miRTarBase - #MIRT014449


—
pre-miRNA Information
pre-miRNA mmu-mir-149   
Genomic Coordinates chr1: 92850378 - 92850443
Synonyms Mirn149, mmu-mir-149, Mir149
Description Mus musculus miR-149 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-149-5p
Sequence 4| UCUGGCUCCGUGUCUUCACUCCC |26
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Lpcat1
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
424 mmu-miR-149-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005299 Aicda activation-induced cytidine deaminase 2 1
MIRT014440 Tspan7 tetraspanin 7 1 1
MIRT014441 Ipcef1 interaction protein for cytohesin exchange factors 1 1 1
MIRT014442 Macrod2 MACRO domain containing 2 1 1
MIRT014443 Zkscan8 zinc finger with KRAB and SCAN domains 8 1 1
MIRT014444 Vat1 vesicle amine transport 1 1 1
MIRT014445 Kif1b kinesin family member 1B 1 1
MIRT014446 Sema4a sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A 1 1
MIRT014447 Adamts16 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16 1 1
MIRT014448 Ddx3x DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked 1 1
MIRT014449 Lpcat1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT014450 Mob1a MOB kinase activator 1A 1 1
MIRT014451 Opcml opioid binding protein/cell adhesion molecule-like 1 1
MIRT014452 Papola poly (A) polymerase alpha 1 1
MIRT014453 Uba2 ubiquitin-like modifier activating enzyme 2 1 1
MIRT014454 Tmem127 transmembrane protein 127 1 1
MIRT014455 Fut9 fucosyltransferase 9 1 1
MIRT014456 Zer1 zyg-11 related, cell cycle regulator 1 1
MIRT014457 Ptpn5 protein tyrosine phosphatase, non-receptor type 5 1 1
MIRT014458 Ksr2 kinase suppressor of ras 2 1 1
MIRT014459 Kcnj16 potassium inwardly-rectifying channel, subfamily J, member 16 1 1
MIRT014460 Rgp1 RAB6A GEF compex partner 1 1 1
MIRT014461 Nrgn neurogranin 1 1
MIRT014462 Elovl2 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 1 1
MIRT014463 Zfp280d zinc finger protein 280D 1 1
MIRT014464 Prnp prion protein 1 1
MIRT014465 Ube2n ubiquitin-conjugating enzyme E2N 1 1
MIRT014466 Nptn neuroplastin 1 1
MIRT014467 Twsg1 twisted gastrulation BMP signaling modulator 1 1 1
MIRT014468 Prrc2b proline-rich coiled-coil 2B 1 1
MIRT014469 Sdcbp syndecan binding protein 1 1
MIRT014470 Aldoc aldolase C, fructose-bisphosphate 1 1
MIRT014471 Smad7 SMAD family member 7 1 1
MIRT014472 Cdadc1 cytidine and dCMP deaminase domain containing 1 1 1
MIRT014473 Mfrp membrane frizzled-related protein 1 1
MIRT014474 Kit KIT proto-oncogene receptor tyrosine kinase 1 1
MIRT014475 Ubr4 ubiquitin protein ligase E3 component n-recognin 4 1 1
MIRT014476 Slc10a4 solute carrier family 10 (sodium/bile acid cotransporter family), member 4 1 1
MIRT014477 Il1rap interleukin 1 receptor accessory protein 1 1
MIRT014478 Rsrc2 arginine/serine-rich coiled-coil 2 1 1
MIRT014479 Luc7l3 LUC7-like 3 (S. cerevisiae) 1 1
MIRT014480 Nkrf NF-kappaB repressing factor 1 1
MIRT014481 Lfng LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT014482 Btbd19 BTB (POZ) domain containing 19 1 1
MIRT014483 Fam49b family with sequence similarity 49, member B 1 1
MIRT014484 Emc10 ER membrane protein complex subunit 10 1 1
