miRTarBase - #MIRT020075


—
pre-miRNA Information
pre-miRNA hsa-mir-361   
Genomic Coordinates chrX: 85903636 - 85903707
Synonyms MIRN361, hsa-mir-361, MIR361
Description Homo sapiens miR-361 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-361-5p
Sequence 6| UUAUCAGAAUCUCCAGGGGUAC |27
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 9 X - 85903694 29233923 MiREDiBase
A-to-I 15 X - 85903688 29976955, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1201941835 9 dbSNP
rs1341659793 19 dbSNP
rs1430235395 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPUSD4   
Synonyms -
Description RNA pseudouridylate synthase domain containing 4
Transcript NM_001144827   
Other Transcripts NM_032795   
Expression
Putative miRNA Targets on RPUSD4
3'UTR of RPUSD4
(miRNA target sites are highlighted)		 
>RPUSD4|NM_001144827|3'UTR
   1 AGACCATGGGAGCACCCTGGCACCTGGGAGCACAGTGAAGACCCTGAGAGCATCCTGGCACCTGGGAGCGCAGGTTGGCC
  81 CCTGAACTGTTCTTTGTTTACAGGACTCTGCTAACTTCTCACTTGGAACAGACTGCGTAAGAGCCAGGTGGGATAAGGTA
 161 AAGCAACTCAGCTGCTACAGGGCTTTTAATGGAGAACAAAGTCTATTTACTGATAGTTTGGCTGCACTGTGGAAAAGCCT
 241 GCTGGAAGTCTCCCTGCCGTGGGCTCTCATTGCCAATATGGAACAGAGCCCAGGGCCAGGCAGACTGGGGCAGTGACTGG
 321 AAAAGGAAAACTAAAGGTCAGAATCCGGGATCAGGAACTGTTTTTATCCAGCAGTGAAGCTCTTGAGCTCTTAGGAAGGT
 401 TCCCGTGGTTGGAAAGAACATAATGGTTAACAAATATCACAGCATCCAGGGATTGCCCAGCTATAGTGTGGGTGCCCTAC
 481 TGAACTCTGATTAGGGAACCTGTATAAGGGTATTGAGTGTGAGGTTGAGGTGGGACATTTGCTGAGCAAGGAGAACCGAT
 561 GTGAATGGCAGGCAGATAACATGCACACATGAAGCTGGCTGGGTGTAAGGCAGTAGCGGGGAGCGGCATGCTGTCTAACA
 641 GCTGTTAGCTCCAGCTGGTTGTTGCCATGTGGGAATGGATTTTCTCATTTCTTCAGAGAAGCTGGAAACCTAGATATTTA
 721 TGTGAAACCTCCCAGTGTATTGCCAACTAAATCAAATTTTTAAAGATGCTTAGGCACCTAAGCAAATAATACTTAGAGGT
 801 TGAATTTGGTCTACAGGCTAGCAGTTTGCAGTCTATGTTTAATGAATGGTATAGAAGTTTGGGGAAAGGTGCCATCTTGA
 881 AAATTCTGGATCAGTGGTTGGCATTTTCGCTGCGTGTAGTATGTATCCTTTCTAGGCTTGGAGATGGCTTTGGTTGGTCC
 961 GTGAATGTAGTTATGAGAGTGCTGCCATTAAAAAATCAAAAATCTCTGTTGTGGAAGCGTATCTTCTGTTCTTAGGTCTC
1041 AGGAAGGAGAGGGCTATACTGAACACCATTAGGGATAGATGGAAATGACCTTGGCCTCCCTGCTCAGCTGGTCCATCTAG
1121 TTTCCACCTTGTTTCTTGCAAACAAATACACCTCACACTACTTTTTCTTTCTGACAGAGTTGGAGTGACAGCACAGTTAG
1201 GGGGGTACACCCCGGGACAGTCTTTATATGTTCCCTCTGTATAGATGATGCCACTTTCTAGCCCTTTCCCTGTCTCCATG
1281 GTACCCATTACTGTGCATAATAAATTTAACTTTGAAAGCACAGAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' caUGGG--GACCUCUAAGACUAuu 5'
            :|||  || || | ||||||  
Target 5' gtGCCCTACT-GA-ACTCTGATta 3'
 472 - 493 132.00 -13.90
2 
miRNA  3' cauggggaccucuaaGACUAUu 5'
                         |||||| 
Target 5' aacaaagtctatttaCTGATAg 3'
 195 - 216 120.00 -7.20
3 
miRNA  3' cauggGGACCUCUA---AGACUAuu 5'
               |:|||||||   |:||:|  
Target 5' ctaggCTTGGAGATGGCTTTGGTtg 3'
 932 - 956 117.00 -15.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN18721340 8 COSMIC
COSN30128611 9 COSMIC
COSN31490408 33 COSMIC
COSN30172015 46 COSMIC
COSN31499729 74 COSMIC
COSN30476773 81 COSMIC
COSN30479802 92 COSMIC
COSN30489515 102 COSMIC
COSN30151418 108 COSMIC
COSN26993408 111 COSMIC
COSN30179743 126 COSMIC
COSN21525964 136 COSMIC
COSN30520957 150 COSMIC
COSN191365 256 COSMIC
COSN17037768 411 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1420101714 3 dbSNP
rs58203163 5 dbSNP
