miRTarBase - #MIRT020080


—
pre-miRNA Information
pre-miRNA hsa-mir-361   
Genomic Coordinates chrX: 85903636 - 85903707
Synonyms MIRN361, hsa-mir-361, MIR361
Description Homo sapiens miR-361 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-361-5p
Sequence 6| UUAUCAGAAUCUCCAGGGGUAC |27
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 9 X - 85903694 29233923 MiREDiBase
A-to-I 15 X - 85903688 29976955, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1201941835 9 dbSNP
rs1341659793 19 dbSNP
rs1430235395 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol EDC3   
Synonyms LSM16, MRT50, YJDC, YJEFN2, hYjeF_N2-15q23
Description enhancer of mRNA decapping 3
Transcript NM_001142443   
Other Transcripts NM_001142444 , NM_025083   
Expression
Putative miRNA Targets on EDC3
3'UTR of EDC3
(miRNA target sites are highlighted)		 
>EDC3|NM_001142443|3'UTR
   1 AGGGTTCCTGCGCAGGCAGGACTCTGCTGTCCCCTGCTGCTCCTGATAACAAACGCCTTAAGGATATGAAGCTTCATGGA
  81 CCTTGTTAAAGTTTTTTCTCTTTTGGGTTTGTTTCTTCTGTGAGAGAACAGAACTTACTTAAAACTGACCTGTCACTTGC
 161 TCTTAGCCAGGGAAGTCTTTCCCACTGGGTTCCGGGCTGGGTGGCAGGCTGAGCGTGCAGCAACTCCAGGCATCTCTACC
 241 CTCAGCCCCCTGCACGGCCAGGTGGGCCTTTGTTTACAGCCGTAGGCAGCTCTCAAGACTGTGTTTCAGGTTTACAGCCA
 321 CTGGGCCTGGGCACACACATTGAAGAGTGGGCCAGGTCCTGTCTGGGGGCCTGTACCTGCTCTATTTCAGAGCTTGTGGC
 401 TTTGTGTCTCCCCTGCTTTCCCCACGCAGACAGCCCTTCCTCTGTAGAACCAGCTGCACGGCAGCTGTCCACCAGAGGGC
 481 AGACCTGCACTCTCCATTCATGTCCAGGGCTGTGACAGACCAGGCCTTCCCCTAGCCCCACAAGTTGATTTGGGGGGTTT
 561 TGACCCTTACTCCTGAGCTGATCCAAGTTTTATGCTGATTTTTCCAAGGATCTCTCCCTCCTTTTCCCTCCATCACTCAG
 641 AGGTAGGGAAGGGGGCGGCATTAGGATGGTGTTACTGTATTGGGATTTTATGTTGTTCTGTCGTCTTCAGCACAGGTAGT
 721 ATAAGGTTATATTACTGTAGAACCACAGTGCCCATCTTGCCAGCAGTGCCCGCCCCCACCCTCAAAGCTGAGCAGGTTGA
 801 GCCTTTGCCTAGTCTGGGGCCAGACCCCTCAGATGGGGATATCCCTGGGGGAGCCTGGTGCTGAACCAGAAGAGGCTTCC
 881 TGGTGCTTCTGTCCTAGGCCACCACTCCTCCAGCCCTTTGCCCGCACATACATGCCCCACCTACTCTTTCATCCCCTCTG
 961 CCCTTCCCCTGAAACGGTCCTTTGCAGCTGTCATCCCAGAGCAGGCAGATGGGCTCCCGTGCTTGAGCTCCACCCCAGCT
1041 CTTACATCATCTGGGCTTTGAACCTTTTACATTTGTCCAGTCTAGATGAGTAGGCTTGGGGCCAGCACCCTGTCTCAAAG
1121 ATGGCAAAATGAGGCTAGTTCTGGATGAGCTAGCTGGTGTGGGTTCCAACCATAGGAACACACTGATGCTCAAATCCTAA
1201 GGTGCCAAGCTCTAGGCCCTGGAGGCTGGTAGAACAGGATCTATGCCTGGAATCCTGGCAGGGATTCCTGTCAAGGACTT
1281 GTGTTTAAGCCTGCTTCAGGGCTTCAGGCTGCTTCTGCTCTGTGTCTGCCCAGGCTGGCTGAGCGGGTGGATGGGTGGAC
1361 AGAAGGGCTCACCAAGGATTGTGGACATAGGGTAGGCCCTGGTACCACGGGTTTCAGGCTGTTATCACTTCCCTTGTAGG
1441 AACATAGCCAGAAGCAGATGAGCCAGGGTAGAGGGCTGGCCCCTCCTCTCATCTTCCCTTCAGTCTTAAATTGTCTCCAG
1521 CGATGGGAAGAGGCCAGGGACTGTAACCCTTGTGCTGTGTATTCTCTGAGCCTCTGCTCACTCTCAGGGCCAAGCAGCTC
1601 CCAAGCCGGGGCCCTCTCTTGGCCAAAATCTGAGGAGCAGTCTAGGTTACAGGCTTTTTGGTAGGTAGGTTCTGGCTGCC
1681 TGTTAATGCAGTTAGGCCCCCTGATTAGGTACAGTGAGAAACAAGCTAGAACAACCCTGGCCCAGAAGACTGTCCACTCC
1761 AGCAAGATCCAGGGATGATAGCCTTGCAGGGCCACTGGGAGTTTGTGCCCAAGCTTCTCCCTCTTCTCTCCCCAGGGGGC
1841 ACTGGGACTGGTCCCTGCCCTCATCCTTAGCCTGGGCCTTCCCCAGAGGTATTAAAGAGAAGTATGATTCCTCTGTCTTC
1921 AGTTCTTTTCAGGGGCATCCTGCCCATAGTACCCAGTTCCCAAGGGGCCCCCAGTCACGTGGTGAAGCCTAGCACTCATG
2001 CAGCTCTTAGGGAACCAAAAACCAGCACTGAAATAAAGCTGAATGACTGACTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cauGGGGACCUCUAAGACUAUu 5'
             ||||||  | | |||||| 
Target 5' tgtCCCCTGCTGCTCCTGATAa 3'
 28 - 49 139.00 -18.60
2 
miRNA  3' caugGGGACCUCUAAGACUAUu 5'
              ||||||||:  |||:|| 
Target 5' taggCCCTGGAGG--CTGGTAg 3'
 1213 - 1232 129.00 -24.00
3 
miRNA  3' cauGGGGACC--UCUAAGACUauu 5'
             |:|:|||  | | |||||   
Target 5' cctCTCTTGGCCAAAATCTGAgga 3'
 1613 - 1636 121.00 -11.52
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN19732415 11 COSMIC
COSN30136761 12 COSMIC
COSN30463066 78 COSMIC
COSN26635055 246 COSMIC
COSN1684327 281 COSMIC
COSN31486616 294 COSMIC
COSN8176570 534 COSMIC
COSN29161047 558 COSMIC
COSN20112265 630 COSMIC
COSN8176569 679 COSMIC
COSN30499433 976 COSMIC
COSN1684325 1057 COSMIC
COSN17636178 1193 COSMIC
COSN19440172 1327 COSMIC