MIRT014485 Tpp1 tripeptidyl peptidase I 1 1
MIRT014486 Ptgfrn prostaglandin F2 receptor negative regulator 1 1
MIRT014487 Zbtb9 zinc finger and BTB domain containing 9 1 1
MIRT014488 Crtc1 CREB regulated transcription coactivator 1 1 1
MIRT014489 Rab14 RAB14, member RAS oncogene family 1 1
MIRT014490 Add3 adducin 3 (gamma) 1 1
MIRT014491 Cul1 cullin 1 1 1
MIRT014492 Tmtc1 transmembrane and tetratricopeptide repeat containing 1 1 1
MIRT014493 Scn8a sodium channel, voltage-gated, type VIII, alpha 1 1
MIRT014494 Acot11 acyl-CoA thioesterase 11 1 1
MIRT014495 Htr5a 5-hydroxytryptamine (serotonin) receptor 5A 1 1
MIRT014496 Ppp2r2c protein phosphatase 2, regulatory subunit B, gamma 1 1
MIRT014497 Ikbkg inhibitor of kappaB kinase gamma 1 1
MIRT014498 Bptf bromodomain PHD finger transcription factor 1 1
MIRT014499 Reep4 receptor accessory protein 4 1 1
MIRT014500 Cxcl12 chemokine (C-X-C motif) ligand 12 1 1
MIRT014501 Soat1 sterol O-acyltransferase 1 1 1
MIRT014502 Gprc5b G protein-coupled receptor, family C, group 5, member B 1 1
MIRT014503 Btd biotinidase 1 1
MIRT014504 Ip6k1 inositol hexaphosphate kinase 1 1 1
MIRT014505 Arl5a ADP-ribosylation factor-like 5A 1 1
MIRT014506 Plekhh2 pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 1 1
MIRT014507 Tex264 testis expressed gene 264 1 1
MIRT014508 Gpc1 glypican 1 1 1
MIRT014509 Nol10 nucleolar protein 10 1 3
MIRT014510 Elmo1 engulfment and cell motility 1 1 1
MIRT014511 Shisa6 shisa family member 6 1 1
MIRT014512 Zbtb39 zinc finger and BTB domain containing 39 1 1
MIRT014513 Cdr2l cerebellar degeneration-related protein 2-like 1 1
MIRT014514 Aagab alpha- and gamma-adaptin binding protein 1 1
MIRT014515 Nmnat2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT014516 Acvr1b activin A receptor, type 1B 1 1
MIRT014517 Vamp2 vesicle-associated membrane protein 2 1 1
MIRT014518 Ctnnd1 catenin (cadherin associated protein), delta 1 1 1
MIRT014519 Dpp8 dipeptidylpeptidase 8 1 1
MIRT014520 Lhx1 LIM homeobox protein 1 1 1
MIRT014521 Spred3 sprouty-related, EVH1 domain containing 3 1 1
MIRT014522 Foxn3 forkhead box N3 1 1
MIRT014523 Ska3 spindle and kinetochore associated complex subunit 3 1 1
MIRT014524 Tnrc6b trinucleotide repeat containing 6b 1 1
MIRT014525 Setd7 SET domain containing (lysine methyltransferase) 7 1 1
MIRT014526 Tcta T cell leukemia translocation altered gene 1 1
MIRT014527 Sez6 seizure related gene 6 1 1
MIRT014528 Pafah1b2 platelet-activating factor acetylhydrolase, isoform 1b, subunit 2 1 1
MIRT014529 Polr3f polymerase (RNA) III (DNA directed) polypeptide F 1 1
MIRT014530 Kifap3 kinesin-associated protein 3 1 1
MIRT014531 Arhgef10 Rho guanine nucleotide exchange factor (GEF) 10 1 1
MIRT014532 B3galt5 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 1 1
MIRT014533 Kcnj3 potassium inwardly-rectifying channel, subfamily J, member 3 1 1
MIRT014534 Lpin1 lipin 1 1 1
MIRT014535 Syt6 synaptotagmin VI 1 1
MIRT014536 Ephb3 Eph receptor B3 1 5
MIRT014537 Dbx2 developing brain homeobox 2 1 1
MIRT014538 Vldlr very low density lipoprotein receptor 1 1
MIRT014539 Sema4g sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G 1 1
