miRTarBase - #MIRT020086


—
pre-miRNA Information
pre-miRNA hsa-mir-361   
Genomic Coordinates chrX: 85903636 - 85903707
Synonyms MIRN361, hsa-mir-361, MIR361
Description Homo sapiens miR-361 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-361-5p
Sequence 6| UUAUCAGAAUCUCCAGGGGUAC |27
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 9 X - 85903694 29233923 MiREDiBase
A-to-I 15 X - 85903688 29976955, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1201941835 9 dbSNP
rs1341659793 19 dbSNP
rs1430235395 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZMYND11   
Synonyms BRAM1, BS69, MRD30
Description zinc finger MYND-type containing 11
Transcript NM_006624   
Other Transcripts NM_212479   
Expression
Putative miRNA Targets on ZMYND11
3'UTR of ZMYND11
(miRNA target sites are highlighted)		 
>ZMYND11|NM_006624|3'UTR
   1 AGCTGGCCCTTCCCGGAGTCACCCCGATGATTACTCTTTTCAGACACAGCGGTTTTTGTTTCCAAGAAGCCAAAATTGTT
  81 TAGAATTTGCTTCCCATTTTGCACCAGCCTTTAAACACTTTTCGTGAAGAAATTTTGCACAGTAGTTTAAATCTTTTGTT
 161 AATGCTCCTCCGAAGTTTTTCAGGGGGTAAAAGTAACATCAGTGGAGGGTATTATTTTAAATAAATTTTAATTGAGAATT
 241 TGTTGCATTTTCAGCAAATTTTAAAACATTTTTAGGTTTTACAGAGATTTTAACCTTTAAACAACAGATCTTTAAAAAAC
 321 AGGTGAATACAAGTGAGTTTAACAAAGAAACATTTAGAATAGATCTGAATGTAAGAACTACAGAACTGTTTCAGAAATAA
 401 AACATACTACCTTGATGTGACATTTTTTTCTTAACCTTGTTGAGCTGGTTTTGTTCAGCTTAATTTACTGTTCAAAGGCA
 481 TTATCTGTTGGTCACACCAGTGGGTATATGATTGAATTTAGGGAACAGGGTTGACACAGCAGGGCTAGTCCTGCATATTT
 561 TTTCTTAAATATTTCCCAATTGTGTTTTTCATTATTTCTTTTCAATATATAACTTTTATAACAAATTATTAGCTTTGATC
 641 TTGTAGTTTAAAATTGCAGGGAACTGGGGTAATCTTTTACTGAGCTGGATCTTAGAGAAAATGAATATTTAAATTTTAAA
 721 GTTTGCACATTTCATCTTTGTCCTAACATGAGTGCTTGTAACAAAATAAACAACAAAAACAAAGCCAAAAACTACCTTTA
 801 TCCATATGTGAAATTATAGATGAGGCATACGAATTTGTTTAATGCTTCCCTTCCCTTCCCACATATCATCTCACTGCCTA
 881 TTATCTGGTGTCACCTCATGTATCGTAAGTTAATACTAAAAGAAGAGAAAGCACTTAAGTTTCACAGAAGCCGTTATGTT
 961 TGTAGTAATGGGTCATTGCCTACTAATGAACTCCATCACTGTACACAGAATGAAGAATAATGCATGTTAATTTTCTTGTA
1041 TTAAAGATGCCGTGATTTGTAAAAAGTCTGTATTTTGCGGAATGTCTGGATTAAGAAGCATTACCAATAGGAATGGATCG
1121 ATAGTTGAATAATGATTTTTTATACATAGATATATAAAATACAGCCAGGAAAACTTAAATTACTTTTCTTTTAAAATATC
1201 TCACAATTTATGTGGTATTTTTAAAGACTGATCTTAGACCAAGTCAAATTCCCATTTATCATTTAGTTATTTTTTGAGGT
1281 TAGAGAATAATTTGTACATATTTATTTAGACCTTTGATATTTATTAAAGCAATTACTCACAATGGAAGTGAAAGAATCAG
1361 GAGAAAAGCCTTTTAAAAAGTATTCTCCAGGTTTGTCAGGGTCACTCTAAAGATAAAAATGTAACTAAGTCTTCTGTGAA
1441 ATATCATCCATCTAATCTTGATGCTGTTGCAGATGGTGGTGACACAAGTTAATTGACAAACTACTGCCAAATGGTGCACA
1521 ATATTTTGTAAAAAGTACCCAGTAGCCCCATTTCATACAATGTACCTAAATTATGCAGTAACTTGGCATCATCGTTCCCT
1601 CCTTGTTGCTGTGTAATTAGTCAGTGTTGCCACAGTGTGTGGCGCTGATGGAGATGTCAGAACCGAGAACACTTAACCTT
1681 CTTTGATTGTTTTTCAAGTTTTAAGACTTCGATCCACCCCTATGAGAGCAAGTAATTGTGGAAATATTTTTGGTGTAAAA
1761 TCATTCCAGAGTATGTAATATTTAACTGATAGCTGCATGAAAGTGAGATTCGTGTTACTTTGGCTTTTCTGTCTCTGTTG
1841 ACACGGTTGCACATTTCCAAGTTACTACAGCGTGAAAACTGTGTGTTTAAAAAAAAACAAAATTAAAAAAAGAGATTGTG