rs1412494792 6 dbSNP
rs1037097469 8 dbSNP
rs1162779698 9 dbSNP
rs369445440 13 dbSNP
rs548898201 15 dbSNP
rs763821932 16 dbSNP
rs377059388 18 dbSNP
rs372548293 23 dbSNP
rs1307802518 29 dbSNP
rs367988189 32 dbSNP
rs1230711667 34 dbSNP
rs1256053295 34 dbSNP
rs1282944412 34 dbSNP
rs1002221353 38 dbSNP
rs1219199251 42 dbSNP
rs376223592 44 dbSNP
rs1488825032 46 dbSNP
rs369093867 47 dbSNP
rs1284794451 50 dbSNP
rs148371197 53 dbSNP
rs1446668479 61 dbSNP
rs1483921396 70 dbSNP
rs905218142 70 dbSNP
rs1040398847 73 dbSNP
rs1473112623 74 dbSNP
rs1243874078 75 dbSNP
rs1309327039 80 dbSNP
rs1208152372 84 dbSNP
rs1416854738 85 dbSNP
rs1043813935 89 dbSNP
rs944719600 92 dbSNP
rs1286195993 96 dbSNP
rs867938110 100 dbSNP
rs1412097379 107 dbSNP
rs1332711407 112 dbSNP
rs946822013 113 dbSNP
rs1205511954 115 dbSNP
rs1355294714 122 dbSNP
rs1449457001 132 dbSNP
rs1286029215 133 dbSNP
rs1363193168 134 dbSNP
rs373330680 136 dbSNP
rs760527115 137 dbSNP
rs1275629937 138 dbSNP
rs892629596 138 dbSNP
rs1247793617 144 dbSNP
rs1383045554 146 dbSNP
rs989196979 150 dbSNP
rs1189609364 151 dbSNP
rs1052611481 167 dbSNP
rs1245601513 180 dbSNP
rs547023334 182 dbSNP
rs1188754704 184 dbSNP
rs1391653173 190 dbSNP
rs944931107 191 dbSNP
rs145181487 194 dbSNP
rs986816957 198 dbSNP
rs1353553851 202 dbSNP
rs554762677 205 dbSNP
rs920970848 212 dbSNP
rs1024068450 215 dbSNP
rs1363040395 221 dbSNP
rs541564958 229 dbSNP
rs962445334 239 dbSNP
rs1015343041 245 dbSNP
rs1231422244 246 dbSNP
rs982595705 250 dbSNP
rs1005618121 252 dbSNP
rs1202039472 256 dbSNP
rs574137299 258 dbSNP
rs960876972 259 dbSNP
rs1464008292 263 dbSNP
rs563745613 264 dbSNP
rs1474432311 265 dbSNP
rs1431094395 266 dbSNP
rs996305484 269 dbSNP
rs576515403 271 dbSNP
rs758935472 273 dbSNP
rs900646429 289 dbSNP
rs1478563898 293 dbSNP
rs1243777284 294 dbSNP
rs1387119397 296 dbSNP
rs1040514122 297 dbSNP
rs1193891421 299 dbSNP
rs1387306759 304 dbSNP
rs1002552605 306 dbSNP
rs1450949068 307 dbSNP
rs772006567 310 dbSNP
rs1022338621 315 dbSNP
rs146547666 326 dbSNP
rs1269469861 333 dbSNP
rs578257702 346 dbSNP
rs1052578142 347 dbSNP
rs1208803542 347 dbSNP
rs1009055067 349 dbSNP
rs890643207 361 dbSNP
rs1202015629 368 dbSNP
rs1410297719 371 dbSNP
rs1472542559 373 dbSNP
rs1160569010 382 dbSNP
rs1415006100 385 dbSNP
rs1365540018 388 dbSNP
rs1340777367 390 dbSNP
rs1456480882 399 dbSNP
rs1270269585 404 dbSNP
rs770370291 405 dbSNP
rs1345398509 408 dbSNP
rs1164783611 409 dbSNP
rs932261255 411 dbSNP
rs1305953261 416 dbSNP
rs558170385 424 dbSNP
rs920897271 425 dbSNP
rs145669714 429 dbSNP
rs186338559 433 dbSNP
rs917126559 438 dbSNP
rs992642307 439 dbSNP
rs961182405 440 dbSNP
rs1015731613 445 dbSNP
rs1202655867 450 dbSNP
rs983823060 451 dbSNP
rs952444496 460 dbSNP
rs111250104 461 dbSNP
rs1408420463 462 dbSNP
rs1422631208 469 dbSNP
rs996420277 475 dbSNP
rs748911797 479 dbSNP
rs1421810162 480 dbSNP
rs1166968880 493 dbSNP
rs535590867 499 dbSNP
rs1430202032 515 dbSNP
rs569802213 517 dbSNP
rs770279577 522 dbSNP
rs1376859302 529 dbSNP
rs927826308 534 dbSNP
rs1168548994 536 dbSNP
rs149924541 537 dbSNP
rs369374124 550 dbSNP
rs7117628 555 dbSNP
rs1009448091 557 dbSNP
rs1022264902 558 dbSNP
rs1341832732 560 dbSNP
rs891883059 561 dbSNP
rs1010925823 562 dbSNP
rs956721187 565 dbSNP