COSN27529950 1684 COSMIC
COSN14825190 1711 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs762342514 1 dbSNP
rs1051188575 3 dbSNP
rs1261528347 9 dbSNP
rs774651678 10 dbSNP
rs373155841 11 dbSNP
rs763169983 12 dbSNP
rs775642353 13 dbSNP
rs970775034 16 dbSNP
rs1397613660 18 dbSNP
rs370249779 24 dbSNP
rs781244236 27 dbSNP
rs770950023 28 dbSNP
rs746963560 29 dbSNP
rs1489851346 30 dbSNP
rs777651516 31 dbSNP
rs1466334575 32 dbSNP
rs758129084 33 dbSNP
rs1163100912 39 dbSNP
rs752387549 42 dbSNP
rs1257434828 46 dbSNP
rs778483673 50 dbSNP
rs754484819 51 dbSNP
rs975126412 52 dbSNP
rs762594910 53 dbSNP
rs958256974 54 dbSNP
rs957113922 55 dbSNP
rs1260649461 71 dbSNP
rs1428720656 72 dbSNP
rs1396419831 76 dbSNP
rs1264445656 83 dbSNP
rs1032634240 88 dbSNP
rs1424645635 91 dbSNP
rs925775571 91 dbSNP
rs999686251 91 dbSNP
rs1193615735 100 dbSNP
rs1164785157 121 dbSNP
rs577072562 122 dbSNP
rs967689148 129 dbSNP
rs1288312523 131 dbSNP
rs1258750859 136 dbSNP
rs1362978896 137 dbSNP
rs1201242584 138 dbSNP
rs1299636711 141 dbSNP
rs1052259941 149 dbSNP
rs1356990766 151 dbSNP
rs1244903408 156 dbSNP
rs1483080202 156 dbSNP
rs1024247352 159 dbSNP
rs1213088763 169 dbSNP
rs1261508579 172 dbSNP
rs370157971 173 dbSNP
rs1486027334 179 dbSNP
rs1187889245 184 dbSNP
rs1240819626 185 dbSNP
rs997624008 187 dbSNP
rs1184550003 190 dbSNP
rs1014603104 193 dbSNP
rs574729274 194 dbSNP
rs374368289 196 dbSNP
rs958702352 199 dbSNP
rs900613226 204 dbSNP
rs1056477241 212 dbSNP
rs868865666 214 dbSNP
rs576347533 215 dbSNP
rs1455594015 216 dbSNP
rs751843666 224 dbSNP
rs1334990448 227 dbSNP
rs1277426729 228 dbSNP
rs1451695372 231 dbSNP
rs555035417 234 dbSNP
rs138293236 236 dbSNP
rs1221996869 237 dbSNP
rs1334654706 247 dbSNP
rs1395082783 250 dbSNP
rs899294769 255 dbSNP
rs536253072 256 dbSNP
rs1036480899 258 dbSNP
rs1465655008 262 dbSNP
rs1245322794 267 dbSNP
rs1422320902 274 dbSNP
rs1469113893 275 dbSNP
rs1005079220 281 dbSNP
rs571938003 282 dbSNP
rs1420964235 285 dbSNP
rs890638380 295 dbSNP
rs1405659678 296 dbSNP
rs1051993440 299 dbSNP
rs982237956 300 dbSNP
rs1360668141 303 dbSNP
rs555918356 305 dbSNP
rs1188608755 308 dbSNP
rs932234907 309 dbSNP
rs916338855 313 dbSNP
rs1229718622 315 dbSNP
rs990497833 322 dbSNP
rs1223742736 323 dbSNP
rs1241482846 327 dbSNP
rs1436446154 329 dbSNP
rs1204188992 333 dbSNP
rs1200778851 339 dbSNP
rs957724601 350 dbSNP
rs920892908 351 dbSNP
rs534754245 360 dbSNP
rs978359002 365 dbSNP
rs1428674602 366 dbSNP
rs1039429093 367 dbSNP
rs935730247 370 dbSNP
rs925723748 374 dbSNP
rs553878357 376 dbSNP
rs977642456 378 dbSNP
rs1327881540 383 dbSNP
rs1355091947 384 dbSNP
rs1411552001 385 dbSNP
rs1300819309 390 dbSNP
rs967212110 395 dbSNP
rs1344306015 398 dbSNP
rs1223534368 400 dbSNP
rs763526466 403 dbSNP
rs1337001930 406 dbSNP
rs1214375627 410 dbSNP
rs1274129725 413 dbSNP
rs1030485888 414 dbSNP
rs1284725589 415 dbSNP
rs998116895 417 dbSNP
rs1490534878 423 dbSNP
rs181346572 425 dbSNP
rs571502493 426 dbSNP
rs958616565 439 dbSNP
rs1034309609 453 dbSNP
rs556410138 459 dbSNP
rs973408569 460 dbSNP
rs1398913916 466 dbSNP
rs963417450 468 dbSNP
rs1324901450 474 dbSNP
rs897090323 477 dbSNP
rs1429560770 488 dbSNP
rs1271193539 500 dbSNP
rs1367806588 515 dbSNP
rs1244150354 518 dbSNP
rs538010571 530 dbSNP
rs188580417 531 dbSNP
rs1393428203 535 dbSNP
rs1164372647 536 dbSNP
rs1211761804 539 dbSNP
rs1424367568 554 dbSNP
rs1005390815 565 dbSNP
rs890595905 572 dbSNP
rs145789135 583 dbSNP
rs1194152252 586 dbSNP
rs949282501 595 dbSNP
rs1451104561 605 dbSNP
rs1030920369 616 dbSNP
rs1181485412 617 dbSNP
rs565686872 619 dbSNP
rs1458330359 628 dbSNP
rs530152557 633 dbSNP
rs540394047 636 dbSNP
rs916325097 638 dbSNP
rs1399551547 640 dbSNP
rs1318568573 651 dbSNP
rs1180705675 652 dbSNP
rs1390331342 654 dbSNP
rs1450939694 656 dbSNP
rs771651466 656 dbSNP
rs1314766518 661 dbSNP
rs1384235021 665 dbSNP
rs996441189 675 dbSNP
rs1277915454 677 dbSNP
rs900790622 682 dbSNP
rs745683233 693 dbSNP
