pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-149 |
Genomic Coordinates | chr1: 92850378 - 92850443 |
Synonyms | Mirn149, mmu-mir-149, Mir149 |
Description | Mus musculus miR-149 stem-loop |
Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-149-5p |
Sequence | 4| UCUGGCUCCGUGUCUUCACUCCC |26 |
Evidence | Experimental |
Experiments | Cloned |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Ephb3 | ||||||||||||||||||||
Synonyms | AW456895, Cek10, Etk2, HEK2, MDK5, Sek4, Tyro6 | ||||||||||||||||||||
Description | Eph receptor B3 | ||||||||||||||||||||
Transcript | NM_010143 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on Ephb3 | |||||||||||||||||||||
3'UTR of Ephb3 (miRNA target sites are highlighted) |
>Ephb3|NM_010143|3'UTR 1 CACTCAGCTCCAACGAGGGGGGGGTGCCCCCCCAGGACTGCACAAGGATTCTGACCAGCCAGCTGGACTTTTGGATGCCT 81 GGCCTCTGGCTGTGGCCCAGAAGATGGAAGTTTGGGGGAGGACCCTAGCTGTGACTTCTCCAGGCCTGTGCTCCCTCCCA 161 GGAAGTGTGCCCCAAACCTCTTCATATTGAAGATGGATTAGAAGAGGGGGTGATGTCCCCTCCCCAGATGCCTTGGGGCC 241 CAGGCCTGCCTGCTCTCCAGTGGGGAGTCTTCACAACTCAGATTGGGCTGCGCTTCAGTAATGGACGTCCTGGTAGGGTC 321 AGGTGGGGATAAGCCTGGGTTCTTCAGGCCCCAGCCCTGGCAGGGGTCTGACCCCACCAGGTAAGCAGAGAGTACTCCCT 401 CCCCCAGGAAGTGGAGGAGGAGACTCTGGGGATGGGGAGATATGGTGCCCCATCCTGAAGCCAGCTGGTACCTCCAGTTT 481 GCACAGGGACTTGATGGGGGCTGAGGGCCCTGCCTACCCTTGGTGCTGTCATAAAAGGGCAGGCAGGAGCAGGCTGAGAA 561 GCAGCCTGTGCCTCCCAGAGACTGACTCAGAGAGCCAGAGACTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 641 TGTGTGTGTGAAAGACGGGGGTGGGGGTATGTATGTGTGTGTTGTGCACATGCTTGCCTGCACAGAGAGCATGAGTGTGT 721 ACAAGCTTGGCCCTGTGCCCTGTAGTGGGGCCAGCTGGGCAGACAGCAAAATAAAGGCAATAAGATGAAAAAAAAAAAAA 801 AAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Brain (Mouse neocortex) |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | mESCs |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM622571. RNA binding protein: AGO2. Condition:WT1B
HITS-CLIP data was present in GSM622574. RNA binding protein: AGO2. Condition:KO2
... - Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology. |
Article |
- Leung AK; Young AG; Bhutkar A; Zheng GX; et al. - Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | CD4+ T cells (C57BL/6) |
Disease | MIMAT0000159 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM1013594. RNA binding protein: AGO2. Condition:CD4+ T cells
"HITS-CLIP data was present in GSM1013595. RNA binding protein: AGO2. Condition:CD4+ T cells
... - Loeb GB; Khan AA; Canner D; Hiatt JB; et al., 2012, Molecular cell. |
Article |
- Loeb GB; Khan AA; Canner D; Hiatt JB; et al. - Molecular cell, 2012
MicroRNAs (miRNAs) are essential components of gene regulation, but identification of miRNA targets remains a major challenge. Most target prediction and discovery relies on perfect complementarity of the miRNA seed to the 3' untranslated region (UTR). However, it is unclear to what extent miRNAs target sites without seed matches. Here, we performed a transcriptome-wide identification of the endogenous targets of a single miRNA-miR-155-in a genetically controlled manner. We found that approximately 40% of miR-155-dependent Argonaute binding occurs at sites without perfect seed matches. The majority of these noncanonical sites feature extensive complementarity to the miRNA seed with one mismatch. These noncanonical sites confer regulation of gene expression, albeit less potently than canonical sites. Thus, noncanonical miRNA binding sites are widespread, often contain seed-like motifs, and can regulate gene expression, generating a continuum of targeting and regulation.
LinkOut: [PMID: 23142080]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Liver |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in ERR266287. RNA binding protein: AGO2. Condition:B_Liver partial hapatectomy 36h
HITS-CLIP data was present in ERR266292. RNA binding protein: AGO2. Condition:B_Liver partial hapatectomy 48h
HITS-CLIP data was present in ERR266293. RNA binding protein: AGO2. Condition:A_Liver partial hapatectomy 36h
HITS-CLIP data was present in ERR266295. RNA binding protein: AGO2. Condition:B_Liver partial hapatectomy 1h
HITS-CLIP data was present in ERR266298. RNA binding protein: AGO2. Condition:A_Untreated
HITS-CLIP data was present in ERR266300. RNA binding protein: AGO2. Condition:B_Untreated
... - Schug J; McKenna LB; Walton G; Hand N; et al., 2013, BMC genomics. |
Article |
- Schug J; McKenna LB; Walton G; Hand N; et al. - BMC genomics, 2013
BACKGROUND: Validation of physiologic miRNA targets has been met with significant challenges. We employed HITS-CLIP to identify which miRNAs participate in liver regeneration, and to identify their target mRNAs. RESULTS: miRNA recruitment to the RISC is highly dynamic, changing more than five-fold for several miRNAs. miRNA recruitment to the RISC did not correlate with changes in overall miRNA expression for these dynamically recruited miRNAs, emphasizing the necessity to determine miRNA recruitment to the RISC in order to fully assess the impact of miRNA regulation. We incorporated RNA-seq quantification of total mRNA to identify expression-weighted Ago footprints, and developed a microRNA regulatory element (MRE) prediction algorithm that represents a greater than 20-fold refinement over computational methods alone. These high confidence MREs were used to generate candidate 'competing endogenous RNA' (ceRNA) networks. CONCLUSION: HITS-CLIP analysis provide novel insights into global miRNA:mRNA relationships in the regenerating liver.
LinkOut: [PMID: 23597149]
|
Experimental Support 5 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | C2C12 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1385342. RNA binding protein: 聽AGO2. Condition:C2C12_GM_Ago2_CLIP-Seq_myoblast
HITS-CLIP data was present in GSM1385343. RNA binding protein: 聽AGO2. Condition:C2C12_DM_Ago2_CLIP-Seq_myotubes
... - Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al., 2014, Cell. |
Article |
- Zhang X; Zuo X; Yang B; Li Z; Xue Y; Zhou et al. - Cell, 2014
MicroRNAs are well known to mediate translational repression and mRNA degradation in the cytoplasm. Various microRNAs have also been detected in membrane-compartmentalized organelles, but the functional significance has remained elusive. Here, we report that miR-1, a microRNA specifically induced during myogenesis, efficiently enters the mitochondria where it unexpectedly stimulates, rather than represses, the translation of specific mitochondrial genome-encoded transcripts. We show that this positive effect requires specific miR:mRNA base-pairing and Ago2, but not its functional partner GW182, which is excluded from the mitochondria. We provide evidence for the direct action of Ago2 in mitochondrial translation by crosslinking immunoprecipitation coupled with deep sequencing (CLIP-seq), functional rescue with mitochondria-targeted Ago2, and selective inhibition of the microRNA machinery in the cytoplasm. These findings unveil a positive function of microRNA in mitochondrial translation and suggest a highly coordinated myogenic program via miR-1-mediated translational stimulation in the mitochondria and repression in the cytoplasm.
