miRTarBase - #MIRT016251


—
pre-miRNA Information
pre-miRNA hsa-mir-504   
Genomic Coordinates chrX: 138667711 - 138667793
Synonyms MIRN504, hsa-mir-504, MIR504
Description Homo sapiens miR-504 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-504-5p
Sequence 13| AGACCCUGGUCUGCACUCUAUC |34
Evidence Experimental
Experiments Array-cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1297440872 6 dbSNP
rs1429220261 12 dbSNP
rs745623382 14 dbSNP
rs770027520 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GADD45A   
Synonyms DDIT1, GADD45
Description growth arrest and DNA damage inducible alpha
Transcript NM_001924   
Expression
Putative miRNA Targets on GADD45A
3'UTR of GADD45A
(miRNA target sites are highlighted)		 
>GADD45A|NM_001924|3'UTR
   1 TGGCATCTGAATGAAAATAACTGAACCAAATTGCACTGAAGTTTTTGAAATACCTTTGTAGTTACTCAAGCAGTTACTCC
  81 CTACACTGATGCAAGGATTACAGAAACTGATGCCAAGGGGCTGAGTGAGTTCAACTACATGTTCTGGGGGCCCGGAGATA
 161 GATGACTTTGCAGATGGAAAGAGGTGAAAATGAAGAAGGAAGCTGTGTTGAAACAGAAAAATAAGTCAAAAGGAACAAAA
 241 ATTACAAAGAACCATGCAGGAAGGAAAACTATGTATTAATTTAGAATGGTTGAGTTACATTAAAATAAACCAAATATGTT
 321 AAAGTTTAAGTGTGCAGCCATAGTTTGGGTATTTTTGGTTTATATGCCCTCAAGTAAAAGAAAAGCCGAAAGGGTTAATC
 401 ATATTTGAAAACCATATTTTATTGTATTTTGATGAGATATTAAATTCTCAAAGTTTTATTATAAATTCTACTAAGTTATT
 481 TTATGACATGAAAAGTTATTTATGCTATAAATTTTTTGAAACACAATACCTACAATAAACTGGTATGAATAATTGCATCA
 561 TTTCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuaucucacgucuggUCCCAGa 5'
                         |||||: 
Target 5' aaaagaaaagccgaaAGGGTTa 3'
 376 - 397 104.00 -9.40
2 
miRNA  3' cuaUCUCACGUC-----UGGUCCCAga 5'
             || ||||||     ::: ||||  
Target 5' ttaAGTGTGCAGCCATAGTTTGGGTat 3'
 326 - 352 95.00 -17.00
3 
miRNA  3' cuauCUCACGUCUG--GUCCCAGa 5'
              |||| || ||  || | || 
Target 5' gagtGAGTTCA-ACTACATGTTCt 3'
 123 - 145 95.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN210349 12 COSMIC
COSN30528857 29 COSMIC
COSN30168163 68 COSMIC
COSN31495252 121 COSMIC
COSN30539622 155 COSMIC
COSN30131974 222 COSMIC
COSN31528800 448 COSMIC
COSN31520801 464 COSMIC
COSN31564848 512 COSMIC
COSN10052166 559 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs747192187 3 dbSNP
rs771244040 4 dbSNP
rs1301636832 6 dbSNP
rs1312154515 8 dbSNP
rs1244621593 10 dbSNP
rs775470989 11 dbSNP
rs749100782 27 dbSNP
rs3783479 28 dbSNP
rs555049615 32 dbSNP
rs766967108 38 dbSNP
rs912207897 40 dbSNP
rs1226623743 42 dbSNP
rs939678838 51 dbSNP
rs1468604086 53 dbSNP
rs1408068975 59 dbSNP
rs829 62 dbSNP
rs1157415035 68 dbSNP
rs1036746014 70 dbSNP
rs2620 73 dbSNP
rs1419889709 82 dbSNP
rs1188438672 84 dbSNP
rs1485208420 89 dbSNP
rs1237174927 91 dbSNP
rs830 91 dbSNP
rs1414039553 93 dbSNP
rs993103006 101 dbSNP
rs1448885703 102 dbSNP
rs919687082 112 dbSNP
rs931094109 115 dbSNP
rs574954890 120 dbSNP
rs895002145 121 dbSNP
rs1295621699 122 dbSNP
