miRTarBase - #MIRT020076


—
pre-miRNA Information
pre-miRNA hsa-mir-361   
Genomic Coordinates chrX: 85903636 - 85903707
Synonyms MIRN361, hsa-mir-361, MIR361
Description Homo sapiens miR-361 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-361-5p
Sequence 6| UUAUCAGAAUCUCCAGGGGUAC |27
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 9 X - 85903694 29233923 MiREDiBase
A-to-I 15 X - 85903688 29976955, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1201941835 9 dbSNP
rs1341659793 19 dbSNP
rs1430235395 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DEPDC1B   
Synonyms BRCC3, XTP1
Description DEP domain containing 1B
Transcript NM_001145208   
Other Transcripts NM_018369   
Expression
Putative miRNA Targets on DEPDC1B
3'UTR of DEPDC1B
(miRNA target sites are highlighted)		 
>DEPDC1B|NM_001145208|3'UTR
   1 TAATACTTCCACAGCAACAGGTGCTAGAGACCACTGTTGTTGTTTTGAGTGAATGGTGGTTAGGAGAAAGACTTTGGTGG
  81 TGGAAGAAAGAAAAGCATAAAACAAAGACTACTGAAATATAGATAAAGATTGCCTTAGTTTTTAAAAATGTTTGGCCATT
 161 AGTATTTTTATAAAACTCAATGCTAGTTTTAAAGTGTATAAATTGGTTAAAATTTATGAGTCAAATATATAGTGATAATG
 241 TTAACATGTTTGTAATTGCTACAGAATTTAAGGGTATTTTTATCTCTGTGCTTTCTTTTTCATGGTGTTTATTAAATAAT
 321 TGTGTATATACATCCTAGCTACTGATATCTTTATTATAGCCTTAAGACTTAATTTTAAGTCTTAAAAATAGCGTGTATAC
 401 TTGAATAAGAAAGACACTGGGTACTGTTACTGTGATGCTATTGACTTAGTAGCCAATTATCATTTCTCCTGTATAAATTC
 481 CAGTTTTTATTGCTGCACATAAATTTTTTAATGTCTTATATTGTGATAGCTATGTCTTTTATTGCAGATTTATTGGATGT
 561 TATGACAGATTTTACTAAAGCTAGTGTTTTTATAACATATATATTAGTTGATGTTTACCTATAAGTGGAGTAGATTTTCA
 641 TCTGCCTGCAATGGTATAATTTCAGTCTTAGCTAAAAATGGAAAGTTGAACTGGATAAATTCTTTGGGTACCCTTAGACC
 721 TCTGATTCTAAGTCAAATGCAAATGGGTTAAATAAAATGAGACTACTTCCTTTATAAATATATTTTCATCCTTTTGAAAG
 801 TAAGTGAAATGTAAATAAACTTATTTTTTTTAAAAATGCCAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' caUGGGGACCUCU-AAGACUAuu 5'
            ||||:|  |||  ||||||  
Target 5' gtACCCTT--AGACCTCTGATtc 3'
 708 - 728 140.00 -16.80
2 
miRNA  3' caUG-GGGACCUCUAAGACUAUu 5'
            || :|||  || | |||||| 
Target 5' atACATCCT--AGCTACTGATAt 3'
 328 - 348 128.00 -9.30
3 
miRNA  3' caUGGGGACCUCUAAGACUAUu 5'
            |: :||  | ||| ||||| 
Target 5' taATGTCT-TATATTGTGATAg 3'
 509 - 529 123.00 -7.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN2112880 3 COSMIC
COSN31495278 36 COSMIC
COSN27982518 40 COSMIC
COSN30185411 40 COSMIC
COSN31528689 42 COSMIC
COSN31540887 50 COSMIC
COSN31558517 54 COSMIC
COSN31546301 57 COSMIC
COSN7948903 96 COSMIC
COSN30137499 132 COSMIC
COSN31575720 157 COSMIC
COSN31542223 256 COSMIC
COSN1317706 284 COSMIC
COSN28718184 290 COSMIC
COSN31489738 349 COSMIC
COSN25533712 433 COSMIC
COSN26584704 555 COSMIC
COSN31583256 702 COSMIC
COSN5608369 812 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs556463378 6 dbSNP
rs1388195301 7 dbSNP
rs536280731 9 dbSNP
rs776026620 10 dbSNP
rs1369497716 16 dbSNP
rs770577370 18 dbSNP
rs760211801 31 dbSNP
rs543172318 33 dbSNP
rs769126100 36 dbSNP
rs749735121 38 dbSNP
rs574305437 39 dbSNP
rs1460380000 40 dbSNP
rs966461421 43 dbSNP
rs756309095 45 dbSNP
rs1397282340 47 dbSNP
rs1468732122 49 dbSNP
rs1264681507 50 dbSNP
rs554458770 53 dbSNP
rs1419338872 70 dbSNP
rs773825743 76 dbSNP
rs1013167823 80 dbSNP
rs1170566611 83 dbSNP
rs896164572 98 dbSNP
rs1036347445 114 dbSNP
rs1001835217 115 dbSNP
rs768244156 120 dbSNP
rs1299017089 121 dbSNP
rs1378734583 121 dbSNP
rs781503102 123 dbSNP
rs769240764 133 dbSNP
rs1356114294 134 dbSNP
rs906009666 139 dbSNP
rs1037905254 143 dbSNP
rs942186721 145 dbSNP
rs1359806116 155 dbSNP
rs886498354 156 dbSNP
rs1206382741 158 dbSNP
rs1251606474 160 dbSNP
rs376138587 178 dbSNP
rs1482742395 181 dbSNP
rs903337857 183 dbSNP
rs1259065518 186 dbSNP
rs1047843115 187 dbSNP
rs933273636 196 dbSNP