rs1453408486 695 dbSNP
rs1290457414 696 dbSNP
rs1270289694 698 dbSNP
rs1460113654 702 dbSNP
rs369929496 703 dbSNP
rs1242273366 705 dbSNP
rs904205175 721 dbSNP
rs1424398461 725 dbSNP
rs1041435249 730 dbSNP
rs924954561 744 dbSNP
rs1287947433 745 dbSNP
rs1361921371 751 dbSNP
rs977782193 757 dbSNP
rs1159193069 762 dbSNP
rs945792856 766 dbSNP
rs1375622736 771 dbSNP
rs966969003 772 dbSNP
rs1336561505 776 dbSNP
rs765293099 777 dbSNP
rs1398092898 779 dbSNP
rs917047900 782 dbSNP
rs993109119 792 dbSNP
rs1327442705 793 dbSNP
rs937250230 804 dbSNP
rs1031042334 805 dbSNP
rs1331199050 807 dbSNP
rs1239891107 812 dbSNP
rs1321727044 816 dbSNP
rs976271593 816 dbSNP
rs927242265 819 dbSNP
rs965254917 821 dbSNP
rs1424625413 837 dbSNP
rs973357755 839 dbSNP
rs369555344 846 dbSNP
rs1364092903 853 dbSNP
rs963320444 854 dbSNP
rs1483455191 856 dbSNP
rs1160888088 857 dbSNP
rs1201920894 859 dbSNP
rs1015347157 860 dbSNP
rs1248352192 860 dbSNP
rs1437138494 872 dbSNP
rs983517475 873 dbSNP
rs955000239 888 dbSNP
rs1006277931 891 dbSNP
rs887747780 895 dbSNP
rs1026259053 897 dbSNP
rs1157080948 900 dbSNP
rs993481794 904 dbSNP
rs1379111731 907 dbSNP
rs1247416863 911 dbSNP
rs1396478836 914 dbSNP
rs1198562306 916 dbSNP
rs897067093 921 dbSNP
rs565938243 923 dbSNP
rs1343709095 924 dbSNP
rs776418367 924 dbSNP
rs1284197569 928 dbSNP
rs1265264914 931 dbSNP
rs1235203252 940 dbSNP
rs768679657 944 dbSNP
rs1338741881 950 dbSNP
rs894974238 950 dbSNP
rs1179396478 956 dbSNP
rs1352754497 958 dbSNP
rs1054852412 959 dbSNP
rs1198020418 960 dbSNP
rs1267641167 965 dbSNP
rs1032573824 966 dbSNP
rs1418368595 968 dbSNP
rs184657076 971 dbSNP
rs34970946 972 dbSNP
rs925049128 973 dbSNP
rs532483830 975 dbSNP
rs1041777495 976 dbSNP
rs1424137036 981 dbSNP
rs1294160469 983 dbSNP
rs1273797641 986 dbSNP
rs1380733510 990 dbSNP
rs565008275 994 dbSNP
rs895588519 1001 dbSNP
rs1364198985 1009 dbSNP
rs1056952123 1016 dbSNP
rs543609912 1018 dbSNP
rs531747317 1019 dbSNP
rs1221142023 1021 dbSNP
rs1300594908 1033 dbSNP
rs552458433 1037 dbSNP
rs927147419 1043 dbSNP
rs1489289990 1046 dbSNP
rs1184397554 1052 dbSNP
rs1260518837 1063 dbSNP
rs1440757349 1066 dbSNP
rs1450507815 1067 dbSNP
rs561665262 1068 dbSNP
rs1252832027 1072 dbSNP
rs1383969926 1080 dbSNP
rs1444541977 1086 dbSNP
rs1165646958 1088 dbSNP
rs1351683755 1090 dbSNP
rs1344996543 1091 dbSNP
rs1451640127 1100 dbSNP
rs774931777 1102 dbSNP
rs192154403 1103 dbSNP
rs964885586 1105 dbSNP
rs572033879 1112 dbSNP
rs941955673 1113 dbSNP
rs1299505364 1115 dbSNP
rs1425955716 1122 dbSNP
rs753827288 1125 dbSNP
rs1175725695 1141 dbSNP
rs1479500164 1143 dbSNP
rs1425634278 1147 dbSNP
rs1312889977 1150 dbSNP
rs1194327849 1171 dbSNP
rs907868300 1172 dbSNP
rs1485407256 1173 dbSNP
rs910731742 1181 dbSNP
rs984949920 1182 dbSNP
rs538914742 1184 dbSNP
rs1259820932 1193 dbSNP
rs1240180984 1196 dbSNP
rs952110373 1203 dbSNP
rs983893076 1209 dbSNP
rs1211027599 1210 dbSNP
rs753790980 1212 dbSNP
rs1444635204 1217 dbSNP
rs34537595 1217 dbSNP
rs993450840 1219 dbSNP
rs971811292 1220 dbSNP
rs1442697720 1238 dbSNP
rs1277498511 1242 dbSNP
rs1221086730 1243 dbSNP
rs553473874 1245 dbSNP
rs866881372 1246 dbSNP
rs1024853717 1252 dbSNP
rs1458996298 1257 dbSNP
rs1322361886 1259 dbSNP
rs1013938479 1265 dbSNP
rs879029404 1266 dbSNP
rs544988418 1283 dbSNP
rs895092916 1289 dbSNP
rs1319430913 1298 dbSNP
rs1054946577 1305 dbSNP
rs1000741169 1307 dbSNP
rs923375815 1308 dbSNP
rs1329504209 1316 dbSNP
rs974844935 1317 dbSNP
rs1229851736 1322 dbSNP
rs1260791713 1335 dbSNP
rs964843578 1344 dbSNP
rs577835020 1345 dbSNP
rs1479925845 1348 dbSNP
rs1176737586 1349 dbSNP
rs1040598858 1368 dbSNP
rs943602414 1372 dbSNP
rs910826611 1377 dbSNP
rs984920165 1388 dbSNP
rs1001076278 1394 dbSNP
rs1287556101 1396 dbSNP
rs1450649704 1397 dbSNP
rs967402650 1399 dbSNP
rs777773239 1408 dbSNP
rs1019939452 1409 dbSNP
rs1306948847 1410 dbSNP
rs1010345687 1411 dbSNP
rs187374774 1414 dbSNP
rs895548703 1422 dbSNP
rs1056784110 1425 dbSNP
