miRTarBase - #MIRT016087


—
pre-miRNA Information
pre-miRNA hsa-mir-744   
Genomic Coordinates chr17: 12081899 - 12081996
Synonyms MIRN744, hsa-mir-744, MIR744
Description Homo sapiens miR-744 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-744-5p
Sequence 11| UGCGGGGCUAGGGCUAACAGCA |32
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN23015028 1 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs557969425 1 dbSNP
rs748252260 4 dbSNP
rs1470408501 7 dbSNP
rs1178657616 10 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B6B8SM miR-744-5p Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Real-time polymerase chain reaction
Gene Information
Gene Symbol PPTC7   
Synonyms TA-PP2C, TAPP2C
Description PTC7 protein phosphatase homolog
Transcript NM_139283   
Expression
Putative miRNA Targets on PPTC7
3'UTR of PPTC7
(miRNA target sites are highlighted)		 
>PPTC7|NM_139283|3'UTR
   1 CTGAGGTGTCAAGTCCTGCCTTTCCTTTCATCATCCCAAATTTCCCCTGCCATGTGTGCTGATCCTGCTGGCAGGACCAC
  81 ATTTCTTTGCCACTGATCTCAATGGCCAGTGATGTAAGTCTTTTGCCTGTCTTCTTGAGACTCGTTGAGATCTTTGTTGA
 161 GAACCACTACTATCATTCACTAGCTCATATCTGCCGGCAGCAATTGAAGAGATCCAATATTTGAAGATTGGCCTTCATTT
 241 CTCGATGTTCTTTCCATGATGGGGATGGAGGTGTTCAGTGCCACCGTGGCTGTTACTTTTCAAAGTAGTTGAAGTATTGA
 321 AAATGAGTAATGTTGGTAAAGTGAATTCAAAATCCTAGTATGCTAAAGGGATGGTACAAGTCTAACACAAATTGTACGTA
 401 ATGATACATCTACTAGAAACATACATTATTCATCAAAAGAAATGTTACATGTGTACTCCACAGGCATAGTCTTTGTTATG
 481 ATGATTGGTGTGGCTTTATGTCTTTGTTATAAACTCCTATTTTTCAGGGGCTTATGATTCTGCTCTAAAACATTGCTCTG
 561 GGTTATACAGTTTTGATCCCAAAAGCTTTTTTGTTACAAATCGGGAGAAAAATCCATTTTAGTTCTATGGATGGAAATAT
 641 TTCATGCTTTTAAAAAGATGTTTGTGTTCCTGTGGTTAAAGTTTTGGCAGTTTATTGATTAGTCCAAATCACAGGCTAAG
 721 GCCTGATCTCCAGGAGGGGTAGGGGAGACACTTTACCAGTATTTTTTTATGGAAATAATACTCAAGGTTGTAAAACCCCT
 801 CAAAGCCTAGAAATTTAATTGTTATGGCTGAAATTCCTCCTAGTTGTCTGATAGAATGCCCCTGAATGGGAACTCTAGGT
 881 CCCAAGGCCTGAAGGGTTGAGAACAGACAGCTGTAACTTTGAATTTTGTTGGCTTTCAGTGGTCATGCTACCTACCCATA
 961 CTCGTACTCTCAGACCTTTTATTAGTAGCCTTGCTTTCTATAGAGCATGCACCAAATCCAGTGAGTCCATGTGGAGAGAG
1041 CACTGTGTGCGCAGCGGCAGCAGCACAGACGTCCATGAGGAAAACTCCCAGTGATGATCTGACATTTACAATTACCCCAC
1121 ATGGAAATTTAGGGGTTTCTGAATCAAGCTTAATGTTTACAGTTTCCAAATAGCCATTTTGCAGTGTATAGTTTCCTTAC
1201 AAAACTACCCCGCATTCAGTTTTCACATTATCTGCAAGCTGAAACTTATTTTTAAGTTTTGTGTACAAGTTGACTGCTGT
1281 AAAGATATATATTTTTGGGTCAGTTTTTTTCCTTCATTAACTTGGTGGTAGAAAAAAATATATACTTAGAAATCCTTAAA
1361 TTAAAGCCATGTTTTATATATAAGTCAGGTAACATTGGTGTATAGATGAGAATGCAATTAAACCTGATGAGAATCTACTT
1441 GAGAATATAGAAAGTCTTTCTCTAAAGGAGATACTGACTCCCTGGTTTATTGCATTAAAATTTATGTTTGAGGTTACCTC
1521 AACTTGTTTTAAAAGATTTTGTTTTGTGAATTTGTACTGTATATTTGAGTAACTGTCAGGCTTTTATTTAAAATTGTTTA
1601 ACATGTACCATGTACATGTCATTACTATATTTCAATGCATCATGCTTGTAACAGGCATTTCATTTATAATAAGAATGAGT
1681 TATTCATTTGTAAGCCGTTCAGTAATTTATCTACTATTCCTAAATTGGCATAATGTTAGATAATCTATTTTGAATCACCT
1761 TTAATTACATGTCAGAATGCCTTAACTACCCTAACTTGACAAAACAGAATTCTTTGGTAGACGCGGTGGGGGCGGGGTGG
1841 GGGGTCTGGACGGAGTCTCTATTTAAGGAGAAATCATCATGCTATGATAAAACACAGAAGCATGAGTGGCAAGTGGCGGG
1921 GTATTTATTTTGCACAAACTATTTGCAGTCTCTGTGTATTTAAAAAGTAAAGAAAGTTGCATCCAGAAGGGTTTTGTTAG
2001 AATGAATACATTTATATTAGGACTGACAACTTCAGCTCTTTTGTTTAGGTTTTCAATTATTTTTGGTAAGAGTATGTAGC
2081 CTTATGATCTGGATATATTTTGCATTCATTTTCCAACGCCTACATTTAATTCCTGGTAAGAGCAGTGCTCGTCAAGTTTC
2161 TGGTTTTTCTCTGCTCTCATTTAACCCGTCAAACACAATCTTTGTAAAGCTAGATTGGTGGTGTTTTATACAACTTATTT
2241 ACTCAGCTTACCTTTTTGAGAAACGATTGTTAGAAATTGACGATGTGTTTGTTCCAGTGATACTGAAAGTAGTGGGGGCA
2321 AGAATTGAGTTTCACAGTGGAATTGGCTTTGGATCTGGCCTATAGATTAGTGACATAAAATATTTTCTCTATTTTCCCCT
2401 GTTCTTTTTGTGTTATGCACTTAATTTTATGACTGCCGGGGGGGTCAGCTGGAGTGCTGCTTAACAAGTATCTCTCCTAC
2481 TCTCAGTGGTCAGAGGCTGTGTTGGACCCATAGTAGAATTTTCCAGGTCACAGACCCAAGCTTCCATGGGTTGTTACTGT
2561 GCTGTACCACTTGGTGGGTCTGATTCTGAACCTGATGTGTGTGTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acGACAAUCGGGAUCGGGGCGu 5'
            || ||| :  |||||::|| 
Target 5' acCTTTTATTAGTAGCCTTGCt 3'
 974 - 995 132.00 -12.50
2 
miRNA  3' acGACAAUCGGGAUCGGGGCGu 5'
            |||  :  :| ||:||:|| 
Target 5' --CTGAGGTGTCAAGTCCTGCc 3'
 1 - 20 120.00 -14.80
3 
miRNA  3' acgacaaucgggaucGGGGCGu 5'
                         |||||| 
Target 5' ttccttacaaaactaCCCCGCa 3'
 1193 - 1214 120.00 -16.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28709844 29 COSMIC
COSN24478148 34 COSMIC
COSN26564924 37 COSMIC
COSN26554758 45 COSMIC
COSN30189364 166 COSMIC
COSN31600580 195 COSMIC
COSN31601623 241 COSMIC
COSN21673281 373 COSMIC
COSN26105167 431 COSMIC
COSN8694512 891 COSMIC
COSN1557152 1047 COSMIC
COSN28782319 1067 COSMIC
COSN31570917 1139 COSMIC
COSN31611192 1270 COSMIC
COSN5864820 1341 COSMIC
COSN31519713 1361 COSMIC
COSN31606622 1418 COSMIC
COSN31487115 1520 COSMIC
COSN26642123 1728 COSMIC
COSN17499399 1922 COSMIC
COSN31570423 2061 COSMIC
COSN26577256 2080 COSMIC
COSN31604138 2103 COSMIC
COSN26633557 2148 COSMIC
COSN31596338 2266 COSMIC
COSN25257974 2313 COSMIC
COSN22213447 2342 COSMIC
COSN23037864 2622 COSMIC
COSN23440870 2899 COSMIC
COSN27460003 2899 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs777642440 5 dbSNP
rs1292423711 6 dbSNP
rs1328179702 8 dbSNP
rs769420249 10 dbSNP
rs1230936918 16 dbSNP
rs1214132912 18 dbSNP
rs1282517108 24 dbSNP
rs766723625 24 dbSNP
rs369743422 25 dbSNP
rs145160849 30 dbSNP
rs376820337 30 dbSNP
rs1265858803 32 dbSNP
rs745639654 36 dbSNP
rs367757579 39 dbSNP
rs1335828179 43 dbSNP
rs1205261160 44 dbSNP
rs200391143 52 dbSNP
rs1449268937 53 dbSNP
rs1197408675 56 dbSNP
rs559727163 58 dbSNP
rs931262536 61 dbSNP
rs919846065 81 dbSNP
rs952646723 82 dbSNP
rs1434464316 92 dbSNP
rs73191841 98 dbSNP
rs554118578 102 dbSNP
rs1470829921 110 dbSNP
rs992885562 113 dbSNP
rs1346001150 116 dbSNP
rs960079374 116 dbSNP
rs924774066 118 dbSNP
rs977612496 123 dbSNP
rs1316014927 135 dbSNP
rs1262081244 137 dbSNP
rs969409003 137 dbSNP
rs961227701 143 dbSNP
rs1258434471 144 dbSNP
rs757765214 156 dbSNP
rs1019402443 167 dbSNP
rs1485206784 169 dbSNP
rs1291695262 181 dbSNP
rs147990237 184 dbSNP
rs1019260185 186 dbSNP
rs565421870 187 dbSNP
rs1049424266 193 dbSNP
rs1182830063 194 dbSNP
rs547130926 195 dbSNP
rs532172877 196 dbSNP
rs1456462402 200 dbSNP
rs1163006683 211 dbSNP
rs1366183184 213 dbSNP
rs894071291 217 dbSNP
rs1054076699 226 dbSNP
rs1341796287 228 dbSNP
rs1391706080 231 dbSNP
rs898431537 235 dbSNP
rs11065659 243 dbSNP
rs1293494850 244 dbSNP
rs1045006356 248 dbSNP
rs185435338 250 dbSNP
rs915919305 263 dbSNP
rs1225408234 270 dbSNP