rs866755598 214 dbSNP
rs1160297024 221 dbSNP
rs975061949 227 dbSNP
rs1014493115 233 dbSNP
rs1430754531 240 dbSNP
rs1250155893 259 dbSNP
rs943323753 261 dbSNP
rs1358904730 270 dbSNP
rs1464749770 273 dbSNP
rs1314976453 283 dbSNP
rs1485746052 291 dbSNP
rs894744864 291 dbSNP
rs748739511 295 dbSNP
rs1276326760 298 dbSNP
rs925094812 299 dbSNP
rs1236359242 304 dbSNP
rs575979454 305 dbSNP
rs1296056496 311 dbSNP
rs1311369911 312 dbSNP
rs1230660459 316 dbSNP
rs930626537 322 dbSNP
rs899197061 326 dbSNP
rs966519365 331 dbSNP
rs1020628324 340 dbSNP
rs1487152659 342 dbSNP
rs991905458 347 dbSNP
rs1187560764 349 dbSNP
rs1318298985 352 dbSNP
rs1284711644 353 dbSNP
rs1227486029 358 dbSNP
rs960361103 371 dbSNP
rs1175826981 373 dbSNP
rs1036839639 377 dbSNP
rs780152430 379 dbSNP
rs1002182975 386 dbSNP
rs1295119925 392 dbSNP
rs970310217 393 dbSNP
rs1289346647 394 dbSNP
rs1016943551 395 dbSNP
rs1006352017 399 dbSNP
rs534504876 411 dbSNP
rs1438424091 414 dbSNP
rs886613094 417 dbSNP
rs1348160688 420 dbSNP
rs1238918767 428 dbSNP
rs866562750 433 dbSNP
rs1318172091 438 dbSNP
rs1302300134 439 dbSNP
rs6886085 440 dbSNP
rs1487760171 447 dbSNP
rs1195904400 449 dbSNP
rs1347124276 450 dbSNP
rs1321643813 453 dbSNP
rs141545203 454 dbSNP
rs557701717 456 dbSNP
rs921181792 458 dbSNP
rs769838776 462 dbSNP
rs1401357651 464 dbSNP
rs1159813905 466 dbSNP
rs537930915 469 dbSNP
rs957028780 473 dbSNP
rs1424872790 482 dbSNP
rs569371269 484 dbSNP
rs1371394761 487 dbSNP
rs977557289 495 dbSNP
rs1277374119 499 dbSNP
rs967174672 502 dbSNP
rs1024867385 503 dbSNP
rs1320477347 515 dbSNP
rs1216048896 518 dbSNP
rs549228788 519 dbSNP
rs1039063566 521 dbSNP
rs529028391 523 dbSNP
rs35582307 524 dbSNP
rs1463419693 525 dbSNP
rs1177080928 527 dbSNP
rs1234801087 529 dbSNP
rs1470601005 536 dbSNP
rs1181357181 544 dbSNP
rs1034591390 547 dbSNP
rs1274783878 548 dbSNP
rs1166975562 556 dbSNP
rs925185349 557 dbSNP
rs879652070 559 dbSNP
rs148770432 564 dbSNP
rs1326544480 571 dbSNP
rs1355927321 574 dbSNP
rs1043633786 581 dbSNP
rs945205799 583 dbSNP
rs1320992799 585 dbSNP
rs1352996976 592 dbSNP
rs913777403 596 dbSNP
rs991853292 600 dbSNP
rs1036380818 606 dbSNP
rs960518138 617 dbSNP
rs1275472295 621 dbSNP
rs926381660 631 dbSNP
rs370667888 655 dbSNP
rs1209621622 659 dbSNP
rs1321536403 663 dbSNP
rs980436988 665 dbSNP
rs1476208160 672 dbSNP
rs940742867 672 dbSNP
rs56814521 681 dbSNP
rs546478211 691 dbSNP
rs1016481406 707 dbSNP
rs1050844664 722 dbSNP
rs1045963 728 dbSNP
rs1006510845 729 dbSNP
rs933822058 733 dbSNP
rs376565821 736 dbSNP
rs1386956195 752 dbSNP
rs372975044 756 dbSNP
rs950857334 762 dbSNP
rs1410236243 765 dbSNP
rs1333060905 767 dbSNP
rs1373166483 772 dbSNP
rs921131168 775 dbSNP
rs1328294956 781 dbSNP
rs1458879124 786 dbSNP
rs1312890232 787 dbSNP
rs1026507134 788 dbSNP
rs571545768 804 dbSNP
rs533101842 815 dbSNP
rs1225819152 817 dbSNP
rs935957963 824 dbSNP
rs780467583 831 dbSNP
rs563713741 832 dbSNP
rs977129345 832 dbSNP
rs1486726981 840 dbSNP
rs1211693965 841 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer -0.249 6.2e-3 -0.221 1.4e-2 100 Click to see details
GSE19783 ER- ER- breast cancer -0.226 2.3e-2 -0.204 3.6e-2 79 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.43 2.9e-2 0.444 2.5e-2 20 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.626 3.6e-2 0.500 8.5e-2 9 Click to see details
GSE17306 Multiple myeloma 0.223 6.2e-2 0.203 8.1e-2 49 Click to see details
GSE28260 Renal cortex and medulla -0.425 7.4e-2 -0.368 1.1e-1 13 Click to see details
GSE14794 Lymphoblastoid cells -0.126 1.2e-1 -0.179 4.6e-2 90 Click to see details
GSE21849 B cell lymphoma 0.203 1.5e-1 0.367 2.5e-2 29 Click to see details
GSE21032 Prostate cancer -0.116 1.5e-1 -0.092 2.0e-1 83 Click to see details