rs1343799033 1435 dbSNP
rs1001247236 1436 dbSNP
rs573059656 1439 dbSNP
rs79171739 1442 dbSNP
rs1012943715 1444 dbSNP
rs1402606774 1448 dbSNP
rs1171259607 1450 dbSNP
rs756224130 1453 dbSNP
rs567461563 1455 dbSNP
rs1000668228 1468 dbSNP
rs1246390627 1469 dbSNP
rs907813582 1477 dbSNP
rs555681942 1485 dbSNP
rs185597952 1490 dbSNP
rs1009746276 1497 dbSNP
rs1407939289 1508 dbSNP
rs1491196220 1511 dbSNP
rs901620134 1511 dbSNP
rs1040424351 1512 dbSNP
rs943088006 1513 dbSNP
rs1300709628 1517 dbSNP
rs1330200587 1519 dbSNP
rs1436732035 1521 dbSNP
rs550899964 1522 dbSNP
rs923311993 1527 dbSNP
rs1205830059 1528 dbSNP
rs974787848 1533 dbSNP
rs1228048936 1534 dbSNP
rs771584168 1537 dbSNP
rs779801839 1539 dbSNP
rs1344882661 1541 dbSNP
rs1220420379 1544 dbSNP
rs964790867 1545 dbSNP
rs752663211 1548 dbSNP
rs767875777 1552 dbSNP
rs1314603462 1554 dbSNP
rs979629003 1555 dbSNP
rs930772381 1564 dbSNP
rs759794557 1573 dbSNP
rs1390752963 1575 dbSNP
rs1332190351 1577 dbSNP
rs1461554221 1579 dbSNP
rs1389381582 1596 dbSNP
rs1021647753 1607 dbSNP
rs566723330 1609 dbSNP
rs950160614 1610 dbSNP
rs1384435493 1614 dbSNP
rs1128628 1618 dbSNP
rs1368048336 1619 dbSNP
rs1284057024 1620 dbSNP
rs1441235446 1620 dbSNP
rs991892242 1621 dbSNP
rs1230055209 1623 dbSNP
rs1282460011 1630 dbSNP
rs1238238637 1634 dbSNP
rs1464589645 1635 dbSNP
rs1207931566 1637 dbSNP
rs1248394653 1640 dbSNP
rs1035321696 1652 dbSNP
rs1185333986 1654 dbSNP
rs1367759440 1657 dbSNP
rs1472852361 1664 dbSNP
rs766830908 1665 dbSNP
rs1409357094 1679 dbSNP
rs905655993 1685 dbSNP
rs1224490954 1691 dbSNP
rs1360575323 1695 dbSNP
rs532323757 1699 dbSNP
rs1321726508 1714 dbSNP
rs1391298759 1722 dbSNP
rs1450840991 1725 dbSNP
rs1334111852 1729 dbSNP
rs1341554846 1732 dbSNP
rs1037485569 1733 dbSNP
rs193221794 1735 dbSNP
rs958704186 1736 dbSNP
rs372755933 1740 dbSNP
rs886295160 1742 dbSNP
rs1270175895 1743 dbSNP
rs1379317857 1746 dbSNP
rs979364061 1750 dbSNP
rs967846677 1754 dbSNP
rs571414527 1757 dbSNP
rs1390856032 1768 dbSNP
rs933258172 1769 dbSNP
rs901586032 1771 dbSNP
rs1471941560 1776 dbSNP
rs187671667 1779 dbSNP
rs763431565 1783 dbSNP
rs1464887037 1789 dbSNP
rs1039091619 1791 dbSNP
rs1172327609 1797 dbSNP
rs1403605097 1800 dbSNP
rs531832283 1801 dbSNP
rs1398290869 1803 dbSNP
rs1349952438 1809 dbSNP
rs943424526 1810 dbSNP
rs1290464850 1814 dbSNP
rs561301582 1815 dbSNP
rs1343828355 1818 dbSNP
rs543338718 1819 dbSNP
rs1007144746 1824 dbSNP
rs1255169062 1828 dbSNP
rs979576874 1829 dbSNP
rs369547229 1834 dbSNP
rs945512752 1839 dbSNP
rs140626109 1843 dbSNP
rs1482457110 1845 dbSNP
rs992780606 1846 dbSNP
rs930909347 1847 dbSNP
rs1253580612 1855 dbSNP
rs1431074449 1858 dbSNP
rs1198669013 1866 dbSNP
rs898106720 1870 dbSNP
rs1167277491 1872 dbSNP
rs1370429612 1874 dbSNP
rs560810378 1875 dbSNP
rs773769077 1883 dbSNP
rs1430516341 1889 dbSNP
rs1036935691 1892 dbSNP
rs950282038 1895 dbSNP
rs1386424641 1899 dbSNP
rs1302168175 1901 dbSNP
rs1268892620 1903 dbSNP
rs1193418706 1904 dbSNP
rs1235085679 1905 dbSNP
rs1295359122 1908 dbSNP
rs770128960 1910 dbSNP
rs1490671771 1911 dbSNP
rs1205314064 1916 dbSNP
rs182751126 1922 dbSNP
rs979767815 1925 dbSNP
rs1208875720 1930 dbSNP
rs1267539873 1936 dbSNP
rs577672608 1942 dbSNP
rs1015945302 1944 dbSNP
rs550137043 1946 dbSNP
rs377139499 1948 dbSNP
rs1005984331 1949 dbSNP
rs886240389 1956 dbSNP
rs991593539 1960 dbSNP
rs11547808 1961 dbSNP
rs925958923 1962 dbSNP
rs1238670704 1971 dbSNP
rs978789243 1973 dbSNP
rs1303583052 1976 dbSNP
rs774811833 1978 dbSNP
rs997838505 1979 dbSNP
rs901793180 1987 dbSNP
rs967936693 1992 dbSNP
rs1364446703 2001 dbSNP
rs866487295 2002 dbSNP
rs1020907757 2014 dbSNP
rs988370612 2016 dbSNP
rs943373657 2024 dbSNP
rs903873267 2027 dbSNP
rs1265692404 2029 dbSNP
rs1489237182 2032 dbSNP
rs1207277892 2033 dbSNP
rs1247781176 2034 dbSNP
rs1287892005 2034 dbSNP
rs1451256768 2035 dbSNP
rs1044171577 2043 dbSNP
rs561674165 2049 dbSNP
rs1412204949 2050 dbSNP
rs548265270 2055 dbSNP
