miRTarBase - #MIRT020084


—
pre-miRNA Information
pre-miRNA hsa-mir-361   
Genomic Coordinates chrX: 85903636 - 85903707
Synonyms MIRN361, hsa-mir-361, MIR361
Description Homo sapiens miR-361 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-361-5p
Sequence 6| UUAUCAGAAUCUCCAGGGGUAC |27
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 9 X - 85903694 29233923 MiREDiBase
A-to-I 15 X - 85903688 29976955, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1201941835 9 dbSNP
rs1341659793 19 dbSNP
rs1430235395 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ARF4   
Synonyms ARF2
Description ADP ribosylation factor 4
Transcript NM_001660   
Expression
Putative miRNA Targets on ARF4
3'UTR of ARF4
(miRNA target sites are highlighted)		 
>ARF4|NM_001660|3'UTR
   1 ATGAAATTGGATATCTAACCAAGGACATGTTTGATAAAATTGGTCTAGGCTTGTTACAACAAAATTAGTTTGTATCTTGG
  81 TTATTAAACAGTATCTGGGACTGGTTTGGGCAGAATATTAAACTTATTTTGTTGCCAATTATTGTTTACCGAGTATAATG
 161 TTGCTATTTAGCAATGTGCTTGGTTTTAAAGAAATTCTCCTTGGGAAAAAAGTATCCTCTTTTAATTTTACTTCCCATAA
 241 GCGTAAATGCCTGGACATAGCTCTTGTGCAACCTTTAAATAAATTGTTTTGAGTGTTTTTTGAGCCCCAGACAAATAATG
 321 TTTTAAAGTTATCCCCTTGCTACTTTACTGATACCTTTATCATTCCTGAGACAGTTTGCTAATTTAAAAATGTAGCATTC
 401 CATTTGTATTTATTTCTCTCCCTTGCCAAAAAGATTTTCTAATACTGCTTGTACCAGCCAGAGAAAGATCCAAAACACTA
 481 CTCAGCTCTCTTGCACTGAGGAAATTTTTCCCCCTACATTGACTCCTGGCCTACATCAGCCAAACTTAACCTTGGTGGGG
 561 TTTGGATTTGATAGCCAATTAGTTCTGTGCTGGTTGCAAAGAATTGATATTTAGATGGTTTTTAATACTCAGCAGATTGT
 641 CTTCCTTTATATTGTGTCTTTTTTATGTTGCATGTTGCTTTTGTTATCAGCCTGATTTTTTGCTCAGTATATGATAGTTC
 721 TGCTGATGTTTTGTTTATTGGGCAGACATATCTTCATTAAGAGTTTTTGGAAAACTCATCAAATTCGATGAATACATTTT
 801 CTTCATAACCCATTTGGAATTATTCCTAATAAAATGATAAAATACGTAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' caUGGGGACCUCUA-AGACUAUu 5'
            | ||  ||| || |:||||| 
Target 5' ctAACCAAGGACATGTTTGATAa 3'
 15 - 37 144.00 -12.20
2 
miRNA  3' caUGGGG--ACCUCUA----AGACUAUu 5'
            |||::  |||:| |    |:||||| 
Target 5' taACCTTGGTGGGGTTTGGATTTGATAg 3'
 547 - 574 140.00 -14.30
3 
miRNA  3' cauGGGGACC--UCUAA-GACUAUu 5'
             ||||| |  |  || |||||| 
Target 5' tatCCCCTTGCTACTTTACTGATAc 3'
 330 - 354 129.00 -11.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30529224 28 COSMIC
COSN30519049 34 COSMIC
COSN30516326 45 COSMIC
COSN18728534 105 COSMIC
COSN22551021 113 COSMIC
COSN22637119 234 COSMIC
COSN31521993 402 COSMIC
COSN31596105 594 COSMIC
COSN31516728 599 COSMIC
COSN31528650 601 COSMIC
COSN22023135 607 COSMIC
COSN5003701 629 COSMIC
COSN31528104 695 COSMIC
COSN15663022 795 COSMIC
COSN27119629 849 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs753788361 1 dbSNP
rs1201581782 3 dbSNP
rs1462473043 6 dbSNP
rs1265301338 7 dbSNP
rs765828909 8 dbSNP
rs201808484 10 dbSNP
rs749942883 15 dbSNP
rs1376614863 18 dbSNP
rs767180500 24 dbSNP
rs370576910 28 dbSNP
rs1286798925 29 dbSNP
rs775921715 33 dbSNP
rs1240816844 34 dbSNP
rs377224020 41 dbSNP
rs760068143 42 dbSNP
rs777306191 45 dbSNP
rs771601910 46 dbSNP
rs979396103 56 dbSNP
rs1388556373 70 dbSNP
rs1299249953 72 dbSNP
rs1401121582 72 dbSNP
rs774767694 73 dbSNP
rs968934455 76 dbSNP
rs1291997386 79 dbSNP
rs1000101374 89 dbSNP
rs1280020276 91 dbSNP
rs1315767440 103 dbSNP
rs11964 105 dbSNP
rs781707837 108 dbSNP
rs1265619011 111 dbSNP
rs1041323960 123 dbSNP
rs537262422 127 dbSNP
rs1207750239 135 dbSNP
rs1030032990 138 dbSNP
rs1428661893 141 dbSNP
rs555071543 150 dbSNP
rs371872970 151 dbSNP
rs937487055 153 dbSNP
rs1477018748 159 dbSNP
rs566171791 166 dbSNP
rs900133591 173 dbSNP
rs546488516 174 dbSNP
rs1398502053 199 dbSNP
rs951569388 201 dbSNP
rs183725596 202 dbSNP
rs918861915 210 dbSNP
rs1390107268 211 dbSNP
rs1360294635 221 dbSNP