LinkOut: [PMID: 25083871]
|
424 mmu-miR-149-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT005299 | Aicda | activation-induced cytidine deaminase | ![]() |
![]() |
2 | 1 | ||||||
MIRT014440 | Tspan7 | tetraspanin 7 | ![]() |
1 | 1 | |||||||
MIRT014441 | Ipcef1 | interaction protein for cytohesin exchange factors 1 | ![]() |
1 | 1 | |||||||
MIRT014442 | Macrod2 | MACRO domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT014443 | Zkscan8 | zinc finger with KRAB and SCAN domains 8 | ![]() |
1 | 1 | |||||||
MIRT014444 | Vat1 | vesicle amine transport 1 | ![]() |
1 | 1 | |||||||
MIRT014445 | Kif1b | kinesin family member 1B | ![]() |
1 | 1 | |||||||
MIRT014446 | Sema4a | sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A | ![]() |
1 | 1 | |||||||
MIRT014447 | Adamts16 | a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16 | ![]() |
1 | 1 | |||||||
MIRT014448 | Ddx3x | DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked | ![]() |
1 | 1 | |||||||
MIRT014449 | Lpcat1 | lysophosphatidylcholine acyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT014450 | Mob1a | MOB kinase activator 1A | ![]() |
1 | 1 | |||||||
MIRT014451 | Opcml | opioid binding protein/cell adhesion molecule-like | ![]() |
1 | 1 | |||||||
MIRT014452 | Papola | poly (A) polymerase alpha | ![]() |
1 | 1 | |||||||
MIRT014453 | Uba2 | ubiquitin-like modifier activating enzyme 2 | ![]() |
1 | 1 | |||||||
MIRT014454 | Tmem127 | transmembrane protein 127 | ![]() |
1 | 1 | |||||||
MIRT014455 | Fut9 | fucosyltransferase 9 | ![]() |
1 | 1 | |||||||
MIRT014456 | Zer1 | zyg-11 related, cell cycle regulator | ![]() |
1 | 1 | |||||||
MIRT014457 | Ptpn5 | protein tyrosine phosphatase, non-receptor type 5 | ![]() |
1 | 1 | |||||||
MIRT014458 | Ksr2 | kinase suppressor of ras 2 | ![]() |
1 | 1 | |||||||
MIRT014459 | Kcnj16 | potassium inwardly-rectifying channel, subfamily J, member 16 | ![]() |
1 | 1 | |||||||
MIRT014460 | Rgp1 | RAB6A GEF compex partner 1 | ![]() |
1 | 1 | |||||||
MIRT014461 | Nrgn | neurogranin | ![]() |
1 | 1 | |||||||
MIRT014462 | Elovl2 | elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 | ![]() |
1 | 1 | |||||||
MIRT014463 | Zfp280d | zinc finger protein 280D | ![]() |
1 | 1 | |||||||
MIRT014464 | Prnp | prion protein | ![]() |
1 | 1 | |||||||
MIRT014465 | Ube2n | ubiquitin-conjugating enzyme E2N | ![]() |
1 | 1 | |||||||
MIRT014466 | Nptn | neuroplastin | ![]() |
1 | 1 | |||||||
MIRT014467 | Twsg1 | twisted gastrulation BMP signaling modulator 1 | ![]() |
1 | 1 | |||||||
MIRT014468 | Prrc2b | proline-rich coiled-coil 2B | ![]() |
1 | 1 | |||||||
MIRT014469 | Sdcbp | syndecan binding protein | ![]() |
1 | 1 | |||||||
MIRT014470 | Aldoc | aldolase C, fructose-bisphosphate | ![]() |
1 | 1 | |||||||
MIRT014471 | Smad7 | SMAD family member 7 | ![]() |
1 | 1 | |||||||
MIRT014472 | Cdadc1 | cytidine and dCMP deaminase domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT014473 | Mfrp | membrane frizzled-related protein | ![]() |
1 | 1 | |||||||
MIRT014474 | Kit | KIT proto-oncogene receptor tyrosine kinase | ![]() |
1 | 1 | |||||||
MIRT014475 | Ubr4 | ubiquitin protein ligase E3 component n-recognin 4 | ![]() |
1 | 1 | |||||||
MIRT014476 | Slc10a4 | solute carrier family 10 (sodium/bile acid cotransporter family), member 4 | ![]() |
1 | 1 | |||||||
MIRT014477 | Il1rap | interleukin 1 receptor accessory protein | ![]() |
1 | 1 | |||||||
MIRT014478 | Rsrc2 | arginine/serine-rich coiled-coil 2 | ![]() |
1 | 1 | |||||||
MIRT014479 | Luc7l3 | LUC7-like 3 (S. cerevisiae) | ![]() |
1 | 1 | |||||||
MIRT014480 | Nkrf | NF-kappaB repressing factor | ![]() |
1 | 1 | |||||||
MIRT014481 | Lfng | LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase | ![]() |
1 | 1 | |||||||
MIRT014482 | Btbd19 | BTB (POZ) domain containing 19 | ![]() |
1 | 1 | |||||||
MIRT014483 | Fam49b | family with sequence similarity 49, member B | ![]() |
1 | 1 | |||||||
MIRT014484 | Emc10 | ER membrane protein complex subunit 10 | ![]() |
1 | 1 | |||||||
MIRT014485 | Tpp1 | tripeptidyl peptidase I | ![]() |
1 | 1 | |||||||
MIRT014486 | Ptgfrn | prostaglandin F2 receptor negative regulator | ![]() |
1 | 1 | |||||||
MIRT014487 | Zbtb9 | zinc finger and BTB domain containing 9 | ![]() |
1 | 1 | |||||||
MIRT014488 | Crtc1 | CREB regulated transcription coactivator 1 | ![]() |
1 | 1 | |||||||
MIRT014489 | Rab14 | RAB14, member RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT014490 | Add3 | adducin 3 (gamma) | ![]() |
1 | 1 | |||||||
MIRT014491 | Cul1 | cullin 1 | ![]() |
1 | 1 | |||||||
MIRT014492 | Tmtc1 | transmembrane and tetratricopeptide repeat containing 1 | ![]() |
1 | 1 | |||||||
MIRT014493 | Scn8a | sodium channel, voltage-gated, type VIII, alpha | ![]() |
1 | 1 | |||||||
MIRT014494 | Acot11 | acyl-CoA thioesterase 11 | ![]() |
1 | 1 | |||||||
MIRT014495 | Htr5a | 5-hydroxytryptamine (serotonin) receptor 5A | ![]() |
1 | 1 | |||||||
MIRT014496 | Ppp2r2c | protein phosphatase 2, regulatory subunit B, gamma | ![]() |
1 | 1 | |||||||
MIRT014497 | Ikbkg | inhibitor of kappaB kinase gamma | ![]() |
1 | 1 | |||||||