MIRT014540 BC034090 cDNA sequence BC034090 1 1
MIRT014541 Sash1 SAM and SH3 domain containing 1 1 1
MIRT014542 Ttc3 tetratricopeptide repeat domain 3 1 1
MIRT014543 Flrt1 fibronectin leucine rich transmembrane protein 1 1 1
MIRT014544 Hnrnpa1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT014545 Rdx radixin 1 1
MIRT014546 Mapk9 mitogen-activated protein kinase 9 1 1
MIRT014547 Grm1 glutamate receptor, metabotropic 1 1 1
MIRT014548 Mvb12b multivesicular body subunit 12B 1 1
MIRT014549 Cpox coproporphyrinogen oxidase 1 1
MIRT014550 Gtf2i general transcription factor II I 1 1
MIRT014551 Tinf2 Terf1 (TRF1)-interacting nuclear factor 2 1 1
MIRT014552 Snhg11 small nucleolar RNA host gene 11 1 1
MIRT014553 Rragc Ras-related GTP binding C 1 1
MIRT014554 Pde7b phosphodiesterase 7B 1 1
MIRT014555 Gab1 growth factor receptor bound protein 2-associated protein 1 1 1
MIRT014556 Fabp7 fatty acid binding protein 7, brain 1 1
MIRT014557 Gprc5c G protein-coupled receptor, family C, group 5, member C 1 1
MIRT014558 Furin furin (paired basic amino acid cleaving enzyme) 1 1
MIRT014559 Rnf144a ring finger protein 144A 1 1
MIRT014560 Cant1 calcium activated nucleotidase 1 1 1
MIRT014561 Nrep neuronal regeneration related protein 1 1
MIRT014562 Il6st interleukin 6 signal transducer 1 1
MIRT014563 F3 coagulation factor III 1 1
MIRT014564 1190002N15Rik RIKEN cDNA 1190002N15 gene 1 1
MIRT014565 Mdm4 transformed mouse 3T3 cell double minute 4 1 1
MIRT014566 Lmbrd1 LMBR1 domain containing 1 1 1
MIRT014567 Sf3b3 splicing factor 3b, subunit 3 1 1
MIRT014568 Ptprd protein tyrosine phosphatase, receptor type, D 1 1
MIRT014569 Ikbkap inhibitor of kappa light polypeptide enhancer in B cells, kinase complex-associated protein 1 1
MIRT014570 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT014571 Camta1 calmodulin binding transcription activator 1 1 1
MIRT014572 Irak1 interleukin-1 receptor-associated kinase 1 1 1
MIRT014573 Pccb propionyl Coenzyme A carboxylase, beta polypeptide 1 1
MIRT014574 Neto2 neuropilin (NRP) and tolloid (TLL)-like 2 1 1
MIRT014575 Map3k14 mitogen-activated protein kinase kinase kinase 14 1 1
MIRT014576 Scn4b sodium channel, type IV, beta 1 1
MIRT014577 Trib2 tribbles pseudokinase 2 1 1
MIRT014578 Git2 G protein-coupled receptor kinase-interactor 2 1 1
MIRT014579 Reep1 receptor accessory protein 1 1 1
MIRT014580 Atg5 autophagy related 5 1 1
MIRT014581 Gng7 guanine nucleotide binding protein (G protein), gamma 7 1 1
MIRT014582 Fem1b feminization 1 homolog b (C. elegans) 1 1
MIRT014583 Trak2 trafficking protein, kinesin binding 2 1 1
MIRT014584 Gnao1 guanine nucleotide binding protein, alpha O 1 1
MIRT014585 Dpy19l3 dpy-19-like 3 (C. elegans) 1 1
MIRT014586 Ptpn12 protein tyrosine phosphatase, non-receptor type 12 1 1
MIRT014587 Wdr1 WD repeat domain 1 1 1
MIRT014588 Pofut1 protein O-fucosyltransferase 1 1 1
MIRT014589 Usp48 ubiquitin specific peptidase 48 1 1
MIRT014590 Cxadr coxsackie virus and adenovirus receptor 1 1
MIRT014591 Lrrc58 leucine rich repeat containing 58 1 1
MIRT014592 R3hdm1 R3H domain containing 1 1 1
MIRT014593 4933426M11Rik sushi domain containing 6 1 1
MIRT014594 Med10 mediator complex subunit 10 1 1