rs1165875890 230 dbSNP
rs570666992 237 dbSNP
rs550719072 242 dbSNP
rs1423566671 243 dbSNP
rs1217978578 252 dbSNP
rs545047334 257 dbSNP
rs1323343030 276 dbSNP
rs1407281876 283 dbSNP
rs1388930392 284 dbSNP
rs1264499168 289 dbSNP
rs1488299487 303 dbSNP
rs530643725 316 dbSNP
rs1218191999 317 dbSNP
rs147220961 319 dbSNP
rs533171776 322 dbSNP
rs1487578622 323 dbSNP
rs1475810399 328 dbSNP
rs532046768 328 dbSNP
rs1425998661 339 dbSNP
rs542381001 354 dbSNP
rs1191453959 366 dbSNP
rs895906515 370 dbSNP
rs770757652 372 dbSNP
rs1358755337 377 dbSNP
rs1057454787 386 dbSNP
rs1269344126 390 dbSNP
rs937373796 393 dbSNP
rs1394087229 397 dbSNP
rs1223564226 399 dbSNP
rs746670622 415 dbSNP
rs559404493 416 dbSNP
rs1449487885 421 dbSNP
rs953328390 433 dbSNP
rs1241923779 437 dbSNP
rs1283241163 454 dbSNP
rs528491258 459 dbSNP
rs1032771899 462 dbSNP
rs927264086 466 dbSNP
rs1803148 468 dbSNP
rs1803147 473 dbSNP
rs1238564334 475 dbSNP
rs1484412731 477 dbSNP
rs777268022 478 dbSNP
rs559736513 483 dbSNP
rs1180507929 484 dbSNP
rs1242958347 485 dbSNP
rs1160739359 490 dbSNP
rs1440525561 490 dbSNP
rs149547076 495 dbSNP
rs903083102 500 dbSNP
rs1041628754 501 dbSNP
rs1464321629 501 dbSNP
rs1340904330 505 dbSNP
rs1377433209 511 dbSNP
rs191871906 513 dbSNP
rs1013860857 514 dbSNP
rs1306716482 516 dbSNP
rs1375432291 517 dbSNP
rs1260479605 523 dbSNP
rs1219325758 524 dbSNP
rs1279901562 537 dbSNP
rs1217352750 538 dbSNP
rs534079372 543 dbSNP
rs1458545335 548 dbSNP
rs1284320940 557 dbSNP
rs1439099604 564 dbSNP
rs188661501 573 dbSNP
rs1236594521 581 dbSNP
rs1323164764 582 dbSNP
rs1191880168 599 dbSNP
rs1410562441 601 dbSNP
rs185446774 616 dbSNP
rs1168373167 621 dbSNP
rs954835022 639 dbSNP
rs555035983 643 dbSNP
rs923053243 652 dbSNP
rs1400759279 654 dbSNP
rs756435719 654 dbSNP
rs1328800626 658 dbSNP
rs376504989 658 dbSNP
rs888195935 661 dbSNP
rs1048572051 663 dbSNP
rs930142179 672 dbSNP
rs192919441 689 dbSNP
rs188469232 698 dbSNP
rs183962464 709 dbSNP
rs1026197057 711 dbSNP
rs1283206835 711 dbSNP
rs1803145 712 dbSNP
rs552513739 718 dbSNP
rs911262527 725 dbSNP
rs1200941171 726 dbSNP
rs539080074 728 dbSNP
rs1256353689 731 dbSNP
rs1255592589 733 dbSNP
rs1311521111 738 dbSNP
rs985870568 742 dbSNP
rs1222652056 751 dbSNP
rs1248518431 752 dbSNP
rs1197532616 756 dbSNP
rs1198520780 764 dbSNP
rs562224016 765 dbSNP
rs6906 779 dbSNP
rs113261357 780 dbSNP
rs1032406324 793 dbSNP
rs201857922 795 dbSNP
rs1274415123 799 dbSNP
rs1347543303 804 dbSNP
rs1435144109 805 dbSNP
rs6907 805 dbSNP
rs905931561 809 dbSNP
rs6908 815 dbSNP
rs947385499 820 dbSNP
rs1329386734 830 dbSNP
rs568306571 836 dbSNP
rs370259576 838 dbSNP
rs1446201564 845 dbSNP
rs1020139239 846 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.824 4.0e-6 0.803 1.0e-5 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.672 1.2e-4 0.627 4.0e-4 25 Click to see details
GSE21687 Ependynoma primary tumors -0.413 3.5e-4 -0.371 1.3e-3 64 Click to see details
GSE28544 Breast cancer 0.595 1.1e-3 0.427 1.9e-2 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.779 6.7e-3 0.767 7.9e-3 9 Click to see details
GSE27834 Pluripotent stem cells 0.57 1.1e-2 0.541 1.5e-2 16 Click to see details
GSE19536 Breast cancer 0.179 3.7e-2 0.229 1.1e-2 100 Click to see details
GSE42095 Differentiated embryonic stem cells 0.349 5.1e-2 0.379 3.7e-2 23 Click to see details
GSE14794 Lymphoblastoid cells -0.162 6.4e-2 -0.210 2.3e-2 90 Click to see details
GSE19350 CNS germ cell tumors 0.464 6.4e-2 0.308 1.7e-1 12 Click to see details
GSE19783 ER- ER- breast cancer 0.162 7.7e-2 0.200 3.9e-2 79 Click to see details
GSE19783 ER+ ER+ breast cancer 0.261 1.3e-1 0.409 3.7e-2 20 Click to see details