MIRT014498 | Bptf | bromodomain PHD finger transcription factor | ![]() |
1 | 1 | |||||||
MIRT014499 | Reep4 | receptor accessory protein 4 | ![]() |
1 | 1 | |||||||
MIRT014500 | Cxcl12 | chemokine (C-X-C motif) ligand 12 | ![]() |
1 | 1 | |||||||
MIRT014501 | Soat1 | sterol O-acyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT014502 | Gprc5b | G protein-coupled receptor, family C, group 5, member B | ![]() |
1 | 1 | |||||||
MIRT014503 | Btd | biotinidase | ![]() |
1 | 1 | |||||||
MIRT014504 | Ip6k1 | inositol hexaphosphate kinase 1 | ![]() |
1 | 1 | |||||||
MIRT014505 | Arl5a | ADP-ribosylation factor-like 5A | ![]() |
1 | 1 | |||||||
MIRT014506 | Plekhh2 | pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 | ![]() |
1 | 1 | |||||||
MIRT014507 | Tex264 | testis expressed gene 264 | ![]() |
1 | 1 | |||||||
MIRT014508 | Gpc1 | glypican 1 | ![]() |
1 | 1 | |||||||
MIRT014509 | Nol10 | nucleolar protein 10 | ![]() |
1 | 3 | |||||||
MIRT014510 | Elmo1 | engulfment and cell motility 1 | ![]() |
1 | 1 | |||||||
MIRT014511 | Shisa6 | shisa family member 6 | ![]() |
1 | 1 | |||||||
MIRT014512 | Zbtb39 | zinc finger and BTB domain containing 39 | ![]() |
1 | 1 | |||||||
MIRT014513 | Cdr2l | cerebellar degeneration-related protein 2-like | ![]() |
1 | 1 | |||||||
MIRT014514 | Aagab | alpha- and gamma-adaptin binding protein | ![]() |
1 | 1 | |||||||
MIRT014515 | Nmnat2 | nicotinamide nucleotide adenylyltransferase 2 | ![]() |
1 | 1 | |||||||
MIRT014516 | Acvr1b | activin A receptor, type 1B | ![]() |
1 | 1 | |||||||
MIRT014517 | Vamp2 | vesicle-associated membrane protein 2 | ![]() |
1 | 1 | |||||||
MIRT014518 | Ctnnd1 | catenin (cadherin associated protein), delta 1 | ![]() |
1 | 1 | |||||||
MIRT014519 | Dpp8 | dipeptidylpeptidase 8 | ![]() |
1 | 1 | |||||||
MIRT014520 | Lhx1 | LIM homeobox protein 1 | ![]() |
1 | 1 | |||||||
MIRT014521 | Spred3 | sprouty-related, EVH1 domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT014522 | Foxn3 | forkhead box N3 | ![]() |
1 | 1 | |||||||
MIRT014523 | Ska3 | spindle and kinetochore associated complex subunit 3 | ![]() |
1 | 1 | |||||||
MIRT014524 | Tnrc6b | trinucleotide repeat containing 6b | ![]() |
1 | 1 | |||||||
MIRT014525 | Setd7 | SET domain containing (lysine methyltransferase) 7 | ![]() |
1 | 1 | |||||||
MIRT014526 | Tcta | T cell leukemia translocation altered gene | ![]() |
1 | 1 | |||||||
MIRT014527 | Sez6 | seizure related gene 6 | ![]() |
1 | 1 | |||||||
MIRT014528 | Pafah1b2 | platelet-activating factor acetylhydrolase, isoform 1b, subunit 2 | ![]() |
1 | 1 | |||||||
MIRT014529 | Polr3f | polymerase (RNA) III (DNA directed) polypeptide F | ![]() |
1 | 1 | |||||||
MIRT014530 | Kifap3 | kinesin-associated protein 3 | ![]() |
1 | 1 | |||||||
MIRT014531 | Arhgef10 | Rho guanine nucleotide exchange factor (GEF) 10 | ![]() |
1 | 1 | |||||||
MIRT014532 | B3galt5 | UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 | ![]() |
1 | 1 | |||||||
MIRT014533 | Kcnj3 | potassium inwardly-rectifying channel, subfamily J, member 3 | ![]() |
1 | 1 | |||||||
MIRT014534 | Lpin1 | lipin 1 | ![]() |
1 | 1 | |||||||
MIRT014535 | Syt6 | synaptotagmin VI | ![]() |
1 | 1 | |||||||
MIRT014536 | Ephb3 | Eph receptor B3 | ![]() |
1 | 5 | |||||||
MIRT014537 | Dbx2 | developing brain homeobox 2 | ![]() |
1 | 1 | |||||||
MIRT014538 | Vldlr | very low density lipoprotein receptor | ![]() |
1 | 1 | |||||||
MIRT014539 | Sema4g | sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G | ![]() |
1 | 1 | |||||||
MIRT014540 | BC034090 | cDNA sequence BC034090 | ![]() |
1 | 1 | |||||||
MIRT014541 | Sash1 | SAM and SH3 domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT014542 | Ttc3 | tetratricopeptide repeat domain 3 | ![]() |
1 | 1 | |||||||
MIRT014543 | Flrt1 | fibronectin leucine rich transmembrane protein 1 | ![]() |
1 | 1 | |||||||
MIRT014544 | Hnrnpa1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
1 | 1 | |||||||
MIRT014545 | Rdx | radixin | ![]() |
1 | 1 | |||||||
MIRT014546 | Mapk9 | mitogen-activated protein kinase 9 | ![]() |
1 | 1 | |||||||
MIRT014547 | Grm1 | glutamate receptor, metabotropic 1 | ![]() |
1 | 1 | |||||||
MIRT014548 | Mvb12b | multivesicular body subunit 12B | ![]() |
1 | 1 | |||||||
MIRT014549 | Cpox | coproporphyrinogen oxidase | ![]() |
1 | 1 | |||||||
MIRT014550 | Gtf2i | general transcription factor II I | ![]() |
1 | 1 | |||||||
MIRT014551 | Tinf2 | Terf1 (TRF1)-interacting nuclear factor 2 | ![]() |
1 | 1 | |||||||
MIRT014552 | Snhg11 | small nucleolar RNA host gene 11 | ![]() |
1 | 1 | |||||||
MIRT014553 | Rragc | Ras-related GTP binding C | ![]() |
1 | 1 | |||||||
MIRT014554 | Pde7b | phosphodiesterase 7B | ![]() |
1 | 1 | |||||||
MIRT014555 | Gab1 | growth factor receptor bound protein 2-associated protein 1 | ![]() |
1 | 1 | |||||||
MIRT014556 | Fabp7 | fatty acid binding protein 7, brain | ![]() |
1 | 1 | |||||||
MIRT014557 | Gprc5c | G protein-coupled receptor, family C, group 5, member C | ![]() |
1 | 1 | |||||||
MIRT014558 | Furin | furin (paired basic amino acid cleaving enzyme) | ![]() |
1 | 1 | |||||||
MIRT014559 | Rnf144a | ring finger protein 144A | ![]() |