rs828 122 dbSNP
rs1013440448 123 dbSNP
rs1356217945 138 dbSNP
rs890670847 141 dbSNP
rs1046318333 149 dbSNP
rs1307327071 151 dbSNP
rs1345356338 154 dbSNP
rs907184804 155 dbSNP
rs1455157423 156 dbSNP
rs1416668862 160 dbSNP
rs1165544616 164 dbSNP
rs998820602 165 dbSNP
rs968906710 166 dbSNP
rs765183194 170 dbSNP
rs1187982582 174 dbSNP
rs1803610 179 dbSNP
rs1285057655 181 dbSNP
rs957475459 196 dbSNP
rs537536426 200 dbSNP
rs1463585294 209 dbSNP
rs113013145 213 dbSNP
rs796800817 221 dbSNP
rs3783480 222 dbSNP
rs1226969838 224 dbSNP
rs1309872001 229 dbSNP
rs1012103271 237 dbSNP
rs184525319 247 dbSNP
rs1308430916 252 dbSNP
rs2622 253 dbSNP
rs949366390 262 dbSNP
rs1362273734 275 dbSNP
rs2621 279 dbSNP
rs4633263 285 dbSNP
rs1432329910 287 dbSNP
rs1273067046 289 dbSNP
rs1481813749 299 dbSNP
rs751951195 306 dbSNP
rs577541931 311 dbSNP
rs1212339657 315 dbSNP
rs1347995210 321 dbSNP
rs750408401 321 dbSNP
rs1482688512 326 dbSNP
rs1179918479 328 dbSNP
rs987021752 333 dbSNP
rs1410297125 336 dbSNP
rs540552999 350 dbSNP
rs1421467800 359 dbSNP
rs762956812 363 dbSNP
rs1188154891 372 dbSNP
rs960989736 377 dbSNP
rs972422480 388 dbSNP
rs560153215 389 dbSNP
rs1207124123 414 dbSNP
rs1037433099 415 dbSNP
rs897552615 422 dbSNP
rs928984000 425 dbSNP
rs1372645274 430 dbSNP
rs931067153 433 dbSNP
rs1385690581 435 dbSNP
rs1358815628 437 dbSNP
rs1365457621 439 dbSNP
rs1299795649 443 dbSNP
rs754310561 450 dbSNP
rs1446165284 456 dbSNP
rs1391857645 458 dbSNP
rs1055308361 463 dbSNP
rs1290849234 468 dbSNP
rs916395639 472 dbSNP
rs1366424047 473 dbSNP
rs758756398 476 dbSNP
rs1179457849 485 dbSNP
rs949237416 489 dbSNP
rs573902878 491 dbSNP
rs1046266094 493 dbSNP
rs1251558765 494 dbSNP
rs1203390480 496 dbSNP
rs1349635463 505 dbSNP
rs1296069896 507 dbSNP
rs766329630 510 dbSNP
rs757883162 522 dbSNP
rs1050817 524 dbSNP
rs904717690 537 dbSNP
rs1235852361 545 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hu W; Chan CS; Wu R; Zhang C; Sun Y; Song et al.
- Molecular cell, 2010
Tumor suppressor p53 plays a central role in tumor prevention. p53 protein levels and activity are under a tight and complex regulation in cells to maintain the proper function of p53. MicroRNAs play a key role in the regulation of gene expression. Here we report the regulation of p53 through miR-504. miR-504 acts as a negative regulator of human p53 through its direct binding to two sites in the p53 3' untranslated region. Overexpression of miR-504 decreases p53 protein levels and functions in cells, including p53 transcriptional activity, p53-mediated apoptosis, and cell-cycle arrest in response to stress, and furthermore promotes tumorigenecity of cells in vivo. These results demonstrate the direct negative regulation of p53 by miR-504 as a mechanism for p53 regulation in cells, which highlights the importance of microRNAs in tumorigenesis.