rs1031074565 569 dbSNP
rs1181852335 571 dbSNP
rs570453719 576 dbSNP
rs1490435967 584 dbSNP
rs1053591045 587 dbSNP
rs1000215244 589 dbSNP
rs1250622552 591 dbSNP
rs546984789 594 dbSNP
rs375691984 595 dbSNP
rs904554169 597 dbSNP
rs375984011 605 dbSNP
rs781759026 609 dbSNP
rs1357271538 617 dbSNP
rs1465432310 618 dbSNP
rs74435010 620 dbSNP
rs1062002 621 dbSNP
rs948656960 624 dbSNP
rs627911 625 dbSNP
rs1296290382 632 dbSNP
rs1365430653 635 dbSNP
rs1216027649 636 dbSNP
rs899445263 639 dbSNP
rs539314286 643 dbSNP
rs1209953962 650 dbSNP
rs1264344578 652 dbSNP
rs1462670943 663 dbSNP
rs939809023 665 dbSNP
rs780137096 667 dbSNP
rs1323479733 674 dbSNP
rs1247537195 675 dbSNP
rs908303321 676 dbSNP
rs1281866081 678 dbSNP
rs941015571 684 dbSNP
rs984246424 694 dbSNP
rs1432415114 702 dbSNP
rs758423693 714 dbSNP
rs1431318584 721 dbSNP
rs1455608945 722 dbSNP
rs182455993 722 dbSNP
rs750595098 730 dbSNP
rs1388802392 736 dbSNP
rs548235026 746 dbSNP
rs920951029 749 dbSNP
rs374061557 757 dbSNP
rs939131244 781 dbSNP
rs1365884659 788 dbSNP
rs964941538 792 dbSNP
rs765498066 793 dbSNP
rs571198680 800 dbSNP
rs981014736 814 dbSNP
rs1469315129 819 dbSNP
rs1427136611 823 dbSNP
rs969269209 835 dbSNP
rs1218162519 837 dbSNP
rs915150063 838 dbSNP
rs1480720832 847 dbSNP
rs1414202472 852 dbSNP
rs1407055890 859 dbSNP
rs956376058 868 dbSNP
rs1191521051 877 dbSNP
rs192081173 884 dbSNP
rs544066883 896 dbSNP
rs578248394 897 dbSNP
rs1208833813 902 dbSNP
rs1401974486 903 dbSNP
rs1459533335 906 dbSNP
rs987541145 908 dbSNP
rs954964047 909 dbSNP
rs564819319 913 dbSNP
rs541751801 914 dbSNP
rs1012887782 917 dbSNP
rs895737815 921 dbSNP
rs572434279 922 dbSNP
rs899367107 925 dbSNP
rs186008000 927 dbSNP
rs1182974601 932 dbSNP
rs1016449812 938 dbSNP
rs1223574517 951 dbSNP
rs117051385 953 dbSNP
rs576494750 956 dbSNP
rs1452013088 960 dbSNP
rs139163920 961 dbSNP
rs1404086529 979 dbSNP
rs1179577610 982 dbSNP
rs1412529285 987 dbSNP
rs539293242 1003 dbSNP
rs1047178520 1006 dbSNP
rs112936743 1008 dbSNP
rs480153 1019 dbSNP
rs533851078 1021 dbSNP
rs1336833817 1024 dbSNP
rs1445070458 1031 dbSNP
rs1282484627 1033 dbSNP
rs1378546266 1035 dbSNP
rs1156693337 1044 dbSNP
rs181082530 1046 dbSNP
rs947852185 1056 dbSNP
rs915117089 1058 dbSNP
rs1339748607 1060 dbSNP
rs547906180 1063 dbSNP
rs1408270841 1065 dbSNP
rs528226549 1071 dbSNP
rs935246290 1072 dbSNP
rs964993294 1075 dbSNP
rs1236327423 1085 dbSNP
rs1444747204 1090 dbSNP
rs1051454362 1095 dbSNP
rs567343039 1095 dbSNP
rs1183634285 1096 dbSNP
rs1168348331 1099 dbSNP
rs1483884067 1102 dbSNP
rs1412075708 1108 dbSNP
rs568902445 1112 dbSNP
rs1358609738 1115 dbSNP
rs1453502770 1125 dbSNP
rs954790740 1127 dbSNP
rs1363251725 1133 dbSNP
rs549215629 1139 dbSNP
rs1228033887 1140 dbSNP
rs978944562 1145 dbSNP
rs1029477170 1150 dbSNP
rs1341229936 1153 dbSNP
rs974821132 1156 dbSNP
rs1277854642 1157 dbSNP
rs1461748741 1166 dbSNP
rs1204979292 1169 dbSNP
rs963509040 1174 dbSNP
rs1380831157 1184 dbSNP
rs1464151206 1185 dbSNP
rs927325528 1194 dbSNP
rs1016418772 1201 dbSNP
rs1012939946 1202 dbSNP
rs1005057375 1204 dbSNP
rs759468973 1205 dbSNP
rs1453071574 1206 dbSNP
rs1171287660 1207 dbSNP
rs1429174376 1208 dbSNP
rs1004558573 1213 dbSNP
rs1286977791 1214 dbSNP
rs188508758 1219 dbSNP