rs888753433 2055 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.877 9.4e-9 -0.614 7.1e-4 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.763 4.6e-5 -0.782 2.3e-5 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.588 1.0e-3 -0.603 7.1e-4 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.806 4.4e-3 -0.717 1.5e-2 9 Click to see details
GSE14794 Lymphoblastoid cells 0.274 4.5e-3 0.235 1.3e-2 90 Click to see details
GSE27834 Pluripotent stem cells 0.623 5.0e-3 0.626 4.7e-3 16 Click to see details
GSE21032 Prostate cancer 0.213 2.7e-2 0.162 7.2e-2 83 Click to see details
GSE42095 Differentiated embryonic stem cells -0.372 4.0e-2 -0.476 1.1e-2 23 Click to see details
GSE32688 Pancreatic cancer 0.273 6.5e-2 0.225 1.1e-1 32 Click to see details
GSE19536 Breast cancer 0.135 9.0e-2 0.153 6.4e-2 100 Click to see details
GSE17498 Multiple myeloma -0.212 9.5e-2 -0.290 3.5e-2 40 Click to see details
GSE19783 ER+ ER+ breast cancer 0.279 1.2e-1 0.424 3.1e-2 20 Click to see details
GSE38226 Liver fibrosis 0.245 1.4e-1 0.277 1.1e-1 21 Click to see details
GSE28260 Renal cortex and medulla 0.316 1.5e-1 0.214 2.4e-1 13 Click to see details
GSE19350 CNS germ cell tumors -0.329 1.5e-1 -0.587 2.2e-2 12 Click to see details
GSE19783 ER- ER- breast cancer 0.11 1.7e-1 0.162 7.7e-2 79 Click to see details
GSE21687 Ependynoma primary tumors 0.09 2.4e-1 0.125 1.6e-1 64 Click to see details
GSE21849 B cell lymphoma 0.097 3.1e-1 0.193 1.6e-1 29 Click to see details
GSE26953 Aortic valvular endothelial cells 0.096 3.3e-1 0.087 3.4e-1 24 Click to see details
GSE17306 Multiple myeloma 0.043 3.8e-1 0.024 4.3e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.024 4.5e-1 0.042 4.2e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.316 0.04 -0.042 0.41 32 Click to see details
UCEC -0.381 0.05 -0.300 0.11 19 Click to see details
BRCA -0.169 0.06 -0.160 0.07 84 Click to see details
PRAD 0.205 0.08 0.232 0.05 50 Click to see details
PCPG -0.955 0.1 -0.500 0.33 3 Click to see details
CHOL 0.449 0.11 0.483 0.09 9 Click to see details
LUAD 0.34 0.14 0.203 0.26 12 Click to see details
KIRP 0.166 0.18 0.105 0.28 32 Click to see details
CESC -0.802 0.2 -0.500 0.33 3 Click to see details
COAD -0.339 0.21 -0.643 0.04 8 Click to see details
KIRC -0.095 0.22 -0.013 0.46 68 Click to see details
ESCA 0.226 0.25 0.464 0.08 11 Click to see details
LIHC 0.09 0.27 0.102 0.24 49 Click to see details
LUSC 0.096 0.28 -0.005 0.49 38 Click to see details
HNSC 0.056 0.36 0.133 0.2 42 Click to see details
BLCA 0.079 0.38 0.131 0.3 18 Click to see details
THCA 0.022 0.43 0.136 0.15 59 Click to see details
KICH 0.034 0.44 0.005 0.49 25 Click to see details
PAAD -0.085 0.46 -0.200 0.4 4 Click to see details
PAAD -0.085 0.46 -0.200 0.4 4 Click to see details
PAAD -0.085 0.46 -0.200 0.4 4 Click to see details
152 hsa-miR-361-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004447 VEGFA vascular endothelial growth factor A 4 3
MIRT020074 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT020075 RPUSD4 RNA pseudouridylate synthase domain containing 4 1 1
MIRT020076 DEPDC1B DEP domain containing 1B 1 1
MIRT020077 CENPQ centromere protein Q 1 1
MIRT020078 EAPP E2F associated phosphoprotein 1 1
MIRT020079 CD46 CD46 molecule 1 1
MIRT020080 EDC3 enhancer of mRNA decapping 3 1 1
MIRT020081 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT020082 ZNF92 zinc finger protein 92 1 1
MIRT020083 ZNF776 zinc finger protein 776 1 1
MIRT020084 ARF4 ADP ribosylation factor 4 1 1
MIRT020085 WDR36 WD repeat domain 36 1 1
MIRT020086 ZMYND11 zinc finger MYND-type containing 11 1 1
MIRT020087 FGFR1OP2 FGFR1 oncogene partner 2 1 1
MIRT020088 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT020089 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT020090 CEBPG CCAAT/enhancer binding protein gamma 1 1
MIRT020091 KLHL28 kelch like family member 28 1 1