rs1057021667 273 dbSNP
rs549723110 276 dbSNP
rs924132195 277 dbSNP
rs1196677688 281 dbSNP
rs924709759 285 dbSNP
rs1046989743 286 dbSNP
rs1384818782 307 dbSNP
rs534052987 309 dbSNP
rs1385913386 312 dbSNP
rs1157366302 313 dbSNP
rs1166667990 317 dbSNP
rs1353800737 321 dbSNP
rs1462310908 332 dbSNP
rs531603161 341 dbSNP
rs949506765 342 dbSNP
rs1299666753 343 dbSNP
rs1418721066 350 dbSNP
rs916626700 357 dbSNP
rs1451434001 358 dbSNP
rs568078755 361 dbSNP
rs1474382884 363 dbSNP
rs1225470787 364 dbSNP
rs193180783 374 dbSNP
rs1294064330 377 dbSNP
rs952679209 381 dbSNP
rs919919002 397 dbSNP
rs548195069 398 dbSNP
rs530157379 400 dbSNP
rs1447385246 403 dbSNP
rs1019332083 406 dbSNP
rs961258136 407 dbSNP
rs1462724591 410 dbSNP
rs1260928244 412 dbSNP
rs1184790871 415 dbSNP
rs1019472367 419 dbSNP
rs1008454825 420 dbSNP
rs1429036250 424 dbSNP
rs1172331921 427 dbSNP
rs1469054862 431 dbSNP
rs951139406 434 dbSNP
rs753063362 436 dbSNP
rs1432340111 447 dbSNP
rs1287765115 449 dbSNP
rs1028458163 453 dbSNP
rs1232161762 461 dbSNP
rs1332123205 463 dbSNP
rs143454016 479 dbSNP
rs1263997478 481 dbSNP
rs1011319076 483 dbSNP
rs1431873598 485 dbSNP
rs759072717 486 dbSNP
rs559883113 487 dbSNP
rs1316815525 488 dbSNP
rs1188230147 489 dbSNP
rs1052754698 508 dbSNP
rs1266613771 518 dbSNP
rs189913431 519 dbSNP
rs1431045409 520 dbSNP
rs1398569094 525 dbSNP
rs1157777866 527 dbSNP
rs1045266718 528 dbSNP
rs1389104397 536 dbSNP
rs1291161433 544 dbSNP
rs537970078 554 dbSNP
rs767884061 557 dbSNP
rs1164232099 568 dbSNP
rs1344106308 568 dbSNP
rs1012121679 570 dbSNP
rs755186196 577 dbSNP
rs1222247454 589 dbSNP
rs1459947827 593 dbSNP
rs577274264 602 dbSNP
rs1217957218 603 dbSNP
rs751745450 608 dbSNP
rs903288838 613 dbSNP
rs1168760059 615 dbSNP
rs1270734949 616 dbSNP
rs766843327 623 dbSNP
rs1176294405 625 dbSNP
rs1408194663 627 dbSNP
rs1401944365 628 dbSNP
rs1041820079 640 dbSNP
rs1364318407 646 dbSNP
rs559075621 648 dbSNP
rs79925739 655 dbSNP
rs914751389 664 dbSNP
rs1440398125 669 dbSNP
rs1046575492 670 dbSNP
rs576654033 678 dbSNP
rs1190914690 688 dbSNP
rs942966451 689 dbSNP
rs912805604 694 dbSNP
rs1358688590 698 dbSNP
rs1223168788 707 dbSNP
rs949542972 712 dbSNP
rs762837814 725 dbSNP
rs916676871 726 dbSNP
rs986489630 728 dbSNP
rs1435884416 740 dbSNP
rs1055650756 743 dbSNP
rs554877045 750 dbSNP
rs1203477602 755 dbSNP
rs1233171729 759 dbSNP
rs951099632 760 dbSNP
rs1212477424 762 dbSNP
rs773175554 770 dbSNP
rs1158167275 778 dbSNP
rs1444673214 779 dbSNP
rs1025702756 783 dbSNP
rs765031967 790 dbSNP
rs1466765844 809 dbSNP
rs1416505135 810 dbSNP
rs35041559 810 dbSNP
rs1408636668 814 dbSNP
rs973857072 825 dbSNP
rs1214839458 845 dbSNP
rs1339135092 857 dbSNP
rs962736229 861 dbSNP
rs1235912435 862 dbSNP
rs1372282256 863 dbSNP
rs1334917026 877 dbSNP
rs1023464006 878 dbSNP
rs1246734617 891 dbSNP
rs919950610 893 dbSNP
rs1337366666 908 dbSNP
rs972695023 914 dbSNP
rs1012025075 929 dbSNP
rs61942605 932 dbSNP
rs1439237704 937 dbSNP
rs1438774657 942 dbSNP
rs1242090956 944 dbSNP
rs1184898268 945 dbSNP
rs1034880415 952 dbSNP
rs999374201 959 dbSNP
rs903193201 963 dbSNP
rs1329782532 964 dbSNP
rs1409663729 967 dbSNP
rs146675300 969 dbSNP
rs1165869255 971 dbSNP
rs1455445103 978 dbSNP
rs1453561825 980 dbSNP
rs893205647 981 dbSNP
rs1395556169 989 dbSNP
rs1192986783 990 dbSNP
rs986659548 991 dbSNP
rs3825391 996 dbSNP
rs1429902316 999 dbSNP
rs1028156821 1000 dbSNP
rs912712635 1003 dbSNP
rs987065769 1012 dbSNP
rs930185366 1013 dbSNP
rs746653905 1025 dbSNP
rs538688052 1035 dbSNP
rs1270455501 1041 dbSNP
rs1213420375 1044 dbSNP
rs1259015164 1045 dbSNP
rs989924685 1046 dbSNP
rs1193122730 1050 dbSNP
rs1243138567 1050 dbSNP
rs1479012061 1053 dbSNP
rs1303270485 1055 dbSNP
rs775051981 1056 dbSNP
rs1375601683 1058 dbSNP
rs1031352129 1069 dbSNP
rs550845280 1070 dbSNP
rs1382925612 1071 dbSNP
rs1280148478 1072 dbSNP
rs1400141689 1075 dbSNP
rs902769394 1079 dbSNP
rs1025616115 1081 dbSNP
rs1441569395 1083 dbSNP
rs1342288264 1101 dbSNP
rs1402934846 1106 dbSNP
rs1013831565 1111 dbSNP
rs1345794874 1118 dbSNP
rs1336424792 1130 dbSNP
rs771584784 1146 dbSNP
rs1349341957 1163 dbSNP
rs34418612 1164 dbSNP
rs1287449411 1169 dbSNP
rs1375882250 1176 dbSNP
rs374481724 1182 dbSNP
rs1489551680 1186 dbSNP
rs1055281763 1194 dbSNP
rs142576986 1202 dbSNP
rs931427423 1211 dbSNP
rs898556750 1212 dbSNP
rs1480946083 1214 dbSNP
rs1036995543 1234 dbSNP
rs1410088264 1242 dbSNP
rs960545142 1249 dbSNP
rs1362218333 1255 dbSNP
rs1177214139 1260 dbSNP
rs1159205669 1278 dbSNP
rs1362429197 1279 dbSNP
rs147740171 1285 dbSNP
rs1469213467 1286 dbSNP
rs1230772044 1288 dbSNP
rs1189675018 1296 dbSNP
rs749809120 1298 dbSNP
rs1486199240 1299 dbSNP
rs879555910 1300 dbSNP
rs1034783548 1305 dbSNP
rs1356521195 1306 dbSNP
rs1220944353 1311 dbSNP
rs531437838 1319 dbSNP
rs902428612 1321 dbSNP
rs1211936775 1325 dbSNP
rs1319183805 1327 dbSNP
rs1285611704 1334 dbSNP
rs1248754685 1339 dbSNP
rs1437439527 1341 dbSNP
rs1182671527 1345 dbSNP
rs932565407 1370 dbSNP
rs1442803866 1371 dbSNP
rs1162864519 1378 dbSNP
rs1385710644 1379 dbSNP
rs547703952 1381 dbSNP
rs1459307467 1383 dbSNP
rs1296232067 1389 dbSNP
rs1395393502 1395 dbSNP
rs921123717 1399 dbSNP
rs768136199 1402 dbSNP
rs989951102 1407 dbSNP
rs1379972047 1416 dbSNP
rs957130289 1417 dbSNP
rs1371338136 1423 dbSNP
rs1039830414 1427 dbSNP
rs1322835661 1432 dbSNP
rs1295319493 1438 dbSNP
rs184123837 1454 dbSNP
rs191663717 1461 dbSNP
rs1199528783 1480 dbSNP
rs1240192099 1493 dbSNP
rs1051224293 1504 dbSNP
rs1460038631 1504 dbSNP
rs1445555418 1525 dbSNP
rs1425466596 1532 dbSNP
rs561780131 1535 dbSNP
rs1168111299 1539 dbSNP
rs527585708 1549 dbSNP
rs1462260959 1554 dbSNP
rs930280970 1555 dbSNP
rs1403364026 1561 dbSNP
rs1451366941 1566 dbSNP
rs1336790185 1573 dbSNP
rs1380577982 1579 dbSNP
rs866064352 1583 dbSNP
rs1346856678 1604 dbSNP
rs1159777118 1613 dbSNP
rs1398338585 1616 dbSNP
rs1399595903 1618 dbSNP
rs781679057 1619 dbSNP
rs971506992 1627 dbSNP
rs1219553749 1635 dbSNP
rs1260308161 1638 dbSNP
rs1321652753 1650 dbSNP
rs1023972158 1652 dbSNP
rs1475295769 1653 dbSNP
rs1256636141 1661 dbSNP
rs1256370212 1663 dbSNP
rs1014278026 1666 dbSNP
rs918826956 1669 dbSNP
rs57076956 1673 dbSNP
rs1487066813 1677 dbSNP
rs1195573345 1679 dbSNP
rs1426827774 1683 dbSNP
rs1468936635 1690 dbSNP
rs941004548 1697 dbSNP
rs1360410543 1702 dbSNP
rs916223238 1704 dbSNP
rs547826284 1706 dbSNP
rs1287632409 1713 dbSNP
rs990540916 1714 dbSNP