1 | 1 | |||||||
MIRT014560 | Cant1 | calcium activated nucleotidase 1 | ![]() |
1 | 1 | |||||||
MIRT014561 | Nrep | neuronal regeneration related protein | ![]() |
1 | 1 | |||||||
MIRT014562 | Il6st | interleukin 6 signal transducer | ![]() |
1 | 1 | |||||||
MIRT014563 | F3 | coagulation factor III | ![]() |
1 | 1 | |||||||
MIRT014564 | 1190002N15Rik | RIKEN cDNA 1190002N15 gene | ![]() |
1 | 1 | |||||||
MIRT014565 | Mdm4 | transformed mouse 3T3 cell double minute 4 | ![]() |
1 | 1 | |||||||
MIRT014566 | Lmbrd1 | LMBR1 domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT014567 | Sf3b3 | splicing factor 3b, subunit 3 | ![]() |
1 | 1 | |||||||
MIRT014568 | Ptprd | protein tyrosine phosphatase, receptor type, D | ![]() |
1 | 1 | |||||||
MIRT014569 | Ikbkap | inhibitor of kappa light polypeptide enhancer in B cells, kinase complex-associated protein | ![]() |
1 | 1 | |||||||
MIRT014570 | Slc7a1 | solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 | ![]() |
1 | 1 | |||||||
MIRT014571 | Camta1 | calmodulin binding transcription activator 1 | ![]() |
1 | 1 | |||||||
MIRT014572 | Irak1 | interleukin-1 receptor-associated kinase 1 | ![]() |
1 | 1 | |||||||
MIRT014573 | Pccb | propionyl Coenzyme A carboxylase, beta polypeptide | ![]() |
1 | 1 | |||||||
MIRT014574 | Neto2 | neuropilin (NRP) and tolloid (TLL)-like 2 | ![]() |
1 | 1 | |||||||
MIRT014575 | Map3k14 | mitogen-activated protein kinase kinase kinase 14 | ![]() |
1 | 1 | |||||||
MIRT014576 | Scn4b | sodium channel, type IV, beta | ![]() |
1 | 1 | |||||||
MIRT014577 | Trib2 | tribbles pseudokinase 2 | ![]() |
1 | 1 | |||||||
MIRT014578 | Git2 | G protein-coupled receptor kinase-interactor 2 | ![]() |
1 | 1 | |||||||
MIRT014579 | Reep1 | receptor accessory protein 1 | ![]() |
1 | 1 | |||||||
MIRT014580 | Atg5 | autophagy related 5 | ![]() |
1 | 1 | |||||||
MIRT014581 | Gng7 | guanine nucleotide binding protein (G protein), gamma 7 | ![]() |
1 | 1 | |||||||
MIRT014582 | Fem1b | feminization 1 homolog b (C. elegans) | ![]() |
1 | 1 | |||||||
MIRT014583 | Trak2 | trafficking protein, kinesin binding 2 | ![]() |
1 | 1 | |||||||
MIRT014584 | Gnao1 | guanine nucleotide binding protein, alpha O | ![]() |
1 | 1 | |||||||
MIRT014585 | Dpy19l3 | dpy-19-like 3 (C. elegans) | ![]() |
1 | 1 | |||||||
MIRT014586 | Ptpn12 | protein tyrosine phosphatase, non-receptor type 12 | ![]() |
1 | 1 | |||||||
MIRT014587 | Wdr1 | WD repeat domain 1 | ![]() |
1 | 1 | |||||||
MIRT014588 | Pofut1 | protein O-fucosyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT014589 | Usp48 | ubiquitin specific peptidase 48 | ![]() |
1 | 1 | |||||||
MIRT014590 | Cxadr | coxsackie virus and adenovirus receptor | ![]() |
1 | 1 | |||||||
MIRT014591 | Lrrc58 | leucine rich repeat containing 58 | ![]() |
1 | 1 | |||||||
MIRT014592 | R3hdm1 | R3H domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT014593 | 4933426M11Rik | sushi domain containing 6 | ![]() |
1 | 1 | |||||||
MIRT014594 | Med10 | mediator complex subunit 10 | ![]() |
1 | 1 | |||||||
MIRT014595 | Sptbn2 | spectrin beta, non-erythrocytic 2 | ![]() |
1 | 1 | |||||||
MIRT014596 | 8430419L09Rik | family with sequence similarity 234, member B | ![]() |
1 | 1 | |||||||
MIRT014597 | Kcnc1 | potassium voltage gated channel, Shaw-related subfamily, member 1 | ![]() |
1 | 1 | |||||||
MIRT014598 | Dgcr2 | DiGeorge syndrome critical region gene 2 | ![]() |
1 | 1 | |||||||
MIRT014599 | Mtmr12 | myotubularin related protein 12 | ![]() |
1 | 1 | |||||||
MIRT014600 | Txnip | thioredoxin interacting protein | ![]() |
1 | 1 | |||||||
MIRT014601 | Slc39a3 | solute carrier family 39 (zinc transporter), member 3 | ![]() |
1 | 1 | |||||||
MIRT014602 | Itsn1 | intersectin 1 (SH3 domain protein 1A) | ![]() |
1 | 1 | |||||||
MIRT014603 | Efcab14 | EF-hand calcium binding domain 14 | ![]() |
1 | 1 | |||||||
MIRT014604 | Csnk1a1 | casein kinase 1, alpha 1 | ![]() |
1 | 1 | |||||||
MIRT014605 | Gria1 | glutamate receptor, ionotropic, AMPA1 (alpha 1) | ![]() |
1 | 1 | |||||||
MIRT014606 | Zfp605 | zinc finger protein 605 | ![]() |
1 | 1 | |||||||
MIRT014607 | Cnot6 | CCR4-NOT transcription complex, subunit 6 | ![]() |
1 | 1 | |||||||
MIRT014608 | Paqr4 | progestin and adipoQ receptor family member IV | ![]() |
1 | 1 | |||||||
MIRT014609 | Unc5b | unc-5 netrin receptor B | ![]() |
1 | 1 | |||||||
MIRT014610 | Hecw1 | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 | ![]() |
1 | 1 | |||||||
MIRT014611 | Zcchc4 | zinc finger, CCHC domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT014612 | Fam102a | family with sequence similarity 102, member A | ![]() |
1 | 1 | |||||||
MIRT014613 | Plekha2 | pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 | ![]() |
1 | 1 | |||||||
MIRT014614 | Tmem135 | transmembrane protein 135 | ![]() |
1 | 1 | |||||||
MIRT014615 | Tmem8b | transmembrane protein 8B | ![]() |
1 | 1 | |||||||
MIRT014616 | Ccser2 | coiled-coil serine rich 2 | ![]() |
1 | 1 | |||||||
MIRT014617 | Sdc3 | syndecan 3 | ![]() |
1 | 1 | |||||||
MIRT014618 | Braf | Braf transforming gene | ![]() |
1 | 1 | |||||||