GSE27834 Pluripotent stem cells 0.24 1.9e-1 0.374 7.7e-2 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.166 2.2e-1 0.122 2.9e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.16 2.5e-1 0.146 2.7e-1 20 Click to see details
GSE21687 Ependynoma primary tumors 0.083 2.6e-1 0.082 2.6e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.133 2.6e-1 0.270 9.6e-2 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.113 3.0e-1 -0.260 1.2e-1 23 Click to see details
GSE19350 CNS germ cell tumors 0.128 3.5e-1 0.098 3.8e-1 12 Click to see details
GSE38226 Liver fibrosis 0.085 3.6e-1 0.134 2.8e-1 21 Click to see details
GSE32688 Pancreatic cancer 0.066 3.6e-1 -0.027 4.4e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.053 4.0e-1 0.120 2.8e-1 25 Click to see details
GSE28544 Breast cancer -0.021 4.6e-1 -0.210 1.6e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA 0.326 0 0.294 0 84 Click to see details
KIRC 0.35 0 0.334 0 68 Click to see details
LUAD 0.747 0 0.734 0 12 Click to see details
KICH -0.526 0 -0.351 0.04 25 Click to see details
CESC 0.999 0.01 1.000 0.5 3 Click to see details
PRAD 0.223 0.06 0.229 0.05 50 Click to see details
STAD 0.251 0.08 0.230 0.1 32 Click to see details
ESCA -0.336 0.16 -0.273 0.21 11 Click to see details
PAAD 0.597 0.2 0.600 0.2 4 Click to see details
PCPG -0.803 0.2 -1.000 0.5 3 Click to see details
HNSC 0.125 0.22 0.001 0.5 42 Click to see details
BLCA 0.194 0.22 0.224 0.19 18 Click to see details
UCEC 0.162 0.25 0.084 0.37 19 Click to see details
KIRP -0.063 0.37 0.004 0.49 32 Click to see details
LIHC -0.044 0.38 0.000 0.5 49 Click to see details
LUSC -0.048 0.39 -0.141 0.2 38 Click to see details
CHOL -0.089 0.41 -0.367 0.17 9 Click to see details
THCA 0.013 0.46 -0.014 0.46 59 Click to see details
COAD 0.02 0.48 0.143 0.37 8 Click to see details
COAD 0.02 0.48 0.143 0.37 8 Click to see details
COAD 0.02 0.48 0.143 0.37 8 Click to see details
152 hsa-miR-361-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004447 VEGFA vascular endothelial growth factor A 4 3
MIRT020074 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT020075 RPUSD4 RNA pseudouridylate synthase domain containing 4 1 1
MIRT020076 DEPDC1B DEP domain containing 1B 1 1
MIRT020077 CENPQ centromere protein Q 1 1
MIRT020078 EAPP E2F associated phosphoprotein 1 1
MIRT020079 CD46 CD46 molecule 1 1
MIRT020080 EDC3 enhancer of mRNA decapping 3 1 1
MIRT020081 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT020082 ZNF92 zinc finger protein 92 1 1
MIRT020083 ZNF776 zinc finger protein 776 1 1
MIRT020084 ARF4 ADP ribosylation factor 4 1 1
MIRT020085 WDR36 WD repeat domain 36 1 1
MIRT020086 ZMYND11 zinc finger MYND-type containing 11 1 1
MIRT020087 FGFR1OP2 FGFR1 oncogene partner 2 1 1
MIRT020088 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT020089 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT020090 CEBPG CCAAT/enhancer binding protein gamma 1 1
MIRT020091 KLHL28 kelch like family member 28 1 1
MIRT020092 G3BP2 G3BP stress granule assembly factor 2 1 1
MIRT020093 SRSF3 serine and arginine rich splicing factor 3 2 3
MIRT020094 RNF141 ring finger protein 141 1 1
MIRT020095 YOD1 YOD1 deubiquitinase 1 1
MIRT020096 DUSP3 dual specificity phosphatase 3 2 3
MIRT020097 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT020098 GTF2E1 general transcription factor IIE subunit 1 1 1
MIRT020099 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT020100 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT020101 ARCN1 archain 1 1 1
MIRT020102 RNF4 ring finger protein 4 1 1
MIRT020103 CPOX coproporphyrinogen oxidase 1 1
MIRT020104 CDC123 cell division cycle 123 1 1