rs960407344 1760 dbSNP
rs755316894 1769 dbSNP
rs995593629 1771 dbSNP
rs1408174540 1777 dbSNP
rs1223170109 1784 dbSNP
rs927842353 1798 dbSNP
rs1314038634 1806 dbSNP
rs898592780 1812 dbSNP
rs532610865 1822 dbSNP
rs748770819 1824 dbSNP
rs966683135 1825 dbSNP
rs1233994310 1827 dbSNP
rs940116278 1831 dbSNP
rs182490866 1833 dbSNP
rs1051087816 1834 dbSNP
rs932572335 1836 dbSNP
rs1291704040 1837 dbSNP
rs1300545381 1838 dbSNP
rs1420812662 1838 dbSNP
rs957371803 1839 dbSNP
rs1404662569 1841 dbSNP
rs1394022381 1844 dbSNP
rs1018256150 1845 dbSNP
rs1222196569 1845 dbSNP
rs1006980623 1846 dbSNP
rs1354450936 1851 dbSNP
rs751800426 1851 dbSNP
rs541799856 1852 dbSNP
rs1386372078 1857 dbSNP
rs935788593 1859 dbSNP
rs543980130 1861 dbSNP
rs1327245871 1866 dbSNP
rs1461537122 1867 dbSNP
rs924433038 1872 dbSNP
rs977209776 1875 dbSNP
rs1162409300 1879 dbSNP
rs1430630122 1880 dbSNP
rs1176168433 1881 dbSNP
rs971153433 1884 dbSNP
rs775290542 1915 dbSNP
rs576603154 1917 dbSNP
rs1186433850 1918 dbSNP
rs372707858 1922 dbSNP
rs1039043457 1940 dbSNP
rs941591383 1947 dbSNP
rs1383858506 1950 dbSNP
rs1405210558 1952 dbSNP
rs916251379 1953 dbSNP
rs916930980 1954 dbSNP
rs561246029 1958 dbSNP
rs939138846 1971 dbSNP
rs1377762526 1975 dbSNP
rs927704871 1977 dbSNP
rs991142744 1988 dbSNP
rs1358621479 1989 dbSNP
rs1228720333 1999 dbSNP
rs959909089 2000 dbSNP
rs1309022253 2011 dbSNP
rs1033858119 2012 dbSNP
rs977976883 2014 dbSNP
rs1203408242 2018 dbSNP
rs1238352072 2020 dbSNP
rs1458720199 2022 dbSNP
rs536132300 2023 dbSNP
rs780042596 2029 dbSNP
rs542868548 2038 dbSNP
rs572416590 2041 dbSNP
rs1472745349 2044 dbSNP
rs1213773916 2055 dbSNP
rs1164242062 2056 dbSNP
rs553321611 2066 dbSNP
rs1408514996 2074 dbSNP
rs112707998 2090 dbSNP
rs368789747 2091 dbSNP
rs1401293404 2093 dbSNP
rs1305562749 2094 dbSNP
rs577649578 2095 dbSNP
rs1339844577 2102 dbSNP
rs1004732321 2113 dbSNP
rs139420012 2116 dbSNP
rs186836759 2117 dbSNP
rs1213709937 2119 dbSNP
rs1258381414 2132 dbSNP
rs1319542730 2133 dbSNP
rs1051549854 2136 dbSNP
rs375622018 2138 dbSNP
rs1018325048 2151 dbSNP
rs985448990 2153 dbSNP
rs1188867672 2154 dbSNP
rs1239655732 2156 dbSNP
rs899760366 2171 dbSNP
rs1193373857 2176 dbSNP
rs1424662737 2180 dbSNP
rs1170106992 2188 dbSNP
rs1448078789 2195 dbSNP
rs1174494433 2203 dbSNP
rs1401616149 2221 dbSNP
rs955468068 2227 dbSNP
rs182228732 2235 dbSNP
rs1343365540 2238 dbSNP
rs1194862395 2241 dbSNP
rs935902707 2246 dbSNP
rs1278584546 2251 dbSNP
rs191141368 2264 dbSNP
rs1041560394 2267 dbSNP
rs1017066990 2268 dbSNP
rs949853802 2271 dbSNP
rs1481041547 2277 dbSNP
rs758526652 2281 dbSNP
rs991570274 2282 dbSNP
rs958432246 2283 dbSNP
rs750429128 2310 dbSNP
rs1264383381 2311 dbSNP
rs1197557351 2312 dbSNP
rs189146763 2313 dbSNP
rs1042546150 2314 dbSNP
rs150392961 2314 dbSNP
rs796203895 2314 dbSNP
rs1235011921 2318 dbSNP
rs945113633 2320 dbSNP
rs1369598023 2329 dbSNP
rs566795684 2334 dbSNP
rs183788086 2335 dbSNP
rs1392632227 2336 dbSNP
rs1373559910 2343 dbSNP
rs1331312389 2348 dbSNP
rs1234840216 2357 dbSNP
rs989323739 2365 dbSNP
rs1297277549 2374 dbSNP
rs1015725876 2380 dbSNP
rs1377695476 2390 dbSNP
rs1174812675 2396 dbSNP
rs1287299835 2399 dbSNP
rs1489480235 2400 dbSNP
rs1267014989 2401 dbSNP
rs192020837 2401 dbSNP
rs765749072 2401 dbSNP
rs370529571 2407 dbSNP
rs762881610 2414 dbSNP
rs1184025573 2416 dbSNP
rs1159184260 2431 dbSNP
rs1419766146 2437 dbSNP
rs769632671 2438 dbSNP
rs955643686 2438 dbSNP
rs985481964 2440 dbSNP
rs1310720301 2442 dbSNP
rs539542512 2445 dbSNP
rs955376195 2445 dbSNP
rs1265195528 2458 dbSNP
rs1357449718 2461 dbSNP
rs745774018 2463 dbSNP
rs1236510086 2464 dbSNP
rs765224377 2467 dbSNP
rs866462394 2469 dbSNP
rs961483317 2470 dbSNP
rs1017554528 2475 dbSNP
rs1442662233 2480 dbSNP
rs1481946698 2489 dbSNP
rs899876028 2496 dbSNP
rs1368851458 2499 dbSNP
rs781176763 2512 dbSNP
rs1054443272 2514 dbSNP
rs867738977 2517 dbSNP
rs903074494 2523 dbSNP
rs1211351415 2531 dbSNP
rs1041960680 2540 dbSNP
rs371898440 2547 dbSNP
rs1254208369 2556 dbSNP
rs1240503491 2557 dbSNP
rs1043568440 2559 dbSNP
rs1003724367 2574 dbSNP
rs906201921 2580 dbSNP
rs1305817213 2596 dbSNP
rs1247432906 2606 dbSNP
rs1256461895 2613 dbSNP
rs1042018021 2617 dbSNP
rs1199390008 2629 dbSNP
rs1260111271 2633 dbSNP
rs1407686714 2636 dbSNP
rs917062176 2639 dbSNP
rs1055587946 2640 dbSNP
rs1403298226 2640 dbSNP
rs1425407939 2640 dbSNP
rs149391682 2640 dbSNP
rs748527741 2640 dbSNP
rs945157994 2640 dbSNP
rs943162724 2641 dbSNP
rs1357748978 2642 dbSNP
rs1302840222 2646 dbSNP
rs576526014 2647 dbSNP
rs1398204066 2652 dbSNP
rs987398110 2659 dbSNP
rs1340249911 2660 dbSNP
rs920289265 2663 dbSNP
rs1280272323 2676 dbSNP
rs922595750 2679 dbSNP
rs973013404 2685 dbSNP
rs761679555 2687 dbSNP
rs1454347026 2692 dbSNP
rs1484182395 2693 dbSNP
rs961789853 2695 dbSNP
rs1363364029 2712 dbSNP
rs1477999452 2713 dbSNP
rs1195419999 2718 dbSNP
rs909950868 2724 dbSNP
rs941633010 2726 dbSNP
rs959546963 2734 dbSNP
rs1378755956 2740 dbSNP
rs1033777706 2745 dbSNP
rs1296835361 2750 dbSNP
rs1360300845 2761 dbSNP
rs1400918723 2774 dbSNP
rs1188342712 2778 dbSNP
rs1365742042 2783 dbSNP
rs1003755515 2787 dbSNP
rs1302033030 2789 dbSNP
rs1441655877 2794 dbSNP
rs1285151425 2795 dbSNP
rs753692472 2801 dbSNP
rs971003195 2803 dbSNP
rs908758201 2805 dbSNP
rs1021072609 2808 dbSNP
rs1487934392 2809 dbSNP
rs1191369448 2823 dbSNP
rs779587980 2825 dbSNP
rs1268867964 2826 dbSNP
rs1009220697 2828 dbSNP
rs763873180 2828 dbSNP
rs893568798 2834 dbSNP
rs1053551825 2841 dbSNP
rs1161708215 2845 dbSNP
rs1348400205 2850 dbSNP
rs1259693871 2857 dbSNP
rs866643419 2859 dbSNP
rs888959065 2867 dbSNP
rs1444574885 2869 dbSNP
rs56257616 2877 dbSNP
rs1228964874 2878 dbSNP
rs1293548777 2882 dbSNP
rs532436743 2894 dbSNP
rs760361351 2895 dbSNP
rs1233029000 2896 dbSNP
rs933269173 2897 dbSNP
rs946543850 2899 dbSNP
rs1177454182 2900 dbSNP
rs1456116117 2900 dbSNP
rs113830542 2901 dbSNP
rs1238154787 2901 dbSNP
rs112020659 2902 dbSNP
rs1179421631 2905 dbSNP
rs1384886633 2909 dbSNP
rs1405081263 2911 dbSNP
rs975548663 2912 dbSNP
rs775185661 2913 dbSNP
rs1165759126 2914 dbSNP
rs1377685682 2914 dbSNP
rs555592281 2914 dbSNP
rs55638079 2914 dbSNP
rs964113508 2914 dbSNP
rs1463109701 2920 dbSNP
rs1282298453 2923 dbSNP
rs1418786872 2932 dbSNP
rs186717024 2940 dbSNP
rs1228668485 2942 dbSNP
rs1037463958 2944 dbSNP
rs139663602 2944 dbSNP
rs1366573251 2946 dbSNP
rs940055080 2949 dbSNP
rs1258179784 2956 dbSNP