LinkOut: [PMID: 20542001]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD -0.958 0.02 -1.000 0.5 4 Click to see details
HNSC 0.376 0.02 0.383 0.02 28 Click to see details
KIRC -0.263 0.03 -0.146 0.15 51 Click to see details
UCEC 0.435 0.05 0.339 0.11 15 Click to see details
BLCA -0.442 0.06 -0.305 0.14 14 Click to see details
PRAD -0.172 0.12 -0.171 0.12 50 Click to see details
BRCA 0.149 0.12 0.040 0.38 65 Click to see details
ESCA 0.62 0.13 0.700 0.09 5 Click to see details
KIRP -0.204 0.15 -0.152 0.22 28 Click to see details
COAD 0.402 0.25 0.200 0.37 5 Click to see details
CHOL -0.207 0.33 0.036 0.47 7 Click to see details
THCA 0.05 0.37 0.076 0.3 49 Click to see details
STAD -0.013 0.48 0.104 0.31 24 Click to see details
LUAD -0.011 0.49 0.055 0.44 11 Click to see details
LUSC -0.003 0.49 0.156 0.21 29 Click to see details
KICH 0.003 0.49 0.137 0.26 25 Click to see details
KICH 0.003 0.49 0.137 0.26 25 Click to see details
KICH 0.003 0.49 0.137 0.26 25 Click to see details
KICH 0.003 0.49 0.137 0.26 25 Click to see details
KICH 0.003 0.49 0.137 0.26 25 Click to see details
LIHC 0 0.5 -0.063 0.34 43 Click to see details
101 hsa-miR-504-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000044 DRD1 dopamine receptor D1 2 1
MIRT004457 VEGFA vascular endothelial growth factor A 2 1
MIRT016249 BAX BCL2 associated X, apoptosis regulator 1 1
MIRT016251 GADD45A growth arrest and DNA damage inducible alpha 1 1
MIRT016252 FAS Fas cell surface death receptor 1 1
MIRT016253 BBC3 BCL2 binding component 3 1 1
MIRT016254 TP53I3 tumor protein p53 inducible protein 3 1 1
MIRT016255 TCEAL1 transcription elongation factor A like 1 2 1
MIRT016256 MDM2 MDM2 proto-oncogene 2 1
MIRT016257 TP53 tumor protein p53 3 1
MIRT041072 P2RY13 purinergic receptor P2Y13 1 1
MIRT041073 PPIL1 peptidylprolyl isomerase like 1 1 1
MIRT041074 ZNF814 zinc finger protein 814 1 1
MIRT041075 HIST1H2AC histone cluster 1 H2A family member c 1 1
MIRT041076 FEM1A fem-1 homolog A 1 1
MIRT041077 TXNRD1 thioredoxin reductase 1 1 1
MIRT041078 RAI1 retinoic acid induced 1 1 1
MIRT041079 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT041080 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT041081 PDLIM1 PDZ and LIM domain 1 1 1
MIRT041082 FAM208B family with sequence similarity 208 member B 1 1
MIRT041083 PSAT1 phosphoserine aminotransferase 1 1 1
MIRT041084 TMEM8A transmembrane protein 8A 1 1
MIRT041085 RABGAP1 RAB GTPase activating protein 1 1 1
MIRT041086 BRD2 bromodomain containing 2 1 1
MIRT041087 C11orf58 chromosome 11 open reading frame 58 1 1
MIRT041088 CNOT8 CCR4-NOT transcription complex subunit 8 1 1
MIRT041089 RPL10 ribosomal protein L10 1 1
MIRT041090 SMCR7L mitochondrial elongation factor 1 1 1
MIRT041091 CENPBD1 CENPB DNA-binding domain containing 1 1 1
MIRT041092 SF3B1 splicing factor 3b subunit 1 1 1
MIRT041093 MTFP1 mitochondrial fission process 1 1 1
MIRT438313 CDK6 cyclin dependent kinase 6 1 1
MIRT438352 TFF1 trefoil factor 1 3 1
MIRT443009 KBTBD12 kelch repeat and BTB domain containing 12 2 2
MIRT448052 SFRP1 secreted frizzled related protein 1 2 2
MIRT457649 ZNF69 zinc finger protein 69 2 2
MIRT458626 TRIM72 tripartite motif containing 72 2 2
MIRT466176 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT472583 NACC1 nucleus accumbens associated 1 2 2
MIRT473576 MAT2A methionine adenosyltransferase 2A 2 6
MIRT485155 RASL10B RAS like family 10 member B 2 2
MIRT490063 PRRT2 proline rich transmembrane protein 2 2 2
MIRT493015 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT499425 PLCG2 phospholipase C gamma 2 2 11
MIRT506956 HOXB3 homeobox B3 2 4
MIRT507100 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508101 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT522215 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT530327 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT531042 ZNF502 zinc finger protein 502 2 2
