclein 2 1 1
MIRT580354 Tmem26 transmembrane protein 26 1 1
MIRT581012 Six4 sine oculis-related homeobox 4 1 2
MIRT581117 Sept3 septin 3 1 1
MIRT581328 Rgs8 regulator of G-protein signaling 8 1 3
MIRT582269 Nbeal1 neurobeachin like 1 1 2
MIRT582595 Lrrc40 leucine rich repeat containing 40 1 1
MIRT582909 Il21 interleukin 21 1 1
MIRT583252 Gnb4 guanine nucleotide binding protein (G protein), beta 4 1 2
MIRT583321 Gfod1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT583818 Eif2s1 eukaryotic translation initiation factor 2, subunit 1 alpha 1 1
MIRT584497 Camk1d calcium/calmodulin-dependent protein kinase ID 1 2
MIRT584673 Fam214b family with sequence similarity 214, member B 1 1
MIRT585476 Txlnb taxilin beta 1 1
MIRT585691 Tbc1d24 TBC1 domain family, member 24 1 1
MIRT585874 Slc22a8 solute carrier family 22 (organic anion transporter), member 8 1 4
MIRT585962 Sike1 suppressor of IKBKE 1 1 3
MIRT586192 Ptprk protein tyrosine phosphatase, receptor type, K 1 1
MIRT586881 Htr3b 5-hydroxytryptamine (serotonin) receptor 3B 1 1
MIRT586915 Heatr2 dynein, axonemal assembly factor 5 1 2
MIRT587053 Gm5464 predicted gene 5464 1 2
MIRT587145 Gcnt4 glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase) 1 1
MIRT587241 Nxpe3 neurexophilin and PC-esterase domain family, member 3 1 1
MIRT587324 Ehbp1l1 EH domain binding protein 1-like 1 1 1
MIRT587474 D630045J12Rik RIKEN cDNA D630045J12 gene 1 4
MIRT587730 Cd28 CD28 antigen 1 1
MIRT587769 Ccpg1 cell cycle progression 1 1 1
MIRT587817 Gpatch11 G patch domain containing 11 1 1
MIRT587834 Casp8 caspase 8 1 2
MIRT587899 BC003965 cDNA sequence BC003965 1 1
MIRT588120 Acmsd amino carboxymuconate semialdehyde decarboxylase 1 1
MIRT588178 A530054K11Rik zinc finger protein 729a 1 1
MIRT588388 Zeb2 zinc finger E-box binding homeobox 2 1 1
MIRT588412 Zc3h12a zinc finger CCCH type containing 12A 1 1
MIRT588536 Unc5d unc-5 netrin receptor D 1 2
MIRT588542 Uhrf1bp1l UHRF1 (ICBP90) binding protein 1-like 1 1
MIRT588599 Tsc22d3 TSC22 domain family, member 3 1 1
MIRT588635 Tnfsf15 tumor necrosis factor (ligand) superfamily, member 15 1 1
MIRT588902 Slc15a5 solute carrier family 15, member 5 1 1
MIRT588907 Slc12a2 solute carrier family 12, member 2 1 1
MIRT589401 Nrf1 nuclear respiratory factor 1 1 1
MIRT589558 Mfap3l microfibrillar-associated protein 3-like 1 1
MIRT589667 Lcorl ligand dependent nuclear receptor corepressor-like 1 1
MIRT589733 Kcnip3 Kv channel interacting protein 3, calsenilin 1 2
MIRT589868 Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 1 1
MIRT589916 Gnaq guanine nucleotide binding protein, alpha q polypeptide 1 1
MIRT589958 Gabrb2 gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 1 1
MIRT589971 Gabpb2 GA repeat binding protein, beta 2 1 1
MIRT590111 Etv3 ets variant 3 1 1
MIRT590159 Eno2 enolase 2, gamma neuronal 1 1
MIRT590183 Ell2 elongation factor RNA polymerase II 2 1 1
MIRT590266 Ddx6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 1 1
MIRT590554 B3gnt2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 1 1
MIRT590862 Vps33b vacuolar protein sorting 33B 1 2
MIRT591030 Rfx3 regulatory factor X, 3 (influences HLA class II expression) 1 1
MIRT591128 Nwd1 NACHT and WD repeat domain containing 1 1 1
MIRT591312 Il18r1 interleukin 18 receptor 1 1 1
MIRT591358 Egfl6 EGF-like-domain, multiple 6 1 1
MIRT591516 Abcc9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 1 1
MIRT591607 Xrcc3 X-ray repair complementing defective repair in Chinese hamster cells 3 1 1
MIRT591610 Vps37a vacuolar protein sorting 37A 1 2
MIRT591689 Slc1a2 solute carrier family 1 (glial high affinity glutamate transporter), member 2 1 1
MIRT591704 Rpusd2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT591716 Rorb RAR-related orphan receptor beta 1 2
MIRT591830 Lin7a lin-7 homolog A (C. elegans) 1 1
MIRT591842 Iglon5 IgLON family member 5 1 1
MIRT591892 Fbrs fibrosin 1 1
MIRT592280 Gatc glutamyl-tRNA(Gln) amidotransferase, subunit C 1 1
MIRT592401 Tmco1 transmembrane and coiled-coil domains 1 1 1
MIRT592678 Has2 hyaluronan synthase 2 1 1
MIRT592794 Cdh12 cadherin 12 1 1
MIRT592825 Asb7 ankyrin repeat and SOCS box-containing 7 1 1
MIRT592839 Akap2 A kinase (PRKA) anchor protein 2 1 1
MIRT593406 Slc6a6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1 1
MIRT594171 Vdr vitamin D (1,25-dihydroxyvitamin D3) receptor 1 1
MIRT594212 Ubxn2b UBX domain protein 2B 1 1
MIRT594950 Fblim1 filamin binding LIM protein 1 1 1
MIRT594969 Fam49a family with sequence similarity 49, member A 1 1
MIRT595029 Ceacam20 carcinoembryonic antigen-related cell adhesion molecule 20 1 1
MIRT596107 Slamf1 signaling lymphocytic activation molecule family member 1 1 1
MIRT596446 Nrxn1 neurexin I 1 1
MIRT605108 Cpne3 copine III 1 1
MIRT605308 Zfp92 zinc finger protein 92 1 1
MIRT605454 St18 suppression of tumorigenicity 18 1 1
MIRT605531 Pstpip2 proline-serine-threonine phosphatase-interacting protein 2 1 1
MIRT605862 Brat1 BRCA1-associated ATM activator 1 1 1
MIRT605942 Sema6a sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A 1 1
MIRT605978 Mylk4 myosin light chain kinase family, member 4 1 1
MIRT606195 Slc5a8 solute carrier family 5 (iodide transporter), member 8 1 1
MIRT606232 Rab3c RAB3C, member RAS oncogene family 1 1
MIRT606758 Ncam1 neural cell adhesion molecule 1 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-297a Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
mmu-miR-297a-5p Doxorubicin 31703 NSC123127 approved sensitive Low Colorectal Cancer tissue and cell line (HCT-116)
mmu-miR-297a-5p Vincristine 5978 approved sensitive Low Colorectal Cancer tissue and cell line (HCT-116)
mmu-miR-297a-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer tissue and cell line (HCT-116)

Error report submission