MIRT044053 SLC30A5 solute carrier family 30 member 5 1 1
MIRT044054 ATP6V1A ATPase H+ transporting V1 subunit A 1 1
MIRT044055 TMEM62 transmembrane protein 62 1 1
MIRT044056 ZNF554 zinc finger protein 554 1 1
MIRT044057 MAGEF1 MAGE family member F1 1 1
MIRT044058 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT044059 DDX23 DEAD-box helicase 23 1 1
MIRT044060 BSG basigin (Ok blood group) 1 1
MIRT044061 VCPIP1 valosin containing protein interacting protein 1 1 1
MIRT044062 VCP valosin containing protein 1 1
MIRT044063 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT044064 SLC25A5 solute carrier family 25 member 5 1 1
MIRT044065 ZNF207 zinc finger protein 207 1 1
MIRT044066 EGFL7 EGF like domain multiple 7 1 1
MIRT044067 SETD1A SET domain containing 1A 1 1
MIRT044068 KIAA1549L KIAA1549 like 1 1
MIRT044069 COX1 cytochrome c oxidase subunit I 1 1
MIRT044070 SON SON DNA binding protein 1 1
MIRT044071 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT044072 PPA1 pyrophosphatase (inorganic) 1 1 1
MIRT044073 DCTN1 dynactin subunit 1 1 1
MIRT044074 ERAL1 Era like 12S mitochondrial rRNA chaperone 1 1 1
MIRT044075 CYCS cytochrome c, somatic 1 1
MIRT044076 ACTG1 actin gamma 1 1 1
MIRT044077 RANBP17 RAN binding protein 17 1 1
MIRT044078 QTRTD1 queuine tRNA-ribosyltransferase accessory subunit 2 1 1
MIRT044079 NCOA6 nuclear receptor coactivator 6 1 1
MIRT044080 ACLY ATP citrate lyase 1 1
MIRT044081 LNPEP leucyl and cystinyl aminopeptidase 1 1
MIRT044082 C14orf80 tubulin epsilon and delta complex 1 1 1
MIRT044083 VBP1 VHL binding protein 1 1 1
MIRT044084 OGDH oxoglutarate dehydrogenase 1 1
MIRT044085 ASH1L ASH1 like histone lysine methyltransferase 1 1
MIRT044086 MDC1 mediator of DNA damage checkpoint 1 1 1
MIRT044087 RPS2 ribosomal protein S2 1 1
MIRT044088 UCK2 uridine-cytidine kinase 2 1 1
MIRT044089 PRPF8 pre-mRNA processing factor 8 1 1
MIRT044090 GSPT1 G1 to S phase transition 1 1 1
MIRT044091 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT044092 USP22 ubiquitin specific peptidase 22 1 1
MIRT044093 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT044094 CNOT2 CCR4-NOT transcription complex subunit 2 1 1
MIRT044095 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT044096 WBP2 WW domain binding protein 2 1 1
MIRT044097 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT044098 GPC6 glypican 6 1 1
MIRT044099 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT044100 EIF3C eukaryotic translation initiation factor 3 subunit C 1 1
MIRT044101 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT044102 DOCK6 dedicator of cytokinesis 6 1 1
MIRT044103 ECD ecdysoneless cell cycle regulator 1 1
MIRT044104 EPHA4 EPH receptor A4 1 1
MIRT044105 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT044106 PSMD2 proteasome 26S subunit, non-ATPase 2 1 1
MIRT044107 RAE1 ribonucleic acid export 1 1 1
MIRT044108 RAVER1 ribonucleoprotein, PTB binding 1 1 1
MIRT044109 TP53BP1 tumor protein p53 binding protein 1 1 1
MIRT044110 COPS7A COP9 signalosome subunit 7A 1 1
MIRT044111 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT044112 CDK2 cyclin dependent kinase 2 1 1
MIRT044113 NOP2 NOP2 nucleolar protein 1 1
MIRT112226 MDM4 MDM4, p53 regulator 2 2
MIRT127737 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT226898 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT235959 BACH1 BTB domain and CNC homolog 1 2 2
MIRT241215 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT243416 ZMAT3 zinc finger matrin-type 3 2 2
MIRT294566 ZNF460 zinc finger protein 460 2 4
MIRT321041 RAC1 Rac family small GTPase 1 2 4
MIRT437351 STAT6 signal transducer and activator of transcription 6 3 1