MIRT020092 G3BP2 G3BP stress granule assembly factor 2 1 1
MIRT020093 SRSF3 serine and arginine rich splicing factor 3 2 3
MIRT020094 RNF141 ring finger protein 141 1 1
MIRT020095 YOD1 YOD1 deubiquitinase 1 1
MIRT020096 DUSP3 dual specificity phosphatase 3 2 3
MIRT020097 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT020098 GTF2E1 general transcription factor IIE subunit 1 1 1
MIRT020099 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT020100 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT020101 ARCN1 archain 1 1 1
MIRT020102 RNF4 ring finger protein 4 1 1
MIRT020103 CPOX coproporphyrinogen oxidase 1 1
MIRT020104 CDC123 cell division cycle 123 1 1
MIRT044053 SLC30A5 solute carrier family 30 member 5 1 1
MIRT044054 ATP6V1A ATPase H+ transporting V1 subunit A 1 1
MIRT044055 TMEM62 transmembrane protein 62 1 1
MIRT044056 ZNF554 zinc finger protein 554 1 1
MIRT044057 MAGEF1 MAGE family member F1 1 1
MIRT044058 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT044059 DDX23 DEAD-box helicase 23 1 1
MIRT044060 BSG basigin (Ok blood group) 1 1
MIRT044061 VCPIP1 valosin containing protein interacting protein 1 1 1
MIRT044062 VCP valosin containing protein 1 1
MIRT044063 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT044064 SLC25A5 solute carrier family 25 member 5 1 1
MIRT044065 ZNF207 zinc finger protein 207 1 1
MIRT044066 EGFL7 EGF like domain multiple 7 1 1
MIRT044067 SETD1A SET domain containing 1A 1 1
MIRT044068 KIAA1549L KIAA1549 like 1 1
MIRT044069 COX1 cytochrome c oxidase subunit I 1 1
MIRT044070 SON SON DNA binding protein 1 1
MIRT044071 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT044072 PPA1 pyrophosphatase (inorganic) 1 1 1
MIRT044073 DCTN1 dynactin subunit 1 1 1
MIRT044074 ERAL1 Era like 12S mitochondrial rRNA chaperone 1 1 1
MIRT044075 CYCS cytochrome c, somatic 1 1
MIRT044076 ACTG1 actin gamma 1 1 1
MIRT044077 RANBP17 RAN binding protein 17 1 1
MIRT044078 QTRTD1 queuine tRNA-ribosyltransferase accessory subunit 2 1 1
MIRT044079 NCOA6 nuclear receptor coactivator 6 1 1
MIRT044080 ACLY ATP citrate lyase 1 1
MIRT044081 LNPEP leucyl and cystinyl aminopeptidase 1 1
MIRT044082 C14orf80 tubulin epsilon and delta complex 1 1 1
MIRT044083 VBP1 VHL binding protein 1 1 1
MIRT044084 OGDH oxoglutarate dehydrogenase 1 1
MIRT044085 ASH1L ASH1 like histone lysine methyltransferase 1 1
MIRT044086 MDC1 mediator of DNA damage checkpoint 1 1 1
MIRT044087 RPS2 ribosomal protein S2 1 1
MIRT044088 UCK2 uridine-cytidine kinase 2 1 1
MIRT044089 PRPF8 pre-mRNA processing factor 8 1 1
MIRT044090 GSPT1 G1 to S phase transition 1 1 1
MIRT044091 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT044092 USP22 ubiquitin specific peptidase 22 1 1
MIRT044093 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT044094 CNOT2 CCR4-NOT transcription complex subunit 2 1 1
MIRT044095 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT044096 WBP2 WW domain binding protein 2 1 1
MIRT044097 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT044098 GPC6 glypican 6 1 1
MIRT044099 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT044100 EIF3C eukaryotic translation initiation factor 3 subunit C 1 1
MIRT044101 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT044102 DOCK6 dedicator of cytokinesis 6 1 1
MIRT044103 ECD ecdysoneless cell cycle regulator 1 1
MIRT044104 EPHA4 EPH receptor A4 1 1
MIRT044105 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT044106 PSMD2 proteasome 26S subunit, non-ATPase 2 1 1
MIRT044107 RAE1 ribonucleic acid export 1 1 1
MIRT044108 RAVER1 ribonucleoprotein, PTB binding 1 1 1
MIRT044109 TP53BP1 tumor protein p53 binding protein 1 1 1
MIRT044110 COPS7A COP9 signalosome subunit 7A 1 1
MIRT044111 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT044112 CDK2 cyclin dependent kinase 2 1 1
MIRT044113 NOP2 NOP2 nucleolar protein 1 1
MIRT112226 MDM4 MDM4, p53 regulator 2 2