rs1434577036 1222 dbSNP
rs1319236653 1223 dbSNP
rs774169089 1226 dbSNP
rs1274065321 1228 dbSNP
rs1048736624 1233 dbSNP
rs1225334905 1236 dbSNP
rs1345625893 1250 dbSNP
rs931111896 1263 dbSNP
rs899612387 1264 dbSNP
rs1039401169 1273 dbSNP
rs943778120 1274 dbSNP
rs1197162554 1276 dbSNP
rs1268706597 1284 dbSNP
rs1481045100 1287 dbSNP
rs906222694 1292 dbSNP
rs1409768113 1295 dbSNP
rs533520221 1297 dbSNP
rs1045213582 1300 dbSNP
rs564683238 1304 dbSNP
rs947819628 1322 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE27834 Pluripotent stem cells -0.543 1.5e-2 -0.559 1.2e-2 16 Click to see details
GSE19536 Breast cancer -0.19 2.9e-2 -0.198 2.4e-2 100 Click to see details
GSE26953 Aortic valvular endothelial cells 0.38 3.4e-2 0.371 3.7e-2 24 Click to see details
GSE19783 ER- ER- breast cancer -0.206 3.4e-2 -0.210 3.2e-2 79 Click to see details
GSE21687 Ependynoma primary tumors -0.204 5.3e-2 -0.212 4.6e-2 64 Click to see details
GSE21849 B cell lymphoma -0.301 5.6e-2 -0.263 8.4e-2 29 Click to see details
GSE28544 Breast cancer -0.251 1.2e-1 -0.248 1.2e-1 24 Click to see details
GSE32688 Pancreatic cancer -0.163 1.9e-1 -0.153 2.0e-1 32 Click to see details
GSE17306 Multiple myeloma -0.109 2.3e-1 -0.063 3.3e-1 49 Click to see details
GSE21032 Prostate cancer -0.056 3.1e-1 -0.109 1.6e-1 83 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.105 3.1e-1 0.152 2.3e-1 25 Click to see details
GSE14794 Lymphoblastoid cells 0.048 3.3e-1 0.077 2.4e-1 90 Click to see details
GSE38226 Liver fibrosis -0.101 3.3e-1 -0.181 2.2e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.085 3.4e-1 0.038 4.3e-1 25 Click to see details
GSE28260 Renal cortex and medulla -0.119 3.5e-1 0.055 4.3e-1 13 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.109 3.9e-1 0.267 2.4e-1 9 Click to see details
GSE19350 CNS germ cell tumors 0.044 4.5e-1 -0.014 4.8e-1 12 Click to see details
GSE42095 Differentiated embryonic stem cells -0.027 4.5e-1 -0.114 3.0e-1 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.021 4.6e-1 0.054 4.1e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.012 4.8e-1 0.090 3.5e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA 0.31 0.01 0.236 0.04 59 Click to see details
CESC 0.997 0.02 1.000 0.5 3 Click to see details
COAD -0.642 0.04 -0.262 0.27 8 Click to see details
BRCA -0.174 0.06 -0.151 0.09 84 Click to see details
KIRC 0.189 0.06 0.212 0.04 68 Click to see details
ESCA -0.433 0.09 -0.582 0.03 11 Click to see details
UCEC 0.269 0.13 0.193 0.21 19 Click to see details
PRAD 0.151 0.15 0.117 0.21 50 Click to see details
STAD -0.165 0.18 -0.279 0.06 32 Click to see details
LUAD 0.163 0.31 0.266 0.2 12 Click to see details
KICH 0.103 0.31 0.088 0.34 25 Click to see details
PCPG 0.472 0.34 0.500 0.33 3 Click to see details
LUSC -0.058 0.36 0.061 0.36 38 Click to see details
HNSC 0.042 0.4 0.103 0.26 42 Click to see details
KIRP 0.043 0.41 -0.007 0.48 32 Click to see details
PAAD -0.159 0.42 -0.400 0.3 4 Click to see details
CHOL 0.014 0.49 0.067 0.43 9 Click to see details
BLCA -0.006 0.49 0.131 0.3 18 Click to see details
LIHC 0.002 0.49 -0.026 0.43 49 Click to see details
LIHC 0.002 0.49 -0.026 0.43 49 Click to see details