GSE38226 Liver fibrosis 0.254 1.3e-1 0.318 8.0e-2 21 Click to see details
GSE28260 Renal cortex and medulla -0.259 2.0e-1 -0.247 2.1e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells 0.113 3.0e-1 0.120 2.9e-1 24 Click to see details
GSE17498 Multiple myeloma -0.082 3.1e-1 -0.105 2.6e-1 40 Click to see details
GSE21032 Prostate cancer 0.055 3.1e-1 0.103 1.8e-1 83 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.097 3.2e-1 0.097 3.2e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.022 4.5e-1 0.067 3.6e-1 32 Click to see details
GSE17306 Multiple myeloma -0.013 4.6e-1 0.007 4.8e-1 49 Click to see details
GSE17306 Multiple myeloma -0.013 4.6e-1 0.007 4.8e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC -0.531 0.01 -0.581 0 19 Click to see details
THCA -0.28 0.02 -0.268 0.02 59 Click to see details
KIRC -0.218 0.04 -0.197 0.05 68 Click to see details
ESCA -0.491 0.06 0.082 0.41 11 Click to see details
LUAD 0.446 0.07 0.455 0.07 12 Click to see details
KICH -0.287 0.08 -0.375 0.03 25 Click to see details
HNSC -0.164 0.15 -0.168 0.14 42 Click to see details
BRCA 0.082 0.23 0.093 0.2 84 Click to see details
LUSC -0.103 0.27 -0.184 0.13 38 Click to see details
STAD -0.11 0.27 -0.164 0.18 32 Click to see details
CHOL -0.193 0.31 -0.033 0.47 9 Click to see details
PRAD -0.047 0.37 0.080 0.29 50 Click to see details
CESC 0.374 0.38 0.500 0.33 3 Click to see details
COAD 0.129 0.38 -0.048 0.46 8 Click to see details
BLCA 0.063 0.4 0.104 0.34 18 Click to see details
LIHC -0.025 0.43 -0.023 0.44 49 Click to see details
PAAD -0.092 0.45 -0.400 0.3 4 Click to see details
PCPG -0.119 0.46 -0.500 0.33 3 Click to see details
KIRP -0.001 0.5 -0.025 0.45 32 Click to see details
KIRP -0.001 0.5 -0.025 0.45 32 Click to see details
KIRP -0.001 0.5 -0.025 0.45 32 Click to see details
152 hsa-miR-361-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004447 VEGFA vascular endothelial growth factor A 4 3
MIRT020074 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT020075 RPUSD4 RNA pseudouridylate synthase domain containing 4 1 1
MIRT020076 DEPDC1B DEP domain containing 1B 1 1
MIRT020077 CENPQ centromere protein Q 1 1
MIRT020078 EAPP E2F associated phosphoprotein 1 1
MIRT020079 CD46 CD46 molecule 1 1
MIRT020080 EDC3 enhancer of mRNA decapping 3 1 1
MIRT020081 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT020082 ZNF92 zinc finger protein 92 1 1
MIRT020083 ZNF776 zinc finger protein 776 1 1
MIRT020084 ARF4 ADP ribosylation factor 4 1 1
MIRT020085 WDR36 WD repeat domain 36 1 1
MIRT020086 ZMYND11 zinc finger MYND-type containing 11 1 1
MIRT020087 FGFR1OP2 FGFR1 oncogene partner 2 1 1
MIRT020088 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT020089 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT020090 CEBPG CCAAT/enhancer binding protein gamma 1 1
MIRT020091 KLHL28 kelch like family member 28 1 1
MIRT020092 G3BP2 G3BP stress granule assembly factor 2 1 1
MIRT020093 SRSF3 serine and arginine rich splicing factor 3 2 3
MIRT020094 RNF141 ring finger protein 141 1 1
MIRT020095 YOD1 YOD1 deubiquitinase 1 1
MIRT020096 DUSP3 dual specificity phosphatase 3 2 3
MIRT020097 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT020098 GTF2E1 general transcription factor IIE subunit 1 1 1
MIRT020099 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT020100 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT020101 ARCN1 archain 1 1 1
MIRT020102 RNF4 ring finger protein 4 1 1
MIRT020103 CPOX coproporphyrinogen oxidase 1 1
MIRT020104 CDC123 cell division cycle 123 1 1
MIRT044053 SLC30A5 solute carrier family 30 member 5 1 1
MIRT044054 ATP6V1A ATPase H+ transporting V1 subunit A 1 1