rs1458679236 2966 dbSNP
rs1207264981 2968 dbSNP
rs867382248 2973 dbSNP
rs903104065 2981 dbSNP
rs1020233974 2984 dbSNP
rs1014583548 2987 dbSNP
rs1469454573 2988 dbSNP
rs1273390270 2992 dbSNP
rs1208939268 3004 dbSNP
rs1354669267 3006 dbSNP
rs1272230895 3018 dbSNP
rs1401137422 3019 dbSNP
rs1411663656 3019 dbSNP
rs1358490597 3024 dbSNP
rs1448547398 3028 dbSNP
rs1294870633 3031 dbSNP
rs117916505 3034 dbSNP
rs1217661355 3042 dbSNP
rs1278375206 3045 dbSNP
rs1319399472 3053 dbSNP
rs768949353 3059 dbSNP
rs1296073150 3061 dbSNP
rs1277196301 3065 dbSNP
rs982236038 3070 dbSNP
rs1056020506 3078 dbSNP
rs561108404 3093 dbSNP
rs1211388697 3104 dbSNP
rs971413916 3117 dbSNP
rs542829799 3121 dbSNP
rs1395368831 3128 dbSNP
rs151241518 3129 dbSNP
rs142274815 3131 dbSNP
rs1170870243 3137 dbSNP
rs1424424771 3141 dbSNP
rs1415004213 3145 dbSNP
rs898893421 3149 dbSNP
rs1037330226 3150 dbSNP
rs1399097241 3158 dbSNP
rs1298508198 3168 dbSNP
rs1327820284 3170 dbSNP
rs16940885 3176 dbSNP
rs907527575 3192 dbSNP
rs1273761743 3203 dbSNP
rs983096980 3204 dbSNP
rs1351552343 3206 dbSNP
rs75223145 3208 dbSNP
rs1283003286 3211 dbSNP
rs1169386759 3226 dbSNP
rs934219570 3240 dbSNP
rs1007317596 3264 dbSNP
rs1389452947 3272 dbSNP
rs888864323 3280 dbSNP
rs1246224250 3286 dbSNP
rs1051627695 3288 dbSNP
rs1175448944 3290 dbSNP
rs922826193 3295 dbSNP
rs773670591 3296 dbSNP
rs975958427 3297 dbSNP
rs747146990 3300 dbSNP
rs576987816 3307 dbSNP
rs964144174 3308 dbSNP
rs1384735624 3313 dbSNP
rs1033055826 3318 dbSNP
rs553975110 3320 dbSNP
rs7489021 3321 dbSNP
rs967410235 3324 dbSNP
rs1331180654 3326 dbSNP
rs1442456749 3333 dbSNP
rs941910372 3343 dbSNP
rs1449448735 3349 dbSNP
rs909890960 3357 dbSNP
rs1274715912 3359 dbSNP
rs1353229953 3359 dbSNP
rs1208301319 3365 dbSNP
rs1048381425 3374 dbSNP
rs1452328869 3375 dbSNP
rs938133581 3376 dbSNP
rs556126603 3393 dbSNP
rs10075 3400 dbSNP
rs552608555 3401 dbSNP
rs142225646 3402 dbSNP
rs368634117 3402 dbSNP
rs895693275 3408 dbSNP
rs1365336596 3412 dbSNP
rs914026510 3416 dbSNP
rs1162349668 3420 dbSNP
rs1371803952 3428 dbSNP
rs781717303 3438 dbSNP
rs1375466750 3443 dbSNP
rs1462606212 3443 dbSNP
rs988418822 3443 dbSNP
rs1034203528 3449 dbSNP
rs148681778 3452 dbSNP
rs1308265829 3467 dbSNP
rs538373610 3469 dbSNP
rs574765926 3483 dbSNP
rs898924531 3491 dbSNP
rs1410290050 3502 dbSNP
rs747329212 3506 dbSNP
rs940444309 3512 dbSNP
rs1369791301 3519 dbSNP
rs886131576 3530 dbSNP
rs1457326128 3536 dbSNP
rs1196307529 3538 dbSNP
rs1252568414 3539 dbSNP
rs140055874 3547 dbSNP
rs934274287 3548 dbSNP
rs1368722839 3554 dbSNP
rs1476000642 3568 dbSNP
rs1168035109 3573 dbSNP
rs922823316 3573 dbSNP
rs867080676 3574 dbSNP
rs1299313177 3579 dbSNP
rs1399246936 3580 dbSNP
rs1190082496 3584 dbSNP
rs988072659 3590 dbSNP
rs115856058 3593 dbSNP
rs1317441640 3611 dbSNP
rs566758661 3621 dbSNP
rs1234237029 3629 dbSNP
rs551427364 3632 dbSNP
rs1482932804 3640 dbSNP
rs780353862 3641 dbSNP
rs978864651 3655 dbSNP
rs967852732 3658 dbSNP
rs1213490227 3662 dbSNP
rs1349151721 3663 dbSNP
rs1278561554 3667 dbSNP
rs887690239 3682 dbSNP
rs539023996 3685 dbSNP
rs913244685 3691 dbSNP
rs993212337 3693 dbSNP
rs185551447 3699 dbSNP
rs1352982124 3700 dbSNP
rs750527903 3711 dbSNP
rs1428658422 3715 dbSNP
rs1171880195 3731 dbSNP
rs550160459 3735 dbSNP
rs1465014628 3742 dbSNP
rs1302716794 3744 dbSNP
rs963222892 3753 dbSNP
rs1016035467 3760 dbSNP
rs1417002355 3760 dbSNP
rs1296643376 3763 dbSNP
rs1340094915 3768 dbSNP
rs1382885927 3777 dbSNP
rs1297856673 3778 dbSNP
rs1310466645 3778 dbSNP
rs1046487038 3780 dbSNP
rs1280876599 3792 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' acgacaaucgggaucGGGGCGu 5'
                         |||||| 
Target 5' -uccuuacaaaacuaCCCCGCa 3'
 		1 - 21
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000354300.3 | 3UTR | UCCUUACAAAACUACCCCGCAUUCAGUUUUCACAUUAUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.82 4.8e-6 0.836 2.2e-6 20 Click to see details
GSE21032 Prostate cancer -0.321 1.5e-3 -0.329 1.2e-3 83 Click to see details
GSE28260 Renal cortex and medulla 0.653 7.8e-3 0.566 2.2e-2 13 Click to see details
GSE28544 Breast cancer 0.429 1.8e-2 0.332 5.6e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.379 3.1e-2 0.420 1.8e-2 25 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.588 4.8e-2 0.567 5.6e-2 9 Click to see details
GSE19350 CNS germ cell tumors -0.45 7.1e-2 -0.364 1.2e-1 12 Click to see details
GSE38226 Liver fibrosis -0.222 1.7e-1 -0.181 2.2e-1 21 Click to see details
GSE42095 Differentiated embryonic stem cells -0.178 2.1e-1 -0.283 9.5e-2 23 Click to see details
GSE19783 ER- ER- breast cancer -0.081 2.4e-1 -0.022 4.2e-1 79 Click to see details
GSE19536 Breast cancer -0.06 2.8e-1 -0.027 3.9e-1 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.078 3.6e-1 0.110 3.0e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.047 3.6e-1 -0.014 4.6e-1 64 Click to see details
GSE26953 Aortic valvular endothelial cells -0.073 3.7e-1 -0.091 3.4e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.024 4.6e-1 0.045 4.3e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.012 4.7e-1 -0.094 3.0e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
COAD 0.933 0 0.810 0.01 8 Click to see details
ESCA 0.43 0.09 0.536 0.04 11 Click to see details
KIRC 0.138 0.13 0.185 0.07 68 Click to see details
KIRP 0.168 0.18 0.207 0.13 32 Click to see details
KICH -0.174 0.2 -0.284 0.08 25 Click to see details
LUAD -0.242 0.22 -0.210 0.26 12 Click to see details
BLCA -0.167 0.25 -0.143 0.29 18 Click to see details
THCA -0.087 0.26 -0.027 0.42 59 Click to see details
LIHC -0.089 0.27 -0.157 0.14 49 Click to see details
UCEC -0.135 0.29 -0.158 0.26 19 Click to see details
HNSC -0.085 0.3 -0.023 0.44 42 Click to see details
LUSC 0.084 0.31 0.090 0.3 38 Click to see details
PAAD -0.332 0.33 -0.200 0.4 4 Click to see details
PCPG 0.488 0.34 0.500 0.33 3 Click to see details
BRCA 0.04 0.36 -0.027 0.4 84 Click to see details
CHOL -0.122 0.38 -0.200 0.3 9 Click to see details
CESC 0.063 0.48 -0.500 0.33 3 Click to see details
PRAD -0.004 0.49 -0.105 0.23 50 Click to see details
STAD -0.002 0.5 -0.077 0.34 32 Click to see details
STAD -0.002 0.5 -0.077 0.34 32 Click to see details
STAD -0.002 0.5 -0.077 0.34 32 Click to see details
412 hsa-miR-744-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT016085 ARL15 ADP ribosylation factor like GTPase 15 1 1