MIRT532580 GSS glutathione synthetase 2 2
MIRT534841 RAB15 RAB15, member RAS oncogene family 2 2
MIRT536820 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT538303 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT546344 TFAP2C transcription factor AP-2 gamma 2 2
MIRT546704 RORA RAR related orphan receptor A 2 4
MIRT549222 BCL2L11 BCL2 like 11 2 4
MIRT549623 TMEM101 transmembrane protein 101 2 2
MIRT549931 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550163 ZNF223 zinc finger protein 223 2 4
MIRT550555 ARSK arylsulfatase family member K 2 2
MIRT553402 TRIM2 tripartite motif containing 2 2 4
MIRT554084 SNX4 sorting nexin 4 2 4
MIRT556962 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT558525 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT558565 CRLF3 cytokine receptor like factor 3 2 4
MIRT560946 TPM4 tropomyosin 4 2 4
MIRT561628 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT562174 HOXA13 homeobox A13 2 2
MIRT568635 ACVR2A activin A receptor type 2A 2 2
MIRT574908 Plcg2 phospholipase C, gamma 2 2 7
MIRT575177 Atg9a autophagy related 9A 2 2
MIRT611972 PKD1 polycystin 1, transient receptor potential channel interacting 2 2
MIRT613623 CLASP1 cytoplasmic linker associated protein 1 2 4
MIRT635830 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 4
MIRT637344 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 4
MIRT643205 JAK3 Janus kinase 3 2 2
MIRT650232 SIGLEC9 sialic acid binding Ig like lectin 9 2 2
MIRT655940 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT662021 ZNF445 zinc finger protein 445 2 2
MIRT662037 FUT2 fucosyltransferase 2 2 2
MIRT666873 POU2F2 POU class 2 homeobox 2 2 2
MIRT684310 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT687333 OSMR oncostatin M receptor 2 2
MIRT689008 ATP6AP1 ATPase H+ transporting accessory protein 1 2 2
MIRT695137 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695154 PRY PTPN13-like, Y-linked 2 2
MIRT700695 POLR3D RNA polymerase III subunit D 2 2
MIRT703269 GNL3L G protein nucleolar 3 like 2 2
MIRT708941 CRY2 cryptochrome circadian clock 2 2 2
MIRT709200 SAPCD2 suppressor APC domain containing 2 2 2
MIRT709572 PDE4A phosphodiesterase 4A 2 2
MIRT711295 PSME3 proteasome activator subunit 3 2 2
MIRT712425 MACROD2 MACRO domain containing 2 2 2
MIRT713941 PIGR polymeric immunoglobulin receptor 2 2
MIRT714124 TMED9 transmembrane p24 trafficking protein 9 2 2
MIRT714630 KIAA1143 KIAA1143 2 2
MIRT724046 SMIM14 small integral membrane protein 14 2 2
MIRT724649 PKDREJ polycystin family receptor for egg jelly 2 2
MIRT725476 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-504 Emodin NULL 3220 Microarray K562 cells 23744534 2013 down-regualted
miR-504 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-504 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-504 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-504 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-504-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-504-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-504-5p Plx-4720 24180719 NSC757438 sensitive High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-504-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-504-5p Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7, MCF-7-TT)
hsa-miR-504-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-504-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (A375)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-504-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-504-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-504-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-504-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-504-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-504-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-504-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H460)

Error report submission