MIRT014619 | Pno1 | partner of NOB1 homolog | ![]() |
1 | 1 | |||||||
MIRT014620 | Bahcc1 | BAH domain and coiled-coil containing 1 | ![]() |
1 | 1 | |||||||
MIRT014621 | Gramd1b | GRAM domain containing 1B | ![]() |
1 | 1 | |||||||
MIRT014622 | Prkab1 | protein kinase, AMP-activated, beta 1 non-catalytic subunit | ![]() |
1 | 1 | |||||||
MIRT014623 | Plec | plectin | ![]() |
1 | 1 | |||||||
MIRT014624 | Rap2a | RAS related protein 2a | ![]() |
1 | 1 | |||||||
MIRT014625 | Rhbdd2 | rhomboid domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT014626 | Sertad2 | SERTA domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT014627 | Entpd7 | ectonucleoside triphosphate diphosphohydrolase 7 | ![]() |
1 | 1 | |||||||
MIRT014628 | Efr3b | EFR3 homolog B | ![]() |
1 | 1 | |||||||
MIRT014629 | Gabrb2 | gamma-aminobutyric acid (GABA) A receptor, subunit beta 2 | ![]() |
1 | 1 | |||||||
MIRT014630 | Atp2a2 | ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 | ![]() |
1 | 1 | |||||||
MIRT014631 | Fnbp1 | formin binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT014632 | Dab2ip | disabled 2 interacting protein | ![]() |
1 | 1 | |||||||
MIRT014633 | Snx27 | sorting nexin family member 27 | ![]() |
1 | 1 | |||||||
MIRT014634 | Hmg20a | high mobility group 20A | ![]() |
1 | 1 | |||||||
MIRT014635 | Rab3gap1 | RAB3 GTPase activating protein subunit 1 | ![]() |
1 | 1 | |||||||
MIRT014636 | Epb4.1l1 | erythrocyte membrane protein band 4.1 like 1 | ![]() |
1 | 1 | |||||||
MIRT014637 | Epha4 | Eph receptor A4 | ![]() |
1 | 1 | |||||||
MIRT014638 | Bach1 | BTB and CNC homology 1, basic leucine zipper transcription factor 1 | ![]() |
1 | 1 | |||||||
MIRT014639 | Rab6b | RAB6B, member RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT014640 | 6030458C11Rik | RIKEN cDNA 6030458C11 gene | ![]() |
1 | 1 | |||||||
MIRT014641 | Zbtb4 | zinc finger and BTB domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT014642 | Cbx5 | chromobox 5 | ![]() |
1 | 1 | |||||||
MIRT014643 | Eif5a | eukaryotic translation initiation factor 5A | ![]() |
1 | 1 | |||||||
MIRT014644 | Slc37a3 | solute carrier family 37 (glycerol-3-phosphate transporter), member 3 | ![]() |
1 | 1 | |||||||
MIRT014645 | Rcc2 | regulator of chromosome condensation 2 | ![]() |
1 | 1 | |||||||
MIRT014646 | Caln1 | calneuron 1 | ![]() |
1 | 1 | |||||||
MIRT014647 | Frem2 | Fras1 related extracellular matrix protein 2 | ![]() |
1 | 1 | |||||||
MIRT014648 | Clp1 | CLP1, cleavage and polyadenylation factor I subunit | ![]() |
1 | 1 | |||||||
MIRT014649 | Ablim1 | actin-binding LIM protein 1 | ![]() |
1 | 1 | |||||||
MIRT014650 | Krba1 | KRAB-A domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT014651 | Sec14l1 | SEC14-like lipid binding 1 | ![]() |
1 | 1 | |||||||
MIRT014652 | Ywhab | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide | ![]() |
1 | 1 | |||||||
MIRT014653 | Bcas3 | breast carcinoma amplified sequence 3 | ![]() |
1 | 1 | |||||||
MIRT014654 | Celf5 | CUGBP, Elav-like family member 5 | ![]() |
1 | 1 | |||||||
MIRT014655 | Atad2 | ATPase family, AAA domain containing 2 | ![]() |
1 | 1 | |||||||
MIRT014656 | Nptx1 | neuronal pentraxin 1 | ![]() |
1 | 1 | |||||||
MIRT014657 | Mmp15 | matrix metallopeptidase 15 | ![]() |
1 | 1 | |||||||
MIRT014658 | Crkl | v-crk avian sarcoma virus CT10 oncogene homolog-like | ![]() |
1 | 1 | |||||||
MIRT014659 | Pigq | phosphatidylinositol glycan anchor biosynthesis, class Q | ![]() |
1 | 1 | |||||||
MIRT014660 | Akt1 | thymoma viral proto-oncogene 1 | ![]() |
1 | 1 | |||||||
MIRT014661 | Zmat3 | zinc finger matrin type 3 | ![]() |
1 | 1 | |||||||
MIRT014662 | Cds2 | CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 | ![]() |
1 | 1 | |||||||
MIRT014663 | Nhsl1 | NHS-like 1 | ![]() |
1 | 1 | |||||||
MIRT014664 | Poglut1 | protein O-glucosyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT014665 | Slc35e2 | solute carrier family 35, member E2 | ![]() |
1 | 1 | |||||||
MIRT014666 | Cep95 | centrosomal protein 95 | ![]() |
1 | 1 | |||||||
MIRT014667 | 2510039O18Rik | RIKEN cDNA 2510039O18 gene | ![]() |
1 | 1 | |||||||
MIRT014668 | Dhcr24 | 24-dehydrocholesterol reductase | ![]() |
1 | 1 | |||||||
MIRT014669 | Arid4b | AT rich interactive domain 4B (RBP1-like) | ![]() |
1 | 1 | |||||||
MIRT014670 | Iws1 | IWS1, SUPT6 interacting protein | ![]() |
1 | 1 | |||||||
MIRT014671 | Ifngr2 | interferon gamma receptor 2 | ![]() |
1 | 1 | |||||||
MIRT014672 | Zfp251 | zinc finger protein 251 | ![]() |
1 | 1 | |||||||
MIRT014673 | Med26 | mediator complex subunit 26 | ![]() |
1 | 1 | |||||||
MIRT014674 | Reck | reversion-inducing-cysteine-rich protein with kazal motifs | ![]() |
1 | 1 | |||||||
MIRT014675 | Bicd2 | bicaudal D homolog 2 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT014676 | Tmbim6 | transmembrane BAX inhibitor motif containing 6 | ![]() |
1 | 1 | |||||||
MIRT014677 | Cdk13 | cyclin-dependent kinase 13 | ![]() |
1 | 1 | |||||||
MIRT014678 | Rapgef4 | Rap guanine nucleotide exchange factor (GEF) 4 | ![]() |
1 | 1 | |||||||
MIRT014679 | Trank1 | tetratricopeptide repeat and ankyrin repeat containing 1 | ![]() |