MIRT016086 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 2
MIRT016087 PPTC7 PTC7 protein phosphatase homolog 2 3
MIRT016088 RASSF1 Ras association domain family member 1 1 1
MIRT016089 IER5 immediate early response 5 1 1
MIRT037383 UFC1 ubiquitin-fold modifier conjugating enzyme 1 1 1
MIRT037384 STAM2 signal transducing adaptor molecule 2 1 1
MIRT037385 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT037386 DCXR dicarbonyl and L-xylulose reductase 1 1
MIRT037387 TSPAN17 tetraspanin 17 1 1
MIRT037388 ACTB actin beta 1 1
MIRT037389 HIST1H2BC histone cluster 1 H2B family member c 1 1
MIRT037390 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT037391 VDAC1 voltage dependent anion channel 1 1 1
MIRT037392 RNASEK ribonuclease K 1 1
MIRT037393 CDK16 cyclin dependent kinase 16 1 1
MIRT037394 ZCCHC24 zinc finger CCHC-type containing 24 1 1
MIRT037395 ARRDC2 arrestin domain containing 2 1 1
MIRT037396 SGMS1 sphingomyelin synthase 1 1 1
MIRT037397 HSPD1 heat shock protein family D (Hsp60) member 1 1 1
MIRT037398 MRPL46 mitochondrial ribosomal protein L46 1 1
MIRT037399 RHEB Ras homolog, mTORC1 binding 1 1
MIRT037400 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT037401 TP53I13 tumor protein p53 inducible protein 13 1 1
MIRT037402 CD44 CD44 molecule (Indian blood group) 1 1
MIRT037403 USP12 ubiquitin specific peptidase 12 1 1
MIRT037404 AP2B1 adaptor related protein complex 2 beta 1 subunit 1 1
MIRT037405 RPL18A ribosomal protein L18a 1 1
MIRT037406 PPP1CA protein phosphatase 1 catalytic subunit alpha 1 1
MIRT037407 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT037408 PXK PX domain containing serine/threonine kinase like 1 1
MIRT037409 TDRKH tudor and KH domain containing 1 1
MIRT037410 PRRC2A proline rich coiled-coil 2A 1 1
MIRT037411 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT037412 NDE1 nudE neurodevelopment protein 1 1 1
MIRT037413 STK16 serine/threonine kinase 16 1 1
MIRT037414 PSMB2 proteasome subunit beta 2 1 1
MIRT037415 EPN1 epsin 1 1 1
MIRT037416 EN2 engrailed homeobox 2 1 1
MIRT037417 LARP1 La ribonucleoprotein domain family member 1 1 1
MIRT037418 SRCAP Snf2 related CREBBP activator protein 1 1
MIRT037419 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT037420 AP2A2 adaptor related protein complex 2 alpha 2 subunit 1 1
MIRT037421 ACTG1 actin gamma 1 1 1
MIRT037422 PIKFYVE phosphoinositide kinase, FYVE-type zinc finger containing 1 1
MIRT037423 UBE2O ubiquitin conjugating enzyme E2 O 1 1
MIRT037424 KLHL15 kelch like family member 15 1 1
MIRT037425 SECISBP2 SECIS binding protein 2 1 1
MIRT037426 KIAA0922 transmembrane 131 like 1 1
MIRT037427 PTMA prothymosin, alpha 1 1
MIRT037428 WDR45B WD repeat domain 45B 1 1
MIRT037429 ZNF282 zinc finger protein 282 1 1
MIRT037430 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT037431 TNKS tankyrase 1 1
MIRT037432 NOP2 NOP2 nucleolar protein 1 1
MIRT037433 GAK cyclin G associated kinase 1 1
MIRT037434 ATP6 ATP synthase F0 subunit 6 1 1
MIRT037435 DIDO1 death inducer-obliterator 1 1 1
MIRT037436 RPL3 ribosomal protein L3 1 1
MIRT037437 AIMP2 aminoacyl tRNA synthetase complex interacting multifunctional protein 2 1 1
MIRT037438 PIGC phosphatidylinositol glycan anchor biosynthesis class C 1 1
MIRT037439 ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 1 1
MIRT037440 USP21 ubiquitin specific peptidase 21 1 1
MIRT037441 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 1
MIRT037442 RPS6 ribosomal protein S6 1 1
MIRT037443 ILKAP ILK associated serine/threonine phosphatase 1 1
MIRT037444 COX1 cytochrome c oxidase subunit I 1 1
MIRT037445 VPS37C VPS37C, ESCRT-I subunit 1 1
MIRT037446 CDK12 cyclin dependent kinase 12 1 1
MIRT037447 RBM8A RNA binding motif protein 8A 1 1
MIRT037448 CKB creatine kinase B 1 1
MIRT037449 DHX57 DExH-box helicase 57 1 1
MIRT037450 DDX23 DEAD-box helicase 23 1 1
MIRT037451 ABI3 ABI family member 3 1 1
MIRT037452 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT037453 PDPK1 3-phosphoinositide dependent protein kinase 1 1 1
MIRT037454 C17orf70 Fanconi anemia core complex associated protein 100 1 1
MIRT037455 SKI SKI proto-oncogene 1 1
MIRT037456 KCTD11 potassium channel tetramerization domain containing 11 1 1
MIRT037457 GNB2L1 receptor for activated C kinase 1 1 1
MIRT037458 NCOA3 nuclear receptor coactivator 3 1 1
MIRT037459 PAK4 p21 (RAC1) activated kinase 4 2 3
MIRT037460 GDI2 GDP dissociation inhibitor 2 1 1
MIRT037461 SLC2A4RG SLC2A4 regulator 1 1
MIRT037462 SLX4 SLX4 structure-specific endonuclease subunit 1 1
MIRT037463 COPA coatomer protein complex subunit alpha 1 1
MIRT037464 GPRASP2 G protein-coupled receptor associated sorting protein 2 1 1
MIRT037465 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT037466 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT037467 COTL1 coactosin like F-actin binding protein 1 1 1
MIRT037468 CAPNS1 calpain small subunit 1 1 1
MIRT037469 FRZB frizzled-related protein 1 1
MIRT037470 UBQLN4 ubiquilin 4 1 1
MIRT037471 NUP153 nucleoporin 153 1 1
MIRT037472 TMEM175 transmembrane protein 175 1 1
MIRT037473 HIST1H2BD histone cluster 1 H2B family member d 1 1
MIRT037474 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT037475 BCL2L12 BCL2 like 12 1 1
MIRT037476 HIST2H2AA3 histone cluster 2 H2A family member a3 1 1
MIRT037477 MINK1 misshapen like kinase 1 1 1
MIRT037478 PDXK pyridoxal kinase 1 1
MIRT037479 FAM110A family with sequence similarity 110 member A 1 1
MIRT037480 ZNF598 zinc finger protein 598 1 1
MIRT037481 ILK integrin linked kinase 1 1
MIRT037482 HINT1 histidine triad nucleotide binding protein 1 1 1
MIRT037483 WBP2 WW domain binding protein 2 1 1
MIRT037484 CYTB cytochrome b 1 1
MIRT037485 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT037486 TRIM33 tripartite motif containing 33 1 1
MIRT037487 SLC25A3 solute carrier family 25 member 3 1 1
MIRT037488 IRS4 insulin receptor substrate 4 1 1
MIRT037489 TSR1 TSR1, ribosome maturation factor 1 1
MIRT037490 TCOF1 treacle ribosome biogenesis factor 1 1 1
MIRT037491 ATXN2L ataxin 2 like 1 1
MIRT037492 MTOR mechanistic target of rapamycin kinase 1 1
MIRT037493 ZNF318 zinc finger protein 318 1 1
MIRT037494 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 3
MIRT037495 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT037496 STMN1 stathmin 1 1 1