LIHC 0.002 0.49 -0.026 0.43 49 Click to see details
152 hsa-miR-361-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004447 VEGFA vascular endothelial growth factor A 4 3
MIRT020074 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT020075 RPUSD4 RNA pseudouridylate synthase domain containing 4 1 1
MIRT020076 DEPDC1B DEP domain containing 1B 1 1
MIRT020077 CENPQ centromere protein Q 1 1
MIRT020078 EAPP E2F associated phosphoprotein 1 1
MIRT020079 CD46 CD46 molecule 1 1
MIRT020080 EDC3 enhancer of mRNA decapping 3 1 1
MIRT020081 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT020082 ZNF92 zinc finger protein 92 1 1
MIRT020083 ZNF776 zinc finger protein 776 1 1
MIRT020084 ARF4 ADP ribosylation factor 4 1 1
MIRT020085 WDR36 WD repeat domain 36 1 1
MIRT020086 ZMYND11 zinc finger MYND-type containing 11 1 1
MIRT020087 FGFR1OP2 FGFR1 oncogene partner 2 1 1
MIRT020088 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT020089 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT020090 CEBPG CCAAT/enhancer binding protein gamma 1 1
MIRT020091 KLHL28 kelch like family member 28 1 1
MIRT020092 G3BP2 G3BP stress granule assembly factor 2 1 1
MIRT020093 SRSF3 serine and arginine rich splicing factor 3 2 3
MIRT020094 RNF141 ring finger protein 141 1 1
MIRT020095 YOD1 YOD1 deubiquitinase 1 1
MIRT020096 DUSP3 dual specificity phosphatase 3 2 3
MIRT020097 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT020098 GTF2E1 general transcription factor IIE subunit 1 1 1
MIRT020099 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT020100 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT020101 ARCN1 archain 1 1 1
MIRT020102 RNF4 ring finger protein 4 1 1
MIRT020103 CPOX coproporphyrinogen oxidase 1 1
MIRT020104 CDC123 cell division cycle 123 1 1
MIRT044053 SLC30A5 solute carrier family 30 member 5 1 1
MIRT044054 ATP6V1A ATPase H+ transporting V1 subunit A 1 1
MIRT044055 TMEM62 transmembrane protein 62 1 1
MIRT044056 ZNF554 zinc finger protein 554 1 1
MIRT044057 MAGEF1 MAGE family member F1 1 1
MIRT044058 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT044059 DDX23 DEAD-box helicase 23 1 1
MIRT044060 BSG basigin (Ok blood group) 1 1
MIRT044061 VCPIP1 valosin containing protein interacting protein 1 1 1
MIRT044062 VCP valosin containing protein 1 1
MIRT044063 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT044064 SLC25A5 solute carrier family 25 member 5 1 1
MIRT044065 ZNF207 zinc finger protein 207 1 1
MIRT044066 EGFL7 EGF like domain multiple 7 1 1
MIRT044067 SETD1A SET domain containing 1A 1 1
MIRT044068 KIAA1549L KIAA1549 like 1 1
MIRT044069 COX1 cytochrome c oxidase subunit I 1 1
MIRT044070 SON SON DNA binding protein 1 1
MIRT044071 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT044072 PPA1 pyrophosphatase (inorganic) 1 1 1
MIRT044073 DCTN1 dynactin subunit 1 1 1
MIRT044074 ERAL1 Era like 12S mitochondrial rRNA chaperone 1 1 1
MIRT044075 CYCS cytochrome c, somatic 1 1
MIRT044076 ACTG1 actin gamma 1 1 1
MIRT044077 RANBP17 RAN binding protein 17 1 1
MIRT044078 QTRTD1 queuine tRNA-ribosyltransferase accessory subunit 2 1 1
MIRT044079 NCOA6 nuclear receptor coactivator 6 1 1
MIRT044080 ACLY ATP citrate lyase 1 1
MIRT044081 LNPEP leucyl and cystinyl aminopeptidase 1 1