MIRT438339 SND1 staphylococcal nuclease and tudor domain containing 1 3 1
MIRT444521 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT447699 ERP44 endoplasmic reticulum protein 44 2 2
MIRT464962 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT468193 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT473767 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT482630 AAR2 AAR2 splicing factor homolog 2 2
MIRT484150 CENPN centromere protein N 2 2
MIRT490457 PROSER2 proline and serine rich 2 2 2
MIRT493066 MTCH1 mitochondrial carrier 1 2 2
MIRT493579 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT506495 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT514833 ZNF154 zinc finger protein 154 2 6
MIRT519028 KYNU kynureninase 2 6
MIRT521750 PPIL1 peptidylprolyl isomerase like 1 2 4
MIRT522899 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 4
MIRT527368 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT530684 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT531397 TMEM18 transmembrane protein 18 2 2
MIRT533163 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT534579 RPL28 ribosomal protein L28 2 2
MIRT545955 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT553282 TSR1 TSR1, ribosome maturation factor 2 2
MIRT553531 TMEM185B transmembrane protein 185B 2 4
MIRT555601 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT556005 NAPG NSF attachment protein gamma 2 2
MIRT556738 KLHL15 kelch like family member 15 2 2
MIRT556971 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT558904 CCDC58 coiled-coil domain containing 58 2 2
MIRT559220 BLMH bleomycin hydrolase 2 2
MIRT559821 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT562671 AKT3 AKT serine/threonine kinase 3 2 2
MIRT564793 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT564827 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT570505 TFIP11 tuftelin interacting protein 11 2 2
MIRT571381 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572562 AFF1 AF4/FMR2 family member 1 2 2
MIRT610398 AR androgen receptor 2 2
MIRT641614 DEFB118 defensin beta 118 2 2
MIRT642143 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT643846 EPGN epithelial mitogen 2 4
MIRT651751 VEGFB vascular endothelial growth factor B 2 2
MIRT657353 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT662436 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT700990 PDE3A phosphodiesterase 3A 2 2
MIRT707393 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT712064 XRCC5 X-ray repair cross complementing 5 2 2
MIRT721145 PLCL1 phospholipase C like 1 (inactive) 2 2
MIRT724466 SMAD2 SMAD family member 2 2 2
MIRT731374 CXCR6 C-X-C motif chemokine receptor 6 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-361 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-361 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-361 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-361 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-361 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-361 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
miR-361-5p Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-mir-361 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-361 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-361-5p (5r,6s)-5-phenyl-3,4-diazatricyclo[8.4.0.02,6]tetradeca-1(14),2,10,12-tetraene-4-carbothioamide 5467466 NSC652809 sensitive
hsa-miR-361-5p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-361-5p [(4e,6z,8r,9r,10e,12r,13r,14r,16r)-9-carbamoyloxy-8,14-dimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-19-(prop-2-enylamino)-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-13-yl] 5-aminopentanoate 5469153 NSC683666 sensitive