MIRT037497 SAT1 spermidine/spermine N1-acetyltransferase 1 1 1
MIRT037498 SALL1 spalt like transcription factor 1 1 1
MIRT037499 ZSCAN18 zinc finger and SCAN domain containing 18 1 1
MIRT037500 SLC35D1 solute carrier family 35 member D1 1 1
MIRT037501 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT037502 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT037503 CHD5 chromodomain helicase DNA binding protein 5 1 1
MIRT037504 BAG6 BCL2 associated athanogene 6 1 1
MIRT037505 MED28 mediator complex subunit 28 1 1
MIRT037506 ANKRD52 ankyrin repeat domain 52 1 1
MIRT037507 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 1 1
MIRT037508 PPDPF pancreatic progenitor cell differentiation and proliferation factor 1 1
MIRT037509 PRKACA protein kinase cAMP-activated catalytic subunit alpha 1 1
MIRT037510 HPCAL4 hippocalcin like 4 1 1
MIRT037511 ZNF256 zinc finger protein 256 1 1
MIRT037512 CGNL1 cingulin like 1 1 1
MIRT037513 TUBA1B tubulin alpha 1b 1 1
MIRT037514 LNPEP leucyl and cystinyl aminopeptidase 1 1
MIRT037515 PDE4A phosphodiesterase 4A 1 1
MIRT037516 HOXD11 homeobox D11 2 3
MIRT037517 QARS glutaminyl-tRNA synthetase 1 1
MIRT037518 G3BP1 G3BP stress granule assembly factor 1 1 1
MIRT037519 PLEKHM2 pleckstrin homology and RUN domain containing M2 1 1
MIRT037520 POLR2A RNA polymerase II subunit A 1 1
MIRT037521 KIAA1462 junctional cadherin 5 associated 1 1
MIRT037522 SF3A1 splicing factor 3a subunit 1 1 1
MIRT037523 YBX1 Y-box binding protein 1 1 1
MIRT037524 PTGES3 prostaglandin E synthase 3 1 1
MIRT037525 FOXO3 forkhead box O3 1 1
MIRT037526 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT037527 AARS alanyl-tRNA synthetase 1 1
MIRT037528 ZNF155 zinc finger protein 155 1 1
MIRT037529 NCS1 neuronal calcium sensor 1 1 1
MIRT037530 FKBP4 FK506 binding protein 4 1 1
MIRT037531 ARHGDIA Rho GDP dissociation inhibitor alpha 1 1
MIRT037532 MAPK7 mitogen-activated protein kinase 7 1 1
MIRT037533 AGPAT2 1-acylglycerol-3-phosphate O-acyltransferase 2 1 1
MIRT037534 HIST1H1E histone cluster 1 H1 family member e 1 1
MIRT037535 MLF2 myeloid leukemia factor 2 1 1
MIRT037536 EDC3 enhancer of mRNA decapping 3 1 1
MIRT037537 CHRAC1 chromatin accessibility complex 1 1 1
MIRT037538 WIPF3 WAS/WASL interacting protein family member 3 1 1
MIRT037539 COX2 cytochrome c oxidase subunit II 1 1
MIRT037540 SRSF1 serine and arginine rich splicing factor 1 1 1
MIRT037541 CTNNBIP1 catenin beta interacting protein 1 1 1
MIRT037542 RPL4 ribosomal protein L4 1 1
MIRT037543 COX3 cytochrome c oxidase III 1 1
MIRT037544 DDX54 DEAD-box helicase 54 1 1
MIRT037545 TOB2 transducer of ERBB2, 2 1 1
MIRT037546 MAN2C1 mannosidase alpha class 2C member 1 1 1
MIRT037547 SMCR7L mitochondrial elongation factor 1 1 1
MIRT037548 RPLP1 ribosomal protein lateral stalk subunit P1 1 1
MIRT037549 RAN RAN, member RAS oncogene family 1 1
MIRT037550 NONO non-POU domain containing octamer binding 1 1
MIRT037551 CYB5R3 cytochrome b5 reductase 3 1 1
MIRT037552 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 1 1
MIRT037553 COLGALT1 collagen beta(1-O)galactosyltransferase 1 1 1
MIRT037554 MGRN1 mahogunin ring finger 1 1 1
MIRT037555 ANAPC1 anaphase promoting complex subunit 1 1 1
MIRT037556 TBX1 T-box 1 1 1
MIRT037557 NXPH4 neurexophilin 4 1 1
MIRT037558 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT037559 UBE2A ubiquitin conjugating enzyme E2 A 1 1
MIRT037560 KPNB1 karyopherin subunit beta 1 1 1
MIRT037561 NDUFB10 NADH:ubiquinone oxidoreductase subunit B10 1 1
MIRT037562 SYMPK symplekin 1 1
MIRT037563 SYPL1 synaptophysin like 1 1 1
MIRT037564 LRP3 LDL receptor related protein 3 1 1
MIRT037565 DDX24 DEAD-box helicase 24 1 1
MIRT037566 WDR37 WD repeat domain 37 1 1
MIRT037567 RPS14 ribosomal protein S14 1 1
MIRT037568 FAM53C family with sequence similarity 53 member C 1 1
MIRT037569 NMT1 N-myristoyltransferase 1 1 1
MIRT037570 PAGR1 PAXIP1 associated glutamate rich protein 1 1 1
MIRT037571 AKT2 AKT serine/threonine kinase 2 1 1
MIRT037572 TMEM14C transmembrane protein 14C 1 1
MIRT037573 MEX3D mex-3 RNA binding family member D 1 1
MIRT037574 BRAF B-Raf proto-oncogene, serine/threonine kinase 1 1
MIRT037575 POLR2L RNA polymerase II subunit L 1 1
MIRT037576 SERP1 stress associated endoplasmic reticulum protein 1 1 1
MIRT037577 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT037578 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT037579 POLD3 DNA polymerase delta 3, accessory subunit 1 1
MIRT037580 HMGA1 high mobility group AT-hook 1 1 1
MIRT037581 SLC35B4 solute carrier family 35 member B4 1 1
MIRT037582 PELP1 proline, glutamate and leucine rich protein 1 1 1
MIRT037583 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 1 1
MIRT037584 RPL7A ribosomal protein L7a 1 1
MIRT037585 LAIR1 leukocyte associated immunoglobulin like receptor 1 1 1
MIRT037586 RPL10 ribosomal protein L10 1 1
MIRT037587 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT037588 SRM spermidine synthase 1 1
MIRT037589 EIF3K eukaryotic translation initiation factor 3 subunit K 1 1
MIRT037590 DESI1 desumoylating isopeptidase 1 1 1
MIRT037591 BET1 Bet1 golgi vesicular membrane trafficking protein 1 1
MIRT037592 HTRA2 HtrA serine peptidase 2 1 1
MIRT037593 LARP6 La ribonucleoprotein domain family member 6 1 1
MIRT037594 NOTCH2 notch 2 1 1
MIRT037595 ADCY9 adenylate cyclase 9 1 1
MIRT037596 C6orf62 chromosome 6 open reading frame 62 1 1
MIRT037597 FBXL19 F-box and leucine rich repeat protein 19 1 1
MIRT037598 L3MBTL2 L3MBTL2, polycomb repressive complex 1 subunit 1 1
MIRT037599 TRIM28 tripartite motif containing 28 1 1
MIRT037600 LGALS3 galectin 3 1 1
MIRT037601 IGSF8 immunoglobulin superfamily member 8 1 1
MIRT037602 LIN37 lin-37 DREAM MuvB core complex component 1 1
MIRT037603 PTPRF protein tyrosine phosphatase, receptor type F 1 1
MIRT037604 MTSS1L MTSS1L, I-BAR domain containing 1 1
MIRT037605 TRMT2A tRNA methyltransferase 2 homolog A 1 1
MIRT037606 DVL1 dishevelled segment polarity protein 1 1 1
MIRT037607 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 1 1
MIRT037608 TOR2A torsin family 2 member A 1 1
MIRT037609 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT037610 SMYD4 SET and MYND domain containing 4 1 1
MIRT037611 TJAP1 tight junction associated protein 1 1 1
MIRT037612 IRAK1 interleukin 1 receptor associated kinase 1 1 1
MIRT037613 PPM1M protein phosphatase, Mg2+/Mn2+ dependent 1M 1 1