MIRT044082 C14orf80 tubulin epsilon and delta complex 1 1 1
MIRT044083 VBP1 VHL binding protein 1 1 1
MIRT044084 OGDH oxoglutarate dehydrogenase 1 1
MIRT044085 ASH1L ASH1 like histone lysine methyltransferase 1 1
MIRT044086 MDC1 mediator of DNA damage checkpoint 1 1 1
MIRT044087 RPS2 ribosomal protein S2 1 1
MIRT044088 UCK2 uridine-cytidine kinase 2 1 1
MIRT044089 PRPF8 pre-mRNA processing factor 8 1 1
MIRT044090 GSPT1 G1 to S phase transition 1 1 1
MIRT044091 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT044092 USP22 ubiquitin specific peptidase 22 1 1
MIRT044093 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT044094 CNOT2 CCR4-NOT transcription complex subunit 2 1 1
MIRT044095 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT044096 WBP2 WW domain binding protein 2 1 1
MIRT044097 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT044098 GPC6 glypican 6 1 1
MIRT044099 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT044100 EIF3C eukaryotic translation initiation factor 3 subunit C 1 1
MIRT044101 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT044102 DOCK6 dedicator of cytokinesis 6 1 1
MIRT044103 ECD ecdysoneless cell cycle regulator 1 1
MIRT044104 EPHA4 EPH receptor A4 1 1
MIRT044105 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT044106 PSMD2 proteasome 26S subunit, non-ATPase 2 1 1
MIRT044107 RAE1 ribonucleic acid export 1 1 1
MIRT044108 RAVER1 ribonucleoprotein, PTB binding 1 1 1
MIRT044109 TP53BP1 tumor protein p53 binding protein 1 1 1
MIRT044110 COPS7A COP9 signalosome subunit 7A 1 1
MIRT044111 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT044112 CDK2 cyclin dependent kinase 2 1 1
MIRT044113 NOP2 NOP2 nucleolar protein 1 1
MIRT112226 MDM4 MDM4, p53 regulator 2 2
MIRT127737 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT226898 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT235959 BACH1 BTB domain and CNC homolog 1 2 2
MIRT241215 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT243416 ZMAT3 zinc finger matrin-type 3 2 2
MIRT294566 ZNF460 zinc finger protein 460 2 4
MIRT321041 RAC1 Rac family small GTPase 1 2 4
MIRT437351 STAT6 signal transducer and activator of transcription 6 3 1
MIRT438339 SND1 staphylococcal nuclease and tudor domain containing 1 3 1
MIRT444521 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT447699 ERP44 endoplasmic reticulum protein 44 2 2
MIRT464962 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT468193 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT473767 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT482630 AAR2 AAR2 splicing factor homolog 2 2
MIRT484150 CENPN centromere protein N 2 2
MIRT490457 PROSER2 proline and serine rich 2 2 2
MIRT493066 MTCH1 mitochondrial carrier 1 2 2
MIRT493579 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT506495 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT514833 ZNF154 zinc finger protein 154 2 6
MIRT519028 KYNU kynureninase 2 6
MIRT521750 PPIL1 peptidylprolyl isomerase like 1 2 4
MIRT522899 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 4
MIRT527368 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT530684 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT531397 TMEM18 transmembrane protein 18 2 2