hsa-miR-361-5p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-361-5p 2-(1-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468781 NSC676184 sensitive
hsa-miR-361-5p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-361-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-361-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-361-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-361-5p 4-[3-(3,4-dihydro-1h-isoquinolin-2-yl)prop-1-en-2-yl]-n-pyrazin-2-ylbenzamide 24205286 NSC734949 sensitive
hsa-miR-361-5p 6-(acetylamino)-2-(3-fluorophenyl)quinolin-4(1h)-one 376375 NSC657277 sensitive
hsa-miR-361-5p 6-aryl alkyl fluoro quinolone derivative 135465400 NSC731099 resistant
hsa-miR-361-5p 7-bromo-2,4,7-triphenyl-6H-benzo[a]quinolizin-5-ium;bromide 386208 NSC677924 sensitive
hsa-miR-361-5p 7-epi-10-deacetylbaccatin iii 6712096 NSC656178 sensitive
hsa-miR-361-5p Acetonitrile;iridium;tetramethyl buta-1,3-diene-1,2,3,4-tetracarboxylate;triphenylphosphane;triphenylphosphanium;tetrafluoroborate 498529 NSC630734 sensitive
hsa-miR-361-5p Antineoplastic-642316 369949 NSC642316 sensitive
hsa-miR-361-5p Auranofin 6333901 NSC321521 sensitive
hsa-miR-361-5p Ayanin 5280682 NSC691652 resistant
hsa-miR-361-5p Bis(trifluoromethylsulfonyl)azanide;trihexyl(tetradecyl)phosphanium 11181836 NSC747251 sensitive
hsa-miR-361-5p Capri blue 102162 NSC7821 sensitive
hsa-miR-361-5p Cbdive_010867 269887 NSC111580 resistant
hsa-miR-361-5p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-361-5p Ethyl 3-(9-chloro-4-hydroxy-2,5,11-trimethyl-6h-pyrido[3,2-b]carbazol-3-yl)propanoate 386719 NSC679261 sensitive
hsa-miR-361-5p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 sensitive
hsa-miR-361-5p Jasplakinolide epoxide c 372550 NSC647763 sensitive
hsa-miR-361-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 resistant
hsa-miR-361-5p N'-butyl-4-[2-[2-[4-(N'-butylcarbamimidoyl)phenoxy]ethylsulfanyl]ethoxy]benzenecarboximidamide;hydrochloride 54613223 NSC750501 sensitive
hsa-miR-361-5p N-(1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl)benzamide 369939 NSC642306 sensitive
hsa-miR-361-5p Rogiolol 402519 NSC716545 sensitive
hsa-miR-361-5p Salinomycin, sodium 60148415 NSC758465 sensitive
hsa-miR-361-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7, MDA-MB-231)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-361-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-miR-361-5p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-361-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-361-5p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-361-5p Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-361-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-361-5p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive Low Gastric Cancer cell line (SGC-7901, MKN28)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-361-5p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (MGC-803)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-361-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-361-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-361-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-361-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-361-5p Testosterone+Tamoxifen sensitive cell line (MCF-7)
hsa-miR-361-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-361-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-361-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-361-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-361-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-361-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MDAH-2774)

Error report submission