MIRT014595 Sptbn2 spectrin beta, non-erythrocytic 2 1 1
MIRT014596 8430419L09Rik family with sequence similarity 234, member B 1 1
MIRT014597 Kcnc1 potassium voltage gated channel, Shaw-related subfamily, member 1 1 1
MIRT014598 Dgcr2 DiGeorge syndrome critical region gene 2 1 1
MIRT014599 Mtmr12 myotubularin related protein 12 1 1
MIRT014600 Txnip thioredoxin interacting protein 1 1
MIRT014601 Slc39a3 solute carrier family 39 (zinc transporter), member 3 1 1
MIRT014602 Itsn1 intersectin 1 (SH3 domain protein 1A) 1 1
MIRT014603 Efcab14 EF-hand calcium binding domain 14 1 1
MIRT014604 Csnk1a1 casein kinase 1, alpha 1 1 1
MIRT014605 Gria1 glutamate receptor, ionotropic, AMPA1 (alpha 1) 1 1
MIRT014606 Zfp605 zinc finger protein 605 1 1
MIRT014607 Cnot6 CCR4-NOT transcription complex, subunit 6 1 1
MIRT014608 Paqr4 progestin and adipoQ receptor family member IV 1 1
MIRT014609 Unc5b unc-5 netrin receptor B 1 1
MIRT014610 Hecw1 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 1 1
MIRT014611 Zcchc4 zinc finger, CCHC domain containing 4 1 1
MIRT014612 Fam102a family with sequence similarity 102, member A 1 1
MIRT014613 Plekha2 pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 1 1
MIRT014614 Tmem135 transmembrane protein 135 1 1
MIRT014615 Tmem8b transmembrane protein 8B 1 1
MIRT014616 Ccser2 coiled-coil serine rich 2 1 1
MIRT014617 Sdc3 syndecan 3 1 1
MIRT014618 Braf Braf transforming gene 1 1
MIRT014619 Pno1 partner of NOB1 homolog 1 1
MIRT014620 Bahcc1 BAH domain and coiled-coil containing 1 1 1
MIRT014621 Gramd1b GRAM domain containing 1B 1 1
MIRT014622 Prkab1 protein kinase, AMP-activated, beta 1 non-catalytic subunit 1 1
MIRT014623 Plec plectin 1 1
MIRT014624 Rap2a RAS related protein 2a 1 1
MIRT014625 Rhbdd2 rhomboid domain containing 2 1 1
MIRT014626 Sertad2 SERTA domain containing 2 1 1
MIRT014627 Entpd7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT014628 Efr3b EFR3 homolog B 1 1
MIRT014629 Gabrb2 gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 1 1
MIRT014630 Atp2a2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1 1
MIRT014631 Fnbp1 formin binding protein 1 1 1
MIRT014632 Dab2ip disabled 2 interacting protein 1 1
MIRT014633 Snx27 sorting nexin family member 27 1 1
MIRT014634 Hmg20a high mobility group 20A 1 1
MIRT014635 Rab3gap1 RAB3 GTPase activating protein subunit 1 1 1
MIRT014636 Epb4.1l1 erythrocyte membrane protein band 4.1 like 1 1 1
MIRT014637 Epha4 Eph receptor A4 1 1
MIRT014638 Bach1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 1 1
MIRT014639 Rab6b RAB6B, member RAS oncogene family 1 1
MIRT014640 6030458C11Rik RIKEN cDNA 6030458C11 gene 1 1
MIRT014641 Zbtb4 zinc finger and BTB domain containing 4 1 1
MIRT014642 Cbx5 chromobox 5 1 1
MIRT014643 Eif5a eukaryotic translation initiation factor 5A 1 1
MIRT014644 Slc37a3 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 1 1
MIRT014645 Rcc2 regulator of chromosome condensation 2 1 1
MIRT014646 Caln1 calneuron 1 1 1
MIRT014647 Frem2 Fras1 related extracellular matrix protein 2 1 1
MIRT014648 Clp1 CLP1, cleavage and polyadenylation factor I subunit 1 1
MIRT014649 Ablim1 actin-binding LIM protein 1 1 1