MIRT037614 EIF4A2 eukaryotic translation initiation factor 4A2 1 1
MIRT037615 GFER growth factor, augmenter of liver regeneration 1 1
MIRT037616 PKP2 plakophilin 2 1 1
MIRT037617 FARSB phenylalanyl-tRNA synthetase beta subunit 1 1
MIRT037618 OPRD1 opioid receptor delta 1 1 1
MIRT037619 CCNY cyclin Y 1 1
MIRT037620 CNOT1 CCR4-NOT transcription complex subunit 1 1 1
MIRT037621 CXCL16 C-X-C motif chemokine ligand 16 1 1
MIRT037622 CEBPA CCAAT/enhancer binding protein alpha 1 1
MIRT037623 DDX11 DEAD/H-box helicase 11 1 1
MIRT037624 URB1 URB1 ribosome biogenesis 1 homolog (S. cerevisiae) 1 1
MIRT037625 SBF1 SET binding factor 1 1 1
MIRT037626 GNB2 G protein subunit beta 2 1 1
MIRT037627 KMT2D lysine methyltransferase 2D 2 3
MIRT037628 DDX17 DEAD-box helicase 17 1 1
MIRT037629 SORBS3 sorbin and SH3 domain containing 3 1 1
MIRT037630 TAPBP TAP binding protein 1 1
MIRT037631 BCR BCR, RhoGEF and GTPase activating protein 1 1
MIRT037632 RPL18 ribosomal protein L18 1 1
MIRT037633 INTS3 integrator complex subunit 3 1 1
MIRT037634 CDC25B cell division cycle 25B 1 1
MIRT037635 LDOC1L retrotransposon Gag like 6 1 1
MIRT037636 TUB tubby bipartite transcription factor 1 1
MIRT037637 NUDT2 nudix hydrolase 2 1 1
MIRT037638 CDAN1 codanin 1 1 1
MIRT037639 MRS2 MRS2, magnesium transporter 1 1
MIRT037640 PYGB glycogen phosphorylase B 1 1
MIRT037641 LDLRAD3 low density lipoprotein receptor class A domain containing 3 1 1
MIRT037642 COL5A1 collagen type V alpha 1 chain 1 1
MIRT037643 ATF7IP activating transcription factor 7 interacting protein 1 1
MIRT037644 AGO1 argonaute 1, RISC catalytic component 1 1
MIRT037645 ZNF212 zinc finger protein 212 1 1
MIRT037646 TSC2 TSC complex subunit 2 1 1
MIRT037647 FASN fatty acid synthase 1 1
MIRT037648 NOL9 nucleolar protein 9 1 1
MIRT037649 CLUH clustered mitochondria homolog 1 1
MIRT037650 PHF8 PHD finger protein 8 1 1
MIRT037651 EIF4G1 eukaryotic translation initiation factor 4 gamma 1 1 1
MIRT037652 TRAPPC12 trafficking protein particle complex 12 1 1
MIRT037653 HOXC11 homeobox C11 1 1
MIRT037654 DGCR14 ess-2 splicing factor homolog 1 1
MIRT037655 SLC25A1 solute carrier family 25 member 1 1 1
MIRT037656 MEX3C mex-3 RNA binding family member C 1 1
MIRT037657 RAI1 retinoic acid induced 1 1 1
MIRT037658 LY6E lymphocyte antigen 6 family member E 1 1
MIRT037659 SEC16A SEC16 homolog A, endoplasmic reticulum export factor 1 1
MIRT037660 RPL37 ribosomal protein L37 1 1
MIRT037661 CNN2 calponin 2 1 1
MIRT037662 ALDH18A1 aldehyde dehydrogenase 18 family member A1 1 1
MIRT037663 POMGNT1 protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-) 1 1
MIRT037664 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT037665 PIM3 Pim-3 proto-oncogene, serine/threonine kinase 1 1
MIRT037666 PTPMT1 protein tyrosine phosphatase, mitochondrial 1 1 1
MIRT037667 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT037668 ART5 ADP-ribosyltransferase 5 1 1
MIRT037669 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT037670 NCL nucleolin 1 1
MIRT037671 NCKAP5L NCK associated protein 5 like 1 1
MIRT037672 ZCCHC14 zinc finger CCHC-type containing 14 1 1
MIRT037673 CCDC71 coiled-coil domain containing 71 1 1
MIRT037674 SURF4 surfeit 4 1 1
MIRT037675 RPL13 ribosomal protein L13 1 1
MIRT037676 ACTN4 actinin alpha 4 1 1
MIRT037677 PA2G4 proliferation-associated 2G4 1 1
MIRT037678 MIF macrophage migration inhibitory factor 1 1
MIRT037679 UBE2N ubiquitin conjugating enzyme E2 N 1 1
MIRT037680 LYNX1 Ly6/neurotoxin 1 1 1
MIRT037681 TACC3 transforming acidic coiled-coil containing protein 3 1 1
MIRT037682 GSR glutathione-disulfide reductase 1 1
MIRT037683 GSK3A glycogen synthase kinase 3 alpha 1 1
MIRT037684 ZMYM3 zinc finger MYM-type containing 3 1 1
MIRT037685 ERP29 endoplasmic reticulum protein 29 1 1
MIRT037686 MATR3 matrin 3 1 1
MIRT037687 FANCG Fanconi anemia complementation group G 1 1
MIRT037688 FAM83G family with sequence similarity 83 member G 1 1
MIRT037689 DUSP18 dual specificity phosphatase 18 1 1
MIRT037690 MYC MYC proto-oncogene, bHLH transcription factor 3 2
MIRT037691 TSPAN7 tetraspanin 7 1 1
MIRT037692 ATMIN ATM interactor 1 1
MIRT037693 SEPT2 septin 2 1 1
MIRT037694 FOXRED2 FAD dependent oxidoreductase domain containing 2 1 1
MIRT037695 TECR trans-2,3-enoyl-CoA reductase 1 1
MIRT037696 MRPL11 mitochondrial ribosomal protein L11 1 1
MIRT037697 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT037698 PSMD4 proteasome 26S subunit, non-ATPase 4 1 1
MIRT037699 SH3GL1 SH3 domain containing GRB2 like 1, endophilin A2 1 1
MIRT037700 CTNNB1 catenin beta 1 1 1
MIRT037701 TMEM189 transmembrane protein 189 1 1
MIRT037702 LDLR low density lipoprotein receptor 1 1
MIRT037703 OGFR opioid growth factor receptor 1 1
MIRT037704 ADAP2 ArfGAP with dual PH domains 2 1 1
MIRT037705 LIPA lipase A, lysosomal acid type 1 1
MIRT037706 SNAPC4 small nuclear RNA activating complex polypeptide 4 1 1
MIRT037707 FBN2 fibrillin 2 1 1
MIRT037708 ZNF704 zinc finger protein 704 1 1
MIRT037709 EIF3M eukaryotic translation initiation factor 3 subunit M 1 1
MIRT037710 SMC1A structural maintenance of chromosomes 1A 1 1
MIRT037711 FZR1 fizzy and cell division cycle 20 related 1 1 1
MIRT037712 NANOS1 nanos C2HC-type zinc finger 1 1 1
MIRT037713 PRR12 proline rich 12 1 1
MIRT037714 PHC2 polyhomeotic homolog 2 1 1
MIRT037715 NOP9 NOP9 nucleolar protein 1 1
MIRT037716 HM13 histocompatibility minor 13 1 1
MIRT037717 PRDX5 peroxiredoxin 5 1 1
MIRT037718 IRGQ immunity related GTPase Q 1 1
MIRT037719 TGFB1 transforming growth factor beta 1 7 2
MIRT037720 MARCH3 membrane associated ring-CH-type finger 3 1 1
MIRT037721 TBX2 T-box 2 1 1
MIRT037722 TSC22D3 TSC22 domain family member 3 1 1
MIRT037723 DUT deoxyuridine triphosphatase 1 1
MIRT037724 FAM171A2 family with sequence similarity 171 member A2 1 1
MIRT037725 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT037726 FRAT1 FRAT1, WNT signaling pathway regulator 1 1
MIRT037727 PSMD11 proteasome 26S subunit, non-ATPase 11 1 1
MIRT037728 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT037729 ENO1 enolase 1 1 1
MIRT037730 AP3D1 adaptor related protein complex 3 delta 1 subunit 1 1
MIRT037731 TUBA1A tubulin alpha 1a 1 1
MIRT037732 ULK3 unc-51 like kinase 3 1 1
MIRT037733 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase type 1 alpha 1 1
MIRT037734 SLC25A46 solute carrier family 25 member 46 1 1