MIRT044055 TMEM62 transmembrane protein 62 1 1
MIRT044056 ZNF554 zinc finger protein 554 1 1
MIRT044057 MAGEF1 MAGE family member F1 1 1
MIRT044058 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT044059 DDX23 DEAD-box helicase 23 1 1
MIRT044060 BSG basigin (Ok blood group) 1 1
MIRT044061 VCPIP1 valosin containing protein interacting protein 1 1 1
MIRT044062 VCP valosin containing protein 1 1
MIRT044063 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT044064 SLC25A5 solute carrier family 25 member 5 1 1
MIRT044065 ZNF207 zinc finger protein 207 1 1
MIRT044066 EGFL7 EGF like domain multiple 7 1 1
MIRT044067 SETD1A SET domain containing 1A 1 1
MIRT044068 KIAA1549L KIAA1549 like 1 1
MIRT044069 COX1 cytochrome c oxidase subunit I 1 1
MIRT044070 SON SON DNA binding protein 1 1
MIRT044071 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT044072 PPA1 pyrophosphatase (inorganic) 1 1 1
MIRT044073 DCTN1 dynactin subunit 1 1 1
MIRT044074 ERAL1 Era like 12S mitochondrial rRNA chaperone 1 1 1
MIRT044075 CYCS cytochrome c, somatic 1 1
MIRT044076 ACTG1 actin gamma 1 1 1
MIRT044077 RANBP17 RAN binding protein 17 1 1
MIRT044078 QTRTD1 queuine tRNA-ribosyltransferase accessory subunit 2 1 1
MIRT044079 NCOA6 nuclear receptor coactivator 6 1 1
MIRT044080 ACLY ATP citrate lyase 1 1
MIRT044081 LNPEP leucyl and cystinyl aminopeptidase 1 1
MIRT044082 C14orf80 tubulin epsilon and delta complex 1 1 1
MIRT044083 VBP1 VHL binding protein 1 1 1
MIRT044084 OGDH oxoglutarate dehydrogenase 1 1
MIRT044085 ASH1L ASH1 like histone lysine methyltransferase 1 1
MIRT044086 MDC1 mediator of DNA damage checkpoint 1 1 1
MIRT044087 RPS2 ribosomal protein S2 1 1
MIRT044088 UCK2 uridine-cytidine kinase 2 1 1
MIRT044089 PRPF8 pre-mRNA processing factor 8 1 1
MIRT044090 GSPT1 G1 to S phase transition 1 1 1
MIRT044091 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT044092 USP22 ubiquitin specific peptidase 22 1 1
MIRT044093 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT044094 CNOT2 CCR4-NOT transcription complex subunit 2 1 1
MIRT044095 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT044096 WBP2 WW domain binding protein 2 1 1
MIRT044097 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT044098 GPC6 glypican 6 1 1
MIRT044099 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT044100 EIF3C eukaryotic translation initiation factor 3 subunit C 1 1
MIRT044101 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT044102 DOCK6 dedicator of cytokinesis 6 1 1
MIRT044103 ECD ecdysoneless cell cycle regulator 1 1
MIRT044104 EPHA4 EPH receptor A4 1 1
MIRT044105 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT044106 PSMD2 proteasome 26S subunit, non-ATPase 2 1 1
MIRT044107 RAE1 ribonucleic acid export 1 1 1
MIRT044108 RAVER1 ribonucleoprotein, PTB binding 1 1 1
MIRT044109 TP53BP1 tumor protein p53 binding protein 1 1 1
MIRT044110 COPS7A COP9 signalosome subunit 7A 1 1
MIRT044111 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT044112 CDK2 cyclin dependent kinase 2 1 1
MIRT044113 NOP2 NOP2 nucleolar protein 1 1
MIRT112226 MDM4 MDM4, p53 regulator 2 2
MIRT127737 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT226898 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT235959 BACH1 BTB domain and CNC homolog 1 2 2
MIRT241215 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT243416 ZMAT3 zinc finger matrin-type 3 2 2
MIRT294566 ZNF460 zinc finger protein 460 2 4
MIRT321041 RAC1 Rac family small GTPase 1 2 4
MIRT437351 STAT6 signal transducer and activator of transcription 6 3 1
MIRT438339 SND1 staphylococcal nuclease and tudor domain containing 1 3 1