MIRT014650 Krba1 KRAB-A domain containing 1 1 1
MIRT014651 Sec14l1 SEC14-like lipid binding 1 1 1
MIRT014652 Ywhab tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide 1 1
MIRT014653 Bcas3 breast carcinoma amplified sequence 3 1 1
MIRT014654 Celf5 CUGBP, Elav-like family member 5 1 1
MIRT014655 Atad2 ATPase family, AAA domain containing 2 1 1
MIRT014656 Nptx1 neuronal pentraxin 1 1 1
MIRT014657 Mmp15 matrix metallopeptidase 15 1 1
MIRT014658 Crkl v-crk avian sarcoma virus CT10 oncogene homolog-like 1 1
MIRT014659 Pigq phosphatidylinositol glycan anchor biosynthesis, class Q 1 1
MIRT014660 Akt1 thymoma viral proto-oncogene 1 1 1
MIRT014661 Zmat3 zinc finger matrin type 3 1 1
MIRT014662 Cds2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 1 1
MIRT014663 Nhsl1 NHS-like 1 1 1
MIRT014664 Poglut1 protein O-glucosyltransferase 1 1 1
MIRT014665 Slc35e2 solute carrier family 35, member E2 1 1
MIRT014666 Cep95 centrosomal protein 95 1 1
MIRT014667 2510039O18Rik RIKEN cDNA 2510039O18 gene 1 1
MIRT014668 Dhcr24 24-dehydrocholesterol reductase 1 1
MIRT014669 Arid4b AT rich interactive domain 4B (RBP1-like) 1 1
MIRT014670 Iws1 IWS1, SUPT6 interacting protein 1 1
MIRT014671 Ifngr2 interferon gamma receptor 2 1 1
MIRT014672 Zfp251 zinc finger protein 251 1 1
MIRT014673 Med26 mediator complex subunit 26 1 1
MIRT014674 Reck reversion-inducing-cysteine-rich protein with kazal motifs 1 1
MIRT014675 Bicd2 bicaudal D homolog 2 (Drosophila) 1 1
MIRT014676 Tmbim6 transmembrane BAX inhibitor motif containing 6 1 1
MIRT014677 Cdk13 cyclin-dependent kinase 13 1 1
MIRT014678 Rapgef4 Rap guanine nucleotide exchange factor (GEF) 4 1 1
MIRT014679 Trank1 tetratricopeptide repeat and ankyrin repeat containing 1 1 1
MIRT014680 Stam2 signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 1 1
MIRT014681 Ppp1r1a protein phosphatase 1, regulatory (inhibitor) subunit 1A 1 1
MIRT014682 Thsd4 thrombospondin, type I, domain containing 4 1 1
MIRT014683 Cadm2 cell adhesion molecule 2 1 1
MIRT014684 Slc6a17 solute carrier family 6 (neurotransmitter transporter), member 17 1 1
MIRT014685 Sestd1 SEC14 and spectrin domains 1 1 1
MIRT014686 Tbc1d20 TBC1 domain family, member 20 1 1
MIRT014687 Per2 period circadian clock 2 1 1
MIRT014688 Ugcg UDP-glucose ceramide glucosyltransferase 1 1
MIRT014689 Ric3 RIC3 acetylcholine receptor chaperone 1 1
MIRT014690 Usp10 ubiquitin specific peptidase 10 1 1
MIRT014691 Macf1 microtubule-actin crosslinking factor 1 1 1
MIRT014692 Adck4 coenzyme Q8B 1 1
MIRT014693 Tef thyrotroph embryonic factor 1 1
MIRT014694 Slc24a3 solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 1 1
MIRT014695 Ccdc43 coiled-coil domain containing 43 1 1
MIRT014696 Nf1 neurofibromin 1 1 1
MIRT014697 Hip1 huntingtin interacting protein 1 1 1
MIRT014698 Ptpn11 protein tyrosine phosphatase, non-receptor type 11 1 1
MIRT014699 Wnk1 WNK lysine deficient protein kinase 1 1 1
MIRT014700 Lmtk2 lemur tyrosine kinase 2 1 1
MIRT014701 Synj1 synaptojanin 1 1 1
MIRT014702 Clmp CXADR-like membrane protein 1 1
MIRT014703 Slc22a23 solute carrier family 22, member 23 1 1
MIRT014704 Otud7b OTU domain containing 7B 1 1