MIRT037735 MED15 mediator complex subunit 15 1 1
MIRT037736 IRF2BP1 interferon regulatory factor 2 binding protein 1 1 1
MIRT037737 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT037738 ATHL1 protein-glucosylgalactosylhydroxylysine glucosidase 1 1
MIRT037739 CTNNA1 catenin alpha 1 1 1
MIRT037740 ADRM1 adhesion regulating molecule 1 1 1
MIRT037741 CCDC106 coiled-coil domain containing 106 1 1
MIRT054493 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 3 1
MIRT451195 PIN1 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 2 2
MIRT452931 DISC1 disrupted in schizophrenia 1 2 2
MIRT455468 LYPLA2 lysophospholipase II 2 2
MIRT457068 TOR4A torsin family 4 member A 2 2
MIRT464195 VGLL4 vestigial like family member 4 2 4
MIRT483030 KHSRP KH-type splicing regulatory protein 2 4
MIRT486062 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT486120 INO80E INO80 complex subunit E 2 2
MIRT486866 DPF1 double PHD fingers 1 2 2
MIRT488343 PAX2 paired box 2 2 2
MIRT488790 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT490249 MFI2 melanotransferrin 2 2
MIRT490264 HAAO 3-hydroxyanthranilate 3,4-dioxygenase 2 2
MIRT490756 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT492321 SETD1B SET domain containing 1B 2 2
MIRT492851 NRGN neurogranin 2 2
MIRT499604 ANKRD45 ankyrin repeat domain 45 2 2
MIRT500189 BARX1 BARX homeobox 1 2 4
MIRT516765 FAM212B family with sequence similarity 212 member B 2 4
MIRT517949 TRIM59 tripartite motif containing 59 2 2
MIRT521182 SCAF4 SR-related CTD associated factor 4 2 2
MIRT526462 OSBPL5 oxysterol binding protein like 5 2 2
MIRT535148 PLEKHG5 pleckstrin homology and RhoGEF domain containing G5 2 2
MIRT569528 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 2
MIRT570593 NFIX nuclear factor I X 2 2
MIRT571219 F2R coagulation factor II thrombin receptor 2 2
MIRT574145 MARVELD1 MARVEL domain containing 1 2 2
MIRT608758 CACNA1A calcium voltage-gated channel subunit alpha1 A 2 2
MIRT649509 RAB17 RAB17, member RAS oncogene family 2 2
MIRT692165 RNF207 ring finger protein 207 2 2
MIRT703495 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT711081 NEUROD2 neuronal differentiation 2 2 2
MIRT712090 UNC13A unc-13 homolog A 2 2
MIRT712531 CYTH2 cytohesin 2 2 2
MIRT712755 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT712893 TGFA transforming growth factor alpha 2 2
MIRT714684 PRX periaxin 2 2
MIRT714723 VPS8 VPS8, CORVET complex subunit 2 2
MIRT714814 NOB1 NIN1/PSMD8 binding protein 1 homolog 2 2
MIRT716774 C1orf229 chromosome 1 open reading frame 229 2 2
MIRT717511 HRNR hornerin 2 2
MIRT717653 THBS2 thrombospondin 2 2 2
MIRT719595 PIAS4 protein inhibitor of activated STAT 4 2 2
MIRT720525 PTGR2 prostaglandin reductase 2 2 2
MIRT724925 VPS18 VPS18, CORVET/HOPS core subunit 2 2
MIRT737146 NOS3 nitric oxide synthase 3 1 0
MIRT756003 SLC7A5 solute carrier family 7 member 5 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-744 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-744 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-744 Ursodeoxycholic acid (UDCA) approved 31401 Microarray rat Liver 20689055 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-744 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901)
hsa-mir-744 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-744 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-744 Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-744 Fluorouracil 3385 NSC19893 approved resistant cell line (KYSE)
hsa-mir-744 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-744 Cisplatin 5460033 NSC119875 approved resistant cell line (SGC-7901)
hsa-miR-744-5p [1,1'-binaphthalene]-2,2',3,3'-tetrol 316673 NSC245006 sensitive
hsa-miR-744-5p 4-n-[12-[(5-amino-6-chloropyrimidin-4-yl)amino]dodecyl]-6-chloropyrimidine-4,5-diamine 358989 NSC619196 sensitive
hsa-miR-744-5p 5,7-dibromo-2-[(e)-2-(4-hydroxy-3-methoxyphenyl)ethenyl]quinolin-8-ol 135460261 NSC67090 sensitive
hsa-miR-744-5p Benzyl 2-(dibenzylamino)-3-phenylpropanoate 375616 NSC655438 sensitive
hsa-miR-744-5p N'-[(Z)-[(4Z)-2-(1,3-benzodioxol-5-yl)-4-[[4-oxo-4-[2-(trifluoromethyl)anilino]butanoyl]hydrazinylidene]chromen-3-ylidene]amino]-N-[2-(trifluoromethyl)phenyl]butanediamide 6399328 NSC641210 sensitive
hsa-miR-744-5p Paullone analog 47 396411 NSC702373 sensitive
hsa-miR-744-5p Ursa-11,13(18)-dien-28-oic acid-3.beta.-ol 378695 NSC661747 sensitive
hsa-miR-744-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-744-5p Carboplatin 38904 NSC241240 approved sensitive High Ovarian Cancer tissue and cell line (MDAH-2274, SKOV3)
hsa-miR-744-5p Gefitinib 123631 NSC715055 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-744-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-744-5p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-744-5p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-744-5p Erlotinib 176870 NSC718781 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-744-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-744-5p Sunitinib 5329102 NSC750690 approved sensitive High Renal Cell Cancer tissue
hsa-miR-744-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-744-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901, BGC-823)
hsa-miR-744-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (HCT-116)
hsa-miR-744-5p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma tissue
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-744-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-744-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-744-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-744-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-744-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-744-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-744-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-744-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-744-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-744-5p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-744-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-744-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-744-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-744-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-744-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)

Error report submission