1921 GCCTGGTTTTGTAAAAGTTTTAGGTAAAATTACAATTGATTGTTTTAGGAATCATTATTAAAAATTTTCTGCAAATCATA
2001 AAGCTATATCGAGGTGTTGAGCTTAGCCACTATGCACATTGTAATTATTCATTGTGGCTGTCCAGTTCTATGATGCATTC
2081 TGGCATTTTGTAAGCTGCTCTGACTAGCAATATATAGATTCATTTAATGTGTTAACATTGGTTAATAAATGTATTTAAAA
2161 AAAACTAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' caUGGGGACCUCU-AAGACUAUu 5'
            |::: |  |||  |:||||| 
Target 5' atATTTATTTAGACCTTTGATAt 3'
 1298 - 1320 132.00 -5.30
2 
miRNA  3' cauggggaccucuaaGACUAUu 5'
                         |||||| 
Target 5' gtatgtaatatttaaCTGATAg 3'
 1771 - 1792 120.00 -7.20
3 
miRNA  3' cauGGGGACCUCUA--AGACUAUu 5'
             :| |||   ||  ||||:|: 
Target 5' atcTCACTGCCTATTATCTGGTGt 3'
 868 - 891 117.00 -10.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30662409 16 COSMIC
COSN20077031 42 COSMIC
COSN30193077 46 COSMIC
COSN30534385 50 COSMIC
COSN24303507 52 COSMIC
COSN31523649 57 COSMIC
COSN27005801 58 COSMIC
COSN30614956 74 COSMIC
COSN31489721 366 COSMIC
COSN31480251 368 COSMIC
COSN31530983 402 COSMIC
COSN31480253 431 COSMIC
COSN30163525 443 COSMIC
COSN5818577 538 COSMIC
COSN20587558 580 COSMIC
COSN31516885 599 COSMIC
COSN31520541 732 COSMIC
COSN5284283 734 COSMIC
COSN31519691 791 COSMIC
COSN30024590 813 COSMIC
COSN5284286 820 COSMIC
COSN30174057 823 COSMIC
COSN31530182 832 COSMIC
COSN26465260 871 COSMIC
COSN8639583 907 COSMIC
COSN31585314 923 COSMIC
COSN31546380 939 COSMIC
COSN31491223 984 COSMIC
COSN31591391 1079 COSMIC
COSN30175020 1081 COSMIC
COSN31551372 1165 COSMIC
COSN24101792 1261 COSMIC
COSN31571821 1262 COSMIC
COSN31543768 1295 COSMIC
COSN29163584 1582 COSMIC
COSN8639587 1655 COSMIC
COSN31607275 1742 COSMIC
COSN31569921 1744 COSMIC
COSN31579138 1815 COSMIC
COSN31541801 1845 COSMIC
COSN17402269 1890 COSMIC
COSN31545900 1898 COSMIC
COSN26643649 2012 COSMIC
COSN31515472 2122 COSMIC
COSN20092048 2157 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1287843597 4 dbSNP
rs768994205 8 dbSNP
rs773903266 9 dbSNP
rs1256526042 11 dbSNP
rs1380745692 13 dbSNP
rs761475538 14 dbSNP
rs375369771 15 dbSNP
rs1237071861 16 dbSNP
rs758504915 22 dbSNP
rs749996660 26 dbSNP
rs760260406 27 dbSNP
rs1433252133 32 dbSNP
rs766486236 41 dbSNP
rs1360238653 43 dbSNP
rs1478522342 44 dbSNP
rs753755318 46 dbSNP
rs1263211304 47 dbSNP
rs754734769 47 dbSNP
rs971592744 48 dbSNP
rs182482931 51 dbSNP
rs534128221 52 dbSNP
rs781386126 53 dbSNP
rs1033462728 59 dbSNP
rs1335816561 83 dbSNP
rs896232171 91 dbSNP
rs1012441810 105 dbSNP
rs973151867 109 dbSNP
rs1270813473 117 dbSNP
rs1435733015 121 dbSNP
rs1044720738 123 dbSNP
rs903538810 124 dbSNP
rs920274462 126 dbSNP
rs1310150306 142 dbSNP
rs1325355554 154 dbSNP
rs1376262309 154 dbSNP
rs1000505099 158 dbSNP
rs928939747 171 dbSNP
rs983334789 172 dbSNP
rs911807495 173 dbSNP
rs944591294 181 dbSNP
rs1039268037 182 dbSNP
rs1346986720 183 dbSNP
rs1376426678 183 dbSNP
rs3758506 185 dbSNP
rs1200868590 188 dbSNP
rs1237904158 191 dbSNP
rs1197029408 194 dbSNP
rs764172684 212 dbSNP
rs900609508 223 dbSNP