MIRT444521 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT447699 ERP44 endoplasmic reticulum protein 44 2 2
MIRT464962 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT468193 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT473767 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT482630 AAR2 AAR2 splicing factor homolog 2 2
MIRT484150 CENPN centromere protein N 2 2
MIRT490457 PROSER2 proline and serine rich 2 2 2
MIRT493066 MTCH1 mitochondrial carrier 1 2 2
MIRT493579 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT506495 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT514833 ZNF154 zinc finger protein 154 2 6
MIRT519028 KYNU kynureninase 2 6
MIRT521750 PPIL1 peptidylprolyl isomerase like 1 2 4
MIRT522899 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 4
MIRT527368 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT530684 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT531397 TMEM18 transmembrane protein 18 2 2
MIRT533163 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT534579 RPL28 ribosomal protein L28 2 2
MIRT545955 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT553282 TSR1 TSR1, ribosome maturation factor 2 2
MIRT553531 TMEM185B transmembrane protein 185B 2 4
MIRT555601 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT556005 NAPG NSF attachment protein gamma 2 2
MIRT556738 KLHL15 kelch like family member 15 2 2
MIRT556971 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT558904 CCDC58 coiled-coil domain containing 58 2 2
MIRT559220 BLMH bleomycin hydrolase 2 2
MIRT559821 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT562671 AKT3 AKT serine/threonine kinase 3 2 2
MIRT564793 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT564827 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT570505 TFIP11 tuftelin interacting protein 11 2 2
MIRT571381 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572562 AFF1 AF4/FMR2 family member 1 2 2
MIRT610398 AR androgen receptor 2 2
MIRT641614 DEFB118 defensin beta 118 2 2
MIRT642143 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT643846 EPGN epithelial mitogen 2 4
MIRT651751 VEGFB vascular endothelial growth factor B 2 2
MIRT657353 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT662436 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT700990 PDE3A phosphodiesterase 3A 2 2
MIRT707393 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT712064 XRCC5 X-ray repair cross complementing 5 2 2
MIRT721145 PLCL1 phospholipase C like 1 (inactive) 2 2
MIRT724466 SMAD2 SMAD family member 2 2 2
MIRT731374 CXCR6 C-X-C motif chemokine receptor 6 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-361 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-361 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-361 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-361 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-361 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-361 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
miR-361-5p Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-mir-361 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-361 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-361-5p (5r,6s)-5-phenyl-3,4-diazatricyclo[8.4.0.02,6]tetradeca-1(14),2,10,12-tetraene-4-carbothioamide 5467466 NSC652809 sensitive
hsa-miR-361-5p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-361-5p [(4e,6z,8r,9r,10e,12r,13r,14r,16r)-9-carbamoyloxy-8,14-dimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-19-(prop-2-enylamino)-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-13-yl] 5-aminopentanoate 5469153 NSC683666 sensitive