MIRT014705 Slc1a1 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 1 1
MIRT014706 Astn1 astrotactin 1 1 1
MIRT014707 Stk38 serine/threonine kinase 38 1 1
MIRT014708 BC026590 family with sequence similarity 206, member A 1 1
MIRT014709 Fam102b family with sequence similarity 102, member B 1 1
MIRT014710 Rictor RPTOR independent companion of MTOR, complex 2 1 1
MIRT014711 Ntrk2 neurotrophic tyrosine kinase, receptor, type 2 1 1
MIRT014712 Phka1 phosphorylase kinase alpha 1 1 1
MIRT014713 Gpr89 G protein-coupled receptor 89 1 1
MIRT014714 Cdk19 cyclin-dependent kinase 19 1 1
MIRT014715 Kansl3 KAT8 regulatory NSL complex subunit 3 1 1
MIRT014716 Kcnk6 potassium inwardly-rectifying channel, subfamily K, member 6 1 2
MIRT014717 Rnf169 ring finger protein 169 1 1
MIRT014718 Sart1 squamous cell carcinoma antigen recognized by T cells 1 1 1
MIRT014719 Ralgapa2 Ral GTPase activating protein, alpha subunit 2 (catalytic) 1 1
MIRT014720 Fam219a family with sequence similarity 219, member A 1 1
MIRT014721 Antxr1 anthrax toxin receptor 1 1 1
MIRT014722 Scn1a sodium channel, voltage-gated, type I, alpha 1 1
MIRT014723 Cog3 component of oligomeric golgi complex 3 1 1
MIRT014724 Scamp5 secretory carrier membrane protein 5 1 1
MIRT014725 Zfyve27 zinc finger, FYVE domain containing 27 1 1
MIRT014726 Mecp2 methyl CpG binding protein 2 1 1
MIRT014727 Gpr17 G protein-coupled receptor 17 1 1
MIRT014728 Dusp16 dual specificity phosphatase 16 1 1
MIRT014729 Nt5dc3 5'-nucleotidase domain containing 3 1 1
MIRT014730 Cbx1 chromobox 1 1 1
MIRT014731 2700089E24Rik small integral membrane protein 10 like 1 1 1
MIRT014732 Syt2 synaptotagmin II 1 1
MIRT014733 Sik3 SIK family kinase 3 1 1
MIRT014734 Asxl2 additional sex combs like 2 (Drosophila) 1 1
MIRT014735 Fkbp1b FK506 binding protein 1b 1 1
MIRT014736 Adcy1 adenylate cyclase 1 1 1
MIRT014737 Nfix nuclear factor I/X 1 1
MIRT014738 Pea15a phosphoprotein enriched in astrocytes 15A 1 1
MIRT014739 Nrp2 neuropilin 2 1 1
MIRT014740 N4bp1 NEDD4 binding protein 1 1 1
MIRT014741 Elfn1 leucine rich repeat and fibronectin type III, extracellular 1 1 1
MIRT014742 Mtch1 mitochondrial carrier 1 1 1
MIRT014743 Atad3a ATPase family, AAA domain containing 3A 1 1
MIRT014744 St8sia3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 1 1
MIRT014745 Ulk1 unc-51 like kinase 1 1 1
MIRT014746 Zfp354c zinc finger protein 354C 1 1
MIRT014747 Rsbn1 rosbin, round spermatid basic protein 1 1 1
MIRT014748 Calr calreticulin 1 1
MIRT014749 Tmod2 tropomodulin 2 1 1
MIRT014750 Nedd4 neural precursor cell expressed, developmentally down-regulated 4 1 1
MIRT014751 Coa3 cytochrome C oxidase assembly factor 3 1 1
MIRT014752 Pdgfrb platelet derived growth factor receptor, beta polypeptide 1 1
MIRT014753 Slc30a4 solute carrier family 30 (zinc transporter), member 4 1 1
MIRT014754 Adar adenosine deaminase, RNA-specific 1 1
MIRT014755 Ywhag tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide 1 1
MIRT014756 Scd2 stearoyl-Coenzyme A desaturase 2 1 1
MIRT014757 Zfp445 zinc finger protein 445 1 1
MIRT014758 Rfx5 regulatory factor X, 5 (influences HLA class II expression) 1 1