1 | 1 | |||||||
MIRT014680 | Stam2 | signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 | ![]() |
1 | 1 | |||||||
MIRT014681 | Ppp1r1a | protein phosphatase 1, regulatory (inhibitor) subunit 1A | ![]() |
1 | 1 | |||||||
MIRT014682 | Thsd4 | thrombospondin, type I, domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT014683 | Cadm2 | cell adhesion molecule 2 | ![]() |
1 | 1 | |||||||
MIRT014684 | Slc6a17 | solute carrier family 6 (neurotransmitter transporter), member 17 | ![]() |
1 | 1 | |||||||
MIRT014685 | Sestd1 | SEC14 and spectrin domains 1 | ![]() |
1 | 1 | |||||||
MIRT014686 | Tbc1d20 | TBC1 domain family, member 20 | ![]() |
1 | 1 | |||||||
MIRT014687 | Per2 | period circadian clock 2 | ![]() |
1 | 1 | |||||||
MIRT014688 | Ugcg | UDP-glucose ceramide glucosyltransferase | ![]() |
1 | 1 | |||||||
MIRT014689 | Ric3 | RIC3 acetylcholine receptor chaperone | ![]() |
1 | 1 | |||||||
MIRT014690 | Usp10 | ubiquitin specific peptidase 10 | ![]() |
1 | 1 | |||||||
MIRT014691 | Macf1 | microtubule-actin crosslinking factor 1 | ![]() |
1 | 1 | |||||||
MIRT014692 | Adck4 | coenzyme Q8B | ![]() |
1 | 1 | |||||||
MIRT014693 | Tef | thyrotroph embryonic factor | ![]() |
1 | 1 | |||||||
MIRT014694 | Slc24a3 | solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 | ![]() |
1 | 1 | |||||||
MIRT014695 | Ccdc43 | coiled-coil domain containing 43 | ![]() |
1 | 1 | |||||||
MIRT014696 | Nf1 | neurofibromin 1 | ![]() |
1 | 1 | |||||||
MIRT014697 | Hip1 | huntingtin interacting protein 1 | ![]() |
1 | 1 | |||||||
MIRT014698 | Ptpn11 | protein tyrosine phosphatase, non-receptor type 11 | ![]() |
1 | 1 | |||||||
MIRT014699 | Wnk1 | WNK lysine deficient protein kinase 1 | ![]() |
1 | 1 | |||||||
MIRT014700 | Lmtk2 | lemur tyrosine kinase 2 | ![]() |
1 | 1 | |||||||
MIRT014701 | Synj1 | synaptojanin 1 | ![]() |
1 | 1 | |||||||
MIRT014702 | Clmp | CXADR-like membrane protein | ![]() |
1 | 1 | |||||||
MIRT014703 | Slc22a23 | solute carrier family 22, member 23 | ![]() |
1 | 1 | |||||||
MIRT014704 | Otud7b | OTU domain containing 7B | ![]() |
1 | 1 | |||||||
MIRT014705 | Slc1a1 | solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 | ![]() |
1 | 1 | |||||||
MIRT014706 | Astn1 | astrotactin 1 | ![]() |
1 | 1 | |||||||
MIRT014707 | Stk38 | serine/threonine kinase 38 | ![]() |
1 | 1 | |||||||
MIRT014708 | BC026590 | family with sequence similarity 206, member A | ![]() |
1 | 1 | |||||||
MIRT014709 | Fam102b | family with sequence similarity 102, member B | ![]() |
1 | 1 | |||||||
MIRT014710 | Rictor | RPTOR independent companion of MTOR, complex 2 | ![]() |
1 | 1 | |||||||
MIRT014711 | Ntrk2 | neurotrophic tyrosine kinase, receptor, type 2 | ![]() |
1 | 1 | |||||||
MIRT014712 | Phka1 | phosphorylase kinase alpha 1 | ![]() |
1 | 1 | |||||||
MIRT014713 | Gpr89 | G protein-coupled receptor 89 | ![]() |
1 | 1 | |||||||
MIRT014714 | Cdk19 | cyclin-dependent kinase 19 | ![]() |
1 | 1 | |||||||
MIRT014715 | Kansl3 | KAT8 regulatory NSL complex subunit 3 | ![]() |
1 | 1 | |||||||
MIRT014716 | Kcnk6 | potassium inwardly-rectifying channel, subfamily K, member 6 | ![]() |
1 | 2 | |||||||
MIRT014717 | Rnf169 | ring finger protein 169 | ![]() |
1 | 1 | |||||||
MIRT014718 | Sart1 | squamous cell carcinoma antigen recognized by T cells 1 | ![]() |
1 | 1 | |||||||
MIRT014719 | Ralgapa2 | Ral GTPase activating protein, alpha subunit 2 (catalytic) | ![]() |
1 | 1 | |||||||
MIRT014720 | Fam219a | family with sequence similarity 219, member A | ![]() |
1 | 1 | |||||||
MIRT014721 | Antxr1 | anthrax toxin receptor 1 | ![]() |
1 | 1 | |||||||
MIRT014722 | Scn1a | sodium channel, voltage-gated, type I, alpha | ![]() |
1 | 1 | |||||||
MIRT014723 | Cog3 | component of oligomeric golgi complex 3 | ![]() |
1 | 1 | |||||||
MIRT014724 | Scamp5 | secretory carrier membrane protein 5 | ![]() |
1 | 1 | |||||||
MIRT014725 | Zfyve27 | zinc finger, FYVE domain containing 27 | ![]() |
1 | 1 | |||||||
MIRT014726 | Mecp2 | methyl CpG binding protein 2 | ![]() |
1 | 1 | |||||||
MIRT014727 | Gpr17 | G protein-coupled receptor 17 | ![]() |
1 | 1 | |||||||
MIRT014728 | Dusp16 | dual specificity phosphatase 16 | ![]() |
1 | 1 | |||||||
MIRT014729 | Nt5dc3 | 5'-nucleotidase domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT014730 | Cbx1 | chromobox 1 | ![]() |
1 | 1 | |||||||
MIRT014731 | 2700089E24Rik | small integral membrane protein 10 like 1 | ![]() |
1 | 1 | |||||||
MIRT014732 | Syt2 | synaptotagmin II | ![]() |
1 | 1 | |||||||
MIRT014733 | Sik3 | SIK family kinase 3 | ![]() |
1 | 1 | |||||||
MIRT014734 | Asxl2 | additional sex combs like 2 (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT014735 | Fkbp1b | FK506 binding protein 1b | ![]() |
1 | 1 | |||||||
MIRT014736 | Adcy1 | adenylate cyclase 1 | ![]() |
1 | 1 | |||||||
MIRT014737 | Nfix | nuclear factor I/X | ![]() |
1 | 1 | |||||||
MIRT014738 | Pea15a | phosphoprotein enriched in astrocytes 15A | ![]() |
1 | 1 | |||||||
MIRT014739 | Nrp2 | neuropilin 2 | ![]() |
1 | 1 | |||||||
MIRT014740 | N4bp1 | NEDD4 binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT014741 | Elfn1 | leucine rich repeat and fibronectin type III, extracellular 1 | ![]() |