MIRT127737 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT226898 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT235959 BACH1 BTB domain and CNC homolog 1 2 2
MIRT241215 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT243416 ZMAT3 zinc finger matrin-type 3 2 2
MIRT294566 ZNF460 zinc finger protein 460 2 4
MIRT321041 RAC1 Rac family small GTPase 1 2 4
MIRT437351 STAT6 signal transducer and activator of transcription 6 3 1
MIRT438339 SND1 staphylococcal nuclease and tudor domain containing 1 3 1
MIRT444521 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT447699 ERP44 endoplasmic reticulum protein 44 2 2
MIRT464962 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT468193 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT473767 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT482630 AAR2 AAR2 splicing factor homolog 2 2
MIRT484150 CENPN centromere protein N 2 2
MIRT490457 PROSER2 proline and serine rich 2 2 2
MIRT493066 MTCH1 mitochondrial carrier 1 2 2
MIRT493579 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT506495 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT514833 ZNF154 zinc finger protein 154 2 6
MIRT519028 KYNU kynureninase 2 6
MIRT521750 PPIL1 peptidylprolyl isomerase like 1 2 4
MIRT522899 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 4
MIRT527368 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT530684 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT531397 TMEM18 transmembrane protein 18 2 2
MIRT533163 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT534579 RPL28 ribosomal protein L28 2 2
MIRT545955 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT553282 TSR1 TSR1, ribosome maturation factor 2 2
MIRT553531 TMEM185B transmembrane protein 185B 2 4
MIRT555601 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT556005 NAPG NSF attachment protein gamma 2 2
MIRT556738 KLHL15 kelch like family member 15 2 2
MIRT556971 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT558904 CCDC58 coiled-coil domain containing 58 2 2
MIRT559220 BLMH bleomycin hydrolase 2 2
MIRT559821 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT562671 AKT3 AKT serine/threonine kinase 3 2 2
MIRT564793 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT564827 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT570505 TFIP11 tuftelin interacting protein 11 2 2
MIRT571381 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572562 AFF1 AF4/FMR2 family member 1 2 2
MIRT610398 AR androgen receptor 2 2
MIRT641614 DEFB118 defensin beta 118 2 2
MIRT642143 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT643846 EPGN epithelial mitogen 2 4
MIRT651751 VEGFB vascular endothelial growth factor B 2 2
MIRT657353 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT662436 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT700990 PDE3A phosphodiesterase 3A 2 2
MIRT707393 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT712064 XRCC5 X-ray repair cross complementing 5 2 2
MIRT721145 PLCL1 phospholipase C like 1 (inactive) 2 2
MIRT724466 SMAD2 SMAD family member 2 2 2
MIRT731374 CXCR6 C-X-C motif chemokine receptor 6 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-361 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-361 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-361 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-361 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-361 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-361 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
miR-361-5p Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-mir-361 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-361 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-361-5p (5r,6s)-5-phenyl-3,4-diazatricyclo[8.4.0.02,6]tetradeca-1(14),2,10,12-tetraene-4-carbothioamide 5467466 NSC652809 sensitive