MIRT533163 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT534579 RPL28 ribosomal protein L28 2 2
MIRT545955 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT553282 TSR1 TSR1, ribosome maturation factor 2 2
MIRT553531 TMEM185B transmembrane protein 185B 2 4
MIRT555601 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT556005 NAPG NSF attachment protein gamma 2 2
MIRT556738 KLHL15 kelch like family member 15 2 2
MIRT556971 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT558904 CCDC58 coiled-coil domain containing 58 2 2
MIRT559220 BLMH bleomycin hydrolase 2 2
MIRT559821 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT562671 AKT3 AKT serine/threonine kinase 3 2 2
MIRT564793 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT564827 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT570505 TFIP11 tuftelin interacting protein 11 2 2
MIRT571381 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572562 AFF1 AF4/FMR2 family member 1 2 2
MIRT610398 AR androgen receptor 2 2
MIRT641614 DEFB118 defensin beta 118 2 2
MIRT642143 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT643846 EPGN epithelial mitogen 2 4
MIRT651751 VEGFB vascular endothelial growth factor B 2 2
MIRT657353 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT662436 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT700990 PDE3A phosphodiesterase 3A 2 2
MIRT707393 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT712064 XRCC5 X-ray repair cross complementing 5 2 2
MIRT721145 PLCL1 phospholipase C like 1 (inactive) 2 2
MIRT724466 SMAD2 SMAD family member 2 2 2
MIRT731374 CXCR6 C-X-C motif chemokine receptor 6 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-361 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-361 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-361 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-361 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-361 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-361 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
miR-361-5p Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-mir-361 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-361 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-361-5p (5r,6s)-5-phenyl-3,4-diazatricyclo[8.4.0.02,6]tetradeca-1(14),2,10,12-tetraene-4-carbothioamide 5467466 NSC652809 sensitive
hsa-miR-361-5p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-361-5p [(4e,6z,8r,9r,10e,12r,13r,14r,16r)-9-carbamoyloxy-8,14-dimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-19-(prop-2-enylamino)-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-13-yl] 5-aminopentanoate 5469153 NSC683666 sensitive
hsa-miR-361-5p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-361-5p 2-(1-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468781 NSC676184 sensitive
hsa-miR-361-5p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-361-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-361-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-361-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-361-5p 4-[3-(3,4-dihydro-1h-isoquinolin-2-yl)prop-1-en-2-yl]-n-pyrazin-2-ylbenzamide 24205286 NSC734949 sensitive