1 | 1 | |||||||
MIRT014742 | Mtch1 | mitochondrial carrier 1 | ![]() |
1 | 1 | |||||||
MIRT014743 | Atad3a | ATPase family, AAA domain containing 3A | ![]() |
1 | 1 | |||||||
MIRT014744 | St8sia3 | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 | ![]() |
1 | 1 | |||||||
MIRT014745 | Ulk1 | unc-51 like kinase 1 | ![]() |
1 | 1 | |||||||
MIRT014746 | Zfp354c | zinc finger protein 354C | ![]() |
1 | 1 | |||||||
MIRT014747 | Rsbn1 | rosbin, round spermatid basic protein 1 | ![]() |
1 | 1 | |||||||
MIRT014748 | Calr | calreticulin | ![]() |
1 | 1 | |||||||
MIRT014749 | Tmod2 | tropomodulin 2 | ![]() |
1 | 1 | |||||||
MIRT014750 | Nedd4 | neural precursor cell expressed, developmentally down-regulated 4 | ![]() |
1 | 1 | |||||||
MIRT014751 | Coa3 | cytochrome C oxidase assembly factor 3 | ![]() |
1 | 1 | |||||||
MIRT014752 | Pdgfrb | platelet derived growth factor receptor, beta polypeptide | ![]() |
1 | 1 | |||||||
MIRT014753 | Slc30a4 | solute carrier family 30 (zinc transporter), member 4 | ![]() |
1 | 1 | |||||||
MIRT014754 | Adar | adenosine deaminase, RNA-specific | ![]() |
1 | 1 | |||||||
MIRT014755 | Ywhag | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | ![]() |
1 | 1 | |||||||
MIRT014756 | Scd2 | stearoyl-Coenzyme A desaturase 2 | ![]() |
1 | 1 | |||||||
MIRT014757 | Zfp445 | zinc finger protein 445 | ![]() |
1 | 1 | |||||||
MIRT014758 | Rfx5 | regulatory factor X, 5 (influences HLA class II expression) | ![]() |
1 | 1 | |||||||
MIRT014759 | Igfbp7 | insulin-like growth factor binding protein 7 | ![]() |
1 | 1 | |||||||
MIRT014760 | Tmem109 | transmembrane protein 109 | ![]() |
1 | 1 | |||||||
MIRT014761 | Fem1c | fem-1 homolog c (C.elegans) | ![]() |
1 | 1 | |||||||
MIRT014762 | Mmp17 | matrix metallopeptidase 17 | ![]() |
1 | 1 | |||||||
MIRT014763 | Gxylt1 | glucoside xylosyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT014764 | Cbln1 | cerebellin 1 precursor protein | ![]() |
1 | 1 | |||||||
MIRT014765 | Ube2i | ubiquitin-conjugating enzyme E2I | ![]() |
1 | 1 | |||||||
MIRT014766 | Trp53inp2 | transformation related protein 53 inducible nuclear protein 2 | ![]() |
1 | 1 | |||||||
MIRT014767 | Efna5 | ephrin A5 | ![]() |
1 | 1 | |||||||
MIRT014768 | Gpr68 | G protein-coupled receptor 68 | ![]() |
1 | 1 | |||||||
MIRT014769 | Rad51c | RAD51 paralog C | ![]() |
1 | 1 | |||||||
MIRT014770 | Camk1g | calcium/calmodulin-dependent protein kinase I gamma | ![]() |
1 | 1 | |||||||
MIRT014771 | Entpd6 | ectonucleoside triphosphate diphosphohydrolase 6 | ![]() |
1 | 1 | |||||||
MIRT014772 | Osbpl8 | oxysterol binding protein-like 8 | ![]() |
1 | 1 | |||||||
MIRT014773 | Inpp5b | inositol polyphosphate-5-phosphatase B | ![]() |
1 | 1 | |||||||
MIRT014774 | Hspg2 | perlecan (heparan sulfate proteoglycan 2) | ![]() |
1 | 1 | |||||||
MIRT014775 | Ahcyl1 | S-adenosylhomocysteine hydrolase-like 1 | ![]() |
1 | 1 | |||||||
MIRT014776 | Zcchc24 | zinc finger, CCHC domain containing 24 | ![]() |
1 | 1 | |||||||
MIRT014777 | Syt11 | synaptotagmin XI | ![]() |
1 | 1 | |||||||
MIRT014778 | Tmem2 | transmembrane protein 2 | ![]() |
1 | 1 | |||||||
MIRT014779 | Bsdc1 | BSD domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT014780 | Srrm2 | serine/arginine repetitive matrix 2 | ![]() |
1 | 1 | |||||||
MIRT014781 | Ank2 | ankyrin 2, brain | ![]() |
1 | 1 | |||||||
MIRT014782 | Slc15a4 | solute carrier family 15, member 4 | ![]() |
1 | 1 | |||||||
MIRT014783 | Tomm70a | translocase of outer mitochondrial membrane 70 homolog A (yeast) | ![]() |
1 | 1 | |||||||
MIRT014784 | Mid2 | midline 2 | ![]() |
1 | 1 | |||||||
MIRT014785 | Zbtb41 | zinc finger and BTB domain containing 41 | ![]() |
1 | 1 | |||||||
MIRT014786 | Nlgn3 | neuroligin 3 | ![]() |
1 | 1 | |||||||
MIRT014787 | Aldh9a1 | aldehyde dehydrogenase 9, subfamily A1 | ![]() |
1 | 1 | |||||||
MIRT014788 | Slc6a6 | solute carrier family 6 (neurotransmitter transporter, taurine), member 6 | ![]() |
1 | 1 | |||||||
MIRT014789 | Slc30a7 | solute carrier family 30 (zinc transporter), member 7 | ![]() |
1 | 1 | |||||||
MIRT014790 | Lmf2 | lipase maturation factor 2 | ![]() |
1 | 1 | |||||||
MIRT014791 | Slc44a2 | solute carrier family 44, member 2 | ![]() |
1 | 1 | |||||||
MIRT014792 | Dazap2 | DAZ associated protein 2 | ![]() |
1 | 1 | |||||||
MIRT014793 | Capns1 | calpain, small subunit 1 | ![]() |
1 | 1 | |||||||
MIRT014794 | Nr1d2 | nuclear receptor subfamily 1, group D, member 2 | ![]() |
1 | 1 | |||||||
MIRT014795 | Pnkd | paroxysmal nonkinesiogenic dyskinesia | ![]() |
1 | 1 | |||||||
MIRT014796 | Rnf165 | ring finger protein 165 | ![]() |
1 | 1 | |||||||
MIRT014797 | Myo10 | myosin X | ![]() |
1 | 1 | |||||||
MIRT014798 | Tnrc6a | trinucleotide repeat containing 6a | ![]() |
1 | 1 | |||||||
MIRT014799 | Mbp | myelin basic protein | ![]() |
1 | 1 | |||||||
MIRT014800 | Hic2 | hypermethylated in cancer 2 | ![]() |
1 | 1 | |||||||
MIRT014801 | Rap1gap2 | RAP1 GTPase activating protein 2 | ![]() |
1 | 1 | |||||||
MIRT014802 | Nfia | nuclear factor I/A | ![]() |
1 | 1 | |||||||