MIRT014759 Igfbp7 insulin-like growth factor binding protein 7 1 1
MIRT014760 Tmem109 transmembrane protein 109 1 1
MIRT014761 Fem1c fem-1 homolog c (C.elegans) 1 1
MIRT014762 Mmp17 matrix metallopeptidase 17 1 1
MIRT014763 Gxylt1 glucoside xylosyltransferase 1 1 1
MIRT014764 Cbln1 cerebellin 1 precursor protein 1 1
MIRT014765 Ube2i ubiquitin-conjugating enzyme E2I 1 1
MIRT014766 Trp53inp2 transformation related protein 53 inducible nuclear protein 2 1 1
MIRT014767 Efna5 ephrin A5 1 1
MIRT014768 Gpr68 G protein-coupled receptor 68 1 1
MIRT014769 Rad51c RAD51 paralog C 1 1
MIRT014770 Camk1g calcium/calmodulin-dependent protein kinase I gamma 1 1
MIRT014771 Entpd6 ectonucleoside triphosphate diphosphohydrolase 6 1 1
MIRT014772 Osbpl8 oxysterol binding protein-like 8 1 1
MIRT014773 Inpp5b inositol polyphosphate-5-phosphatase B 1 1
MIRT014774 Hspg2 perlecan (heparan sulfate proteoglycan 2) 1 1
MIRT014775 Ahcyl1 S-adenosylhomocysteine hydrolase-like 1 1 1
MIRT014776 Zcchc24 zinc finger, CCHC domain containing 24 1 1
MIRT014777 Syt11 synaptotagmin XI 1 1
MIRT014778 Tmem2 transmembrane protein 2 1 1
MIRT014779 Bsdc1 BSD domain containing 1 1 1
MIRT014780 Srrm2 serine/arginine repetitive matrix 2 1 1
MIRT014781 Ank2 ankyrin 2, brain 1 1
MIRT014782 Slc15a4 solute carrier family 15, member 4 1 1
MIRT014783 Tomm70a translocase of outer mitochondrial membrane 70 homolog A (yeast) 1 1
MIRT014784 Mid2 midline 2 1 1
MIRT014785 Zbtb41 zinc finger and BTB domain containing 41 1 1
MIRT014786 Nlgn3 neuroligin 3 1 1
MIRT014787 Aldh9a1 aldehyde dehydrogenase 9, subfamily A1 1 1
MIRT014788 Slc6a6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1 1
MIRT014789 Slc30a7 solute carrier family 30 (zinc transporter), member 7 1 1
MIRT014790 Lmf2 lipase maturation factor 2 1 1
MIRT014791 Slc44a2 solute carrier family 44, member 2 1 1
MIRT014792 Dazap2 DAZ associated protein 2 1 1
MIRT014793 Capns1 calpain, small subunit 1 1 1
MIRT014794 Nr1d2 nuclear receptor subfamily 1, group D, member 2 1 1
MIRT014795 Pnkd paroxysmal nonkinesiogenic dyskinesia 1 1
MIRT014796 Rnf165 ring finger protein 165 1 1
MIRT014797 Myo10 myosin X 1 1
MIRT014798 Tnrc6a trinucleotide repeat containing 6a 1 1
MIRT014799 Mbp myelin basic protein 1 1
MIRT014800 Hic2 hypermethylated in cancer 2 1 1
MIRT014801 Rap1gap2 RAP1 GTPase activating protein 2 1 1
MIRT014802 Nfia nuclear factor I/A 1 1
MIRT014803 Sept8 septin 8 1 1
MIRT014804 Elf2 E74-like factor 2 1 1
MIRT014805 Zzz3 zinc finger, ZZ domain containing 3 1 1
MIRT014806 Edem1 ER degradation enhancer, mannosidase alpha-like 1 1 1
MIRT014807 Atrn attractin 1 1
MIRT014808 Csdc2 cold shock domain containing C2, RNA binding 1 1
MIRT014809 Timp3 tissue inhibitor of metalloproteinase 3 1 1
MIRT014810 Ddit4 DNA-damage-inducible transcript 4 1 1
MIRT014811 Dok1 docking protein 1 1 1
MIRT014812 Slc43a2 solute carrier family 43, member 2 1 1
MIRT014813 Zkscan1 zinc finger with KRAB and SCAN domains 1 1 1
MIRT014814 Ptpn4 protein tyrosine phosphatase, non-receptor type 4 1 1
MIRT014815 Ssbp2 single-stranded DNA binding protein 2 1 1
MIRT014816 Igfbp5 insulin-like growth factor binding protein 5 1 1