hsa-miR-361-5p 6-(acetylamino)-2-(3-fluorophenyl)quinolin-4(1h)-one 376375 NSC657277 sensitive
hsa-miR-361-5p 6-aryl alkyl fluoro quinolone derivative 135465400 NSC731099 resistant
hsa-miR-361-5p 7-bromo-2,4,7-triphenyl-6H-benzo[a]quinolizin-5-ium;bromide 386208 NSC677924 sensitive
hsa-miR-361-5p 7-epi-10-deacetylbaccatin iii 6712096 NSC656178 sensitive
hsa-miR-361-5p Acetonitrile;iridium;tetramethyl buta-1,3-diene-1,2,3,4-tetracarboxylate;triphenylphosphane;triphenylphosphanium;tetrafluoroborate 498529 NSC630734 sensitive
hsa-miR-361-5p Antineoplastic-642316 369949 NSC642316 sensitive
hsa-miR-361-5p Auranofin 6333901 NSC321521 sensitive
hsa-miR-361-5p Ayanin 5280682 NSC691652 resistant
hsa-miR-361-5p Bis(trifluoromethylsulfonyl)azanide;trihexyl(tetradecyl)phosphanium 11181836 NSC747251 sensitive
hsa-miR-361-5p Capri blue 102162 NSC7821 sensitive
hsa-miR-361-5p Cbdive_010867 269887 NSC111580 resistant
hsa-miR-361-5p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-361-5p Ethyl 3-(9-chloro-4-hydroxy-2,5,11-trimethyl-6h-pyrido[3,2-b]carbazol-3-yl)propanoate 386719 NSC679261 sensitive
hsa-miR-361-5p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 sensitive
hsa-miR-361-5p Jasplakinolide epoxide c 372550 NSC647763 sensitive
hsa-miR-361-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 resistant
hsa-miR-361-5p N'-butyl-4-[2-[2-[4-(N'-butylcarbamimidoyl)phenoxy]ethylsulfanyl]ethoxy]benzenecarboximidamide;hydrochloride 54613223 NSC750501 sensitive
hsa-miR-361-5p N-(1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl)benzamide 369939 NSC642306 sensitive
hsa-miR-361-5p Rogiolol 402519 NSC716545 sensitive
hsa-miR-361-5p Salinomycin, sodium 60148415 NSC758465 sensitive
hsa-miR-361-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7, MDA-MB-231)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-361-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-miR-361-5p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-361-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-361-5p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-361-5p Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-361-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-361-5p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive Low Gastric Cancer cell line (SGC-7901, MKN28)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-361-5p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (MGC-803)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-361-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-361-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-361-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-361-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-361-5p Testosterone+Tamoxifen sensitive cell line (MCF-7)
hsa-miR-361-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-361-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-361-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-361-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-361-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-361-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MDAH-2774)

Error report submission