MIRT014803 | Sept8 | septin 8 | ![]() |
1 | 1 | |||||||
MIRT014804 | Elf2 | E74-like factor 2 | ![]() |
1 | 1 | |||||||
MIRT014805 | Zzz3 | zinc finger, ZZ domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT014806 | Edem1 | ER degradation enhancer, mannosidase alpha-like 1 | ![]() |
1 | 1 | |||||||
MIRT014807 | Atrn | attractin | ![]() |
1 | 1 | |||||||
MIRT014808 | Csdc2 | cold shock domain containing C2, RNA binding | ![]() |
1 | 1 | |||||||
MIRT014809 | Timp3 | tissue inhibitor of metalloproteinase 3 | ![]() |
1 | 1 | |||||||
MIRT014810 | Ddit4 | DNA-damage-inducible transcript 4 | ![]() |
1 | 1 | |||||||
MIRT014811 | Dok1 | docking protein 1 | ![]() |
1 | 1 | |||||||
MIRT014812 | Slc43a2 | solute carrier family 43, member 2 | ![]() |
1 | 1 | |||||||
MIRT014813 | Zkscan1 | zinc finger with KRAB and SCAN domains 1 | ![]() |
1 | 1 | |||||||
MIRT014814 | Ptpn4 | protein tyrosine phosphatase, non-receptor type 4 | ![]() |
1 | 1 | |||||||
MIRT014815 | Ssbp2 | single-stranded DNA binding protein 2 | ![]() |
1 | 1 | |||||||
MIRT014816 | Igfbp5 | insulin-like growth factor binding protein 5 | ![]() |
1 | 1 | |||||||
MIRT014817 | Naa40 | N(alpha)-acetyltransferase 40, NatD catalytic subunit | ![]() |
1 | 1 | |||||||
MIRT014818 | Elovl5 | ELOVL family member 5, elongation of long chain fatty acids (yeast) | ![]() |
1 | 1 | |||||||
MIRT014819 | Ttyh3 | tweety family member 3 | ![]() |
1 | 1 | |||||||
MIRT014820 | Arc | activity regulated cytoskeletal-associated protein | ![]() |
1 | 1 | |||||||
MIRT014821 | Kcnj10 | potassium inwardly-rectifying channel, subfamily J, member 10 | ![]() |
1 | 1 | |||||||
MIRT014822 | Gm608 | upstream transcription factor family member 3 | ![]() |
1 | 1 | |||||||
MIRT014823 | Itpa | inosine triphosphatase (nucleoside triphosphate pyrophosphatase) | ![]() |
1 | 1 | |||||||
MIRT014824 | Slc6a8 | solute carrier family 6 (neurotransmitter transporter, creatine), member 8 | ![]() |
1 | 1 | |||||||
MIRT014825 | Ppap2b | phospholipid phosphatase 3 | ![]() |
1 | 1 | |||||||
MIRT014826 | Prickle2 | prickle planar cell polarity protein 2 | ![]() |
1 | 1 | |||||||
MIRT014827 | Wwtr1 | WW domain containing transcription regulator 1 | ![]() |
1 | 1 | |||||||
MIRT014828 | Ncoa5 | nuclear receptor coactivator 5 | ![]() |
1 | 1 | |||||||
MIRT014829 | Brap | BRCA1 associated protein | ![]() |
1 | 1 | |||||||
MIRT014830 | Tnks | tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase | ![]() |
1 | 1 | |||||||
MIRT014831 | Plxna2 | plexin A2 | ![]() |
1 | 1 | |||||||
MIRT014832 | Camk2g | calcium/calmodulin-dependent protein kinase II gamma | ![]() |
1 | 1 | |||||||
MIRT014833 | Klf7 | Kruppel-like factor 7 (ubiquitous) | ![]() |
1 | 1 | |||||||
MIRT014834 | Rnf24 | ring finger protein 24 | ![]() |
1 | 1 | |||||||
MIRT014835 | Fbxl16 | F-box and leucine-rich repeat protein 16 | ![]() |
1 | 4 | |||||||
MIRT014836 | Gria3 | glutamate receptor, ionotropic, AMPA3 (alpha 3) | ![]() |
1 | 1 | |||||||
MIRT579316 | BC003965 | cDNA sequence BC003965 | ![]() |
1 | 2 | |||||||
MIRT579432 | Adsl | adenylosuccinate lyase | ![]() |
1 | 1 | |||||||
MIRT579655 | 2010012O05Rik | BLOC-1 related complex subunit 7 | ![]() |
1 | 3 | |||||||
MIRT582543 | Map3k7 | mitogen-activated protein kinase kinase kinase 7 | ![]() |
1 | 1 | |||||||
MIRT585596 | Tns4 | tensin 4 | ![]() |
1 | 1 | |||||||
MIRT585774 | Speer4b | spermatogenesis associated glutamate (E)-rich protein 4B | ![]() |
1 | 1 | |||||||
MIRT586832 | Il5ra | interleukin 5 receptor, alpha | ![]() |
1 | 1 | |||||||
MIRT587885 | BC030476 | glutamate rich 5 | ![]() |
1 | 2 | |||||||
MIRT588274 | Sppl2a | signal peptide peptidase like 2A | ![]() |
1 | 1 | |||||||
MIRT588313 | Zyg11b | zyg-ll family member B, cell cycle regulator | ![]() |
1 | 2 | |||||||
MIRT588445 | Ybx1 | Y box protein 1 | ![]() |
1 | 2 | |||||||
MIRT591825 | Mapkap1 | mitogen-activated protein kinase associated protein 1 | ![]() |
1 | 2 | |||||||
MIRT592956 | Zdhhc3 | zinc finger, DHHC domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT593007 | Axl | AXL receptor tyrosine kinase | ![]() |
1 | 1 | |||||||
MIRT593463 | Mylip | myosin regulatory light chain interacting protein | ![]() |
1 | 2 | |||||||
MIRT593797 | Mettl2 | methyltransferase like 2 | ![]() |
1 | 1 | |||||||
MIRT594568 | 2900026A02Rik | RIKEN cDNA 2900026A02 gene | ![]() |
1 | 1 | |||||||
MIRT595594 | Ago1 | argonaute RISC catalytic subunit 1 | ![]() |
1 | 1 | |||||||
MIRT597699 | Ppp1r2 | protein phosphatase 1, regulatory (inhibitor) subunit 2 | ![]() |
1 | 1 | |||||||
MIRT599114 | Ecd | ecdysoneless homolog (Drosophila) | ![]() |
1 | 1 | |||||||
MIRT601960 | Nav1 | neuron navigator 1 | ![]() |
1 | 1 | |||||||
MIRT602350 | Fktn | fukutin | ![]() |
1 | 1 | |||||||
MIRT605621 | Mpp7 | membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) | ![]() |
1 | 1 | |||||||
MIRT606005 | Fam129a | family with sequence similarity 129, member A | ![]() |
1 | 1 | |||||||
MIRT606581 | Zfp941 | zinc finger protein 941 | ![]() |
1 | 1 | |||||||
MIRT756230 | HSF4 | heat shock transcription factor 4 | 2 | 1 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|