hsa-miR-361-5p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-361-5p 2-(1-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468781 NSC676184 sensitive
hsa-miR-361-5p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-361-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-361-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-361-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-361-5p 4-[3-(3,4-dihydro-1h-isoquinolin-2-yl)prop-1-en-2-yl]-n-pyrazin-2-ylbenzamide 24205286 NSC734949 sensitive
hsa-miR-361-5p 6-(acetylamino)-2-(3-fluorophenyl)quinolin-4(1h)-one 376375 NSC657277 sensitive
hsa-miR-361-5p 6-aryl alkyl fluoro quinolone derivative 135465400 NSC731099 resistant
hsa-miR-361-5p 7-bromo-2,4,7-triphenyl-6H-benzo[a]quinolizin-5-ium;bromide 386208 NSC677924 sensitive
hsa-miR-361-5p 7-epi-10-deacetylbaccatin iii 6712096 NSC656178 sensitive
hsa-miR-361-5p Acetonitrile;iridium;tetramethyl buta-1,3-diene-1,2,3,4-tetracarboxylate;triphenylphosphane;triphenylphosphanium;tetrafluoroborate 498529 NSC630734 sensitive
hsa-miR-361-5p Antineoplastic-642316 369949 NSC642316 sensitive
hsa-miR-361-5p Auranofin 6333901 NSC321521 sensitive
hsa-miR-361-5p Ayanin 5280682 NSC691652 resistant
hsa-miR-361-5p Bis(trifluoromethylsulfonyl)azanide;trihexyl(tetradecyl)phosphanium 11181836 NSC747251 sensitive
hsa-miR-361-5p Capri blue 102162 NSC7821 sensitive
hsa-miR-361-5p Cbdive_010867 269887 NSC111580 resistant
hsa-miR-361-5p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-361-5p Ethyl 3-(9-chloro-4-hydroxy-2,5,11-trimethyl-6h-pyrido[3,2-b]carbazol-3-yl)propanoate 386719 NSC679261 sensitive
hsa-miR-361-5p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 sensitive
hsa-miR-361-5p Jasplakinolide epoxide c 372550 NSC647763 sensitive
hsa-miR-361-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 resistant
hsa-miR-361-5p N'-butyl-4-[2-[2-[4-(N'-butylcarbamimidoyl)phenoxy]ethylsulfanyl]ethoxy]benzenecarboximidamide;hydrochloride 54613223 NSC750501 sensitive
hsa-miR-361-5p N-(1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl)benzamide 369939 NSC642306 sensitive
hsa-miR-361-5p Rogiolol 402519 NSC716545 sensitive
hsa-miR-361-5p Salinomycin, sodium 60148415 NSC758465 sensitive
hsa-miR-361-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7, MDA-MB-231)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-361-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-miR-361-5p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-361-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-361-5p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-361-5p Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-361-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-361-5p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive Low Gastric Cancer cell line (SGC-7901, MKN28)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-361-5p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (MGC-803)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-361-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-361-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-361-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-361-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-361-5p Testosterone+Tamoxifen sensitive cell line (MCF-7)
hsa-miR-361-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-361-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-361-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-361-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-361-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-361-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MDAH-2774)

Error report submission