MIRT014817 Naa40 N(alpha)-acetyltransferase 40, NatD catalytic subunit 1 1
MIRT014818 Elovl5 ELOVL family member 5, elongation of long chain fatty acids (yeast) 1 1
MIRT014819 Ttyh3 tweety family member 3 1 1
MIRT014820 Arc activity regulated cytoskeletal-associated protein 1 1
MIRT014821 Kcnj10 potassium inwardly-rectifying channel, subfamily J, member 10 1 1
MIRT014822 Gm608 upstream transcription factor family member 3 1 1
MIRT014823 Itpa inosine triphosphatase (nucleoside triphosphate pyrophosphatase) 1 1
MIRT014824 Slc6a8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 1 1
MIRT014825 Ppap2b phospholipid phosphatase 3 1 1
MIRT014826 Prickle2 prickle planar cell polarity protein 2 1 1
MIRT014827 Wwtr1 WW domain containing transcription regulator 1 1 1
MIRT014828 Ncoa5 nuclear receptor coactivator 5 1 1
MIRT014829 Brap BRCA1 associated protein 1 1
MIRT014830 Tnks tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 1 1
MIRT014831 Plxna2 plexin A2 1 1
MIRT014832 Camk2g calcium/calmodulin-dependent protein kinase II gamma 1 1
MIRT014833 Klf7 Kruppel-like factor 7 (ubiquitous) 1 1
MIRT014834 Rnf24 ring finger protein 24 1 1
MIRT014835 Fbxl16 F-box and leucine-rich repeat protein 16 1 4
MIRT014836 Gria3 glutamate receptor, ionotropic, AMPA3 (alpha 3) 1 1
MIRT579316 BC003965 cDNA sequence BC003965 1 2
MIRT579432 Adsl adenylosuccinate lyase 1 1
MIRT579655 2010012O05Rik BLOC-1 related complex subunit 7 1 3
MIRT582543 Map3k7 mitogen-activated protein kinase kinase kinase 7 1 1
MIRT585596 Tns4 tensin 4 1 1
MIRT585774 Speer4b spermatogenesis associated glutamate (E)-rich protein 4B 1 1
MIRT586832 Il5ra interleukin 5 receptor, alpha 1 1
MIRT587885 BC030476 glutamate rich 5 1 2
MIRT588274 Sppl2a signal peptide peptidase like 2A 1 1
MIRT588313 Zyg11b zyg-ll family member B, cell cycle regulator 1 2
MIRT588445 Ybx1 Y box protein 1 1 2
MIRT591825 Mapkap1 mitogen-activated protein kinase associated protein 1 1 2
MIRT592956 Zdhhc3 zinc finger, DHHC domain containing 3 1 1
MIRT593007 Axl AXL receptor tyrosine kinase 1 1
MIRT593463 Mylip myosin regulatory light chain interacting protein 1 2
MIRT593797 Mettl2 methyltransferase like 2 1 1
MIRT594568 2900026A02Rik RIKEN cDNA 2900026A02 gene 1 1
MIRT595594 Ago1 argonaute RISC catalytic subunit 1 1 1
MIRT597699 Ppp1r2 protein phosphatase 1, regulatory (inhibitor) subunit 2 1 1
MIRT599114 Ecd ecdysoneless homolog (Drosophila) 1 1
MIRT601960 Nav1 neuron navigator 1 1 1
MIRT602350 Fktn fukutin 1 1
MIRT605621 Mpp7 membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) 1 1
MIRT606005 Fam129a family with sequence similarity 129, member A 1 1
MIRT606581 Zfp941 zinc finger protein 941 1 1
MIRT756230 HSF4 heat shock transcription factor 4 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-149 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
miR-149 Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 down-regulated
miR-149 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-149 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-149 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-149 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated

Error report submission