hsa-miR-361-5p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-361-5p [(4e,6z,8r,9r,10e,12r,13r,14r,16r)-9-carbamoyloxy-8,14-dimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-19-(prop-2-enylamino)-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-13-yl] 5-aminopentanoate 5469153 NSC683666 sensitive
hsa-miR-361-5p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-361-5p 2-(1-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468781 NSC676184 sensitive
hsa-miR-361-5p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-361-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-361-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-361-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-361-5p 4-[3-(3,4-dihydro-1h-isoquinolin-2-yl)prop-1-en-2-yl]-n-pyrazin-2-ylbenzamide 24205286 NSC734949 sensitive
hsa-miR-361-5p 6-(acetylamino)-2-(3-fluorophenyl)quinolin-4(1h)-one 376375 NSC657277 sensitive
hsa-miR-361-5p 6-aryl alkyl fluoro quinolone derivative 135465400 NSC731099 resistant
hsa-miR-361-5p 7-bromo-2,4,7-triphenyl-6H-benzo[a]quinolizin-5-ium;bromide 386208 NSC677924 sensitive
hsa-miR-361-5p 7-epi-10-deacetylbaccatin iii 6712096 NSC656178 sensitive
hsa-miR-361-5p Acetonitrile;iridium;tetramethyl buta-1,3-diene-1,2,3,4-tetracarboxylate;triphenylphosphane;triphenylphosphanium;tetrafluoroborate 498529 NSC630734 sensitive
hsa-miR-361-5p Antineoplastic-642316 369949 NSC642316 sensitive
hsa-miR-361-5p Auranofin 6333901 NSC321521 sensitive
hsa-miR-361-5p Ayanin 5280682 NSC691652 resistant
hsa-miR-361-5p Bis(trifluoromethylsulfonyl)azanide;trihexyl(tetradecyl)phosphanium 11181836 NSC747251 sensitive
hsa-miR-361-5p Capri blue 102162 NSC7821 sensitive
hsa-miR-361-5p Cbdive_010867 269887 NSC111580 resistant
hsa-miR-361-5p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-361-5p Ethyl 3-(9-chloro-4-hydroxy-2,5,11-trimethyl-6h-pyrido[3,2-b]carbazol-3-yl)propanoate 386719 NSC679261 sensitive
hsa-miR-361-5p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 sensitive
hsa-miR-361-5p Jasplakinolide epoxide c 372550 NSC647763 sensitive
hsa-miR-361-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 resistant
hsa-miR-361-5p N'-butyl-4-[2-[2-[4-(N'-butylcarbamimidoyl)phenoxy]ethylsulfanyl]ethoxy]benzenecarboximidamide;hydrochloride 54613223 NSC750501 sensitive
hsa-miR-361-5p N-(1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl)benzamide 369939 NSC642306 sensitive
hsa-miR-361-5p Rogiolol 402519 NSC716545 sensitive
hsa-miR-361-5p Salinomycin, sodium 60148415 NSC758465 sensitive
hsa-miR-361-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7, MDA-MB-231)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-361-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-miR-361-5p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-361-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-361-5p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-361-5p Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-361-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-361-5p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive Low Gastric Cancer cell line (SGC-7901, MKN28)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-361-5p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (MGC-803)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-361-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-361-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-361-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-361-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-361-5p Testosterone+Tamoxifen sensitive cell line (MCF-7)
hsa-miR-361-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-361-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-361-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-361-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-361-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-361-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MDAH-2774)

Error report submission