rs1273872352 259 dbSNP
rs187059051 260 dbSNP
rs1459748889 262 dbSNP
rs1218713577 281 dbSNP
rs1033194643 289 dbSNP
rs1200139228 293 dbSNP
rs1342875922 295 dbSNP
rs936104569 297 dbSNP
rs1456939211 299 dbSNP
rs956298805 300 dbSNP
rs1010320974 308 dbSNP
rs1329011383 318 dbSNP
rs1448602714 324 dbSNP
rs190584441 326 dbSNP
rs1333007100 327 dbSNP
rs374874943 332 dbSNP
rs1010236528 333 dbSNP
rs542442200 334 dbSNP
rs955472018 336 dbSNP
rs985973149 338 dbSNP
rs1455054950 341 dbSNP
rs1172409526 344 dbSNP
rs1380128267 344 dbSNP
rs1001733705 346 dbSNP
rs1441845953 346 dbSNP
rs1233670234 361 dbSNP
rs1427620711 363 dbSNP
rs1034948335 364 dbSNP
rs1211555148 365 dbSNP
rs1489467832 366 dbSNP
rs1306883956 372 dbSNP
rs1242050688 376 dbSNP
rs1373705264 398 dbSNP
rs1332316896 399 dbSNP
rs911329742 403 dbSNP
rs1283250335 408 dbSNP
rs1399773783 410 dbSNP
rs761728211 412 dbSNP
rs1389778701 415 dbSNP
rs962882421 416 dbSNP
rs3834409 423 dbSNP
rs973568262 423 dbSNP
rs1332815343 427 dbSNP
rs1233868254 439 dbSNP
rs962676289 448 dbSNP
rs375712698 461 dbSNP
rs1360443990 463 dbSNP
rs1157311193 468 dbSNP
rs1402817802 471 dbSNP
rs1409107155 480 dbSNP
rs1181526081 481 dbSNP
rs1282476796 488 dbSNP
rs1321160625 492 dbSNP
rs974080041 494 dbSNP
rs1188733037 500 dbSNP
rs918465947 500 dbSNP
rs1487962657 501 dbSNP
rs556102305 522 dbSNP
rs1283809020 524 dbSNP
rs929914713 529 dbSNP
rs991999442 536 dbSNP
rs1317321084 538 dbSNP
rs1288833499 540 dbSNP
rs950427226 553 dbSNP
rs917773608 554 dbSNP
rs1398852037 555 dbSNP
rs947813660 556 dbSNP
rs572728265 570 dbSNP
rs776758441 571 dbSNP
rs1338294175 576 dbSNP
rs911838736 580 dbSNP
rs966339697 585 dbSNP
rs1433449598 587 dbSNP
rs1164486414 598 dbSNP
rs1346198841 598 dbSNP
rs1403873595 599 dbSNP
rs1420291096 605 dbSNP
rs1193613473 622 dbSNP
rs1477546491 630 dbSNP
rs1045192311 632 dbSNP
rs181818045 639 dbSNP
rs1188243318 643 dbSNP
rs1486136912 644 dbSNP
rs147376275 658 dbSNP
rs935817416 660 dbSNP
rs1323220346 662 dbSNP
rs1054582108 674 dbSNP
rs1198767862 677 dbSNP
rs533156913 688 dbSNP
rs1279502294 692 dbSNP
rs1052052928 706 dbSNP
rs1479020901 707 dbSNP
rs946057682 708 dbSNP
rs892039927 714 dbSNP
rs1010472997 719 dbSNP
rs767368083 729 dbSNP
rs1460642437 742 dbSNP
rs1465262849 744 dbSNP
rs760009072 744 dbSNP
rs1002205909 748 dbSNP
rs1429117689 749 dbSNP
rs1424377951 757 dbSNP
rs750061528 758 dbSNP
rs1189340013 759 dbSNP
rs879021387 768 dbSNP
rs1056017432 772 dbSNP
rs1386219459 774 dbSNP
rs1197665019 775 dbSNP
rs1456154632 775 dbSNP
rs1302482936 777 dbSNP
rs1029812011 783 dbSNP
rs1227516870 784 dbSNP
rs891263537 794 dbSNP
rs1007071211 801 dbSNP
rs1401645672 803 dbSNP
rs1018739518 806 dbSNP
rs1373690273 825 dbSNP
rs1446386269 829 dbSNP
rs112037913 831 dbSNP
rs760312613 832 dbSNP
rs1358597771 837 dbSNP
rs1173901484 845 dbSNP
rs1455505002 845 dbSNP
rs563626850 848 dbSNP
rs1395508335 854 dbSNP
rs1177757287 859 dbSNP
rs1437512112 861 dbSNP
rs950459504 863 dbSNP
rs1025687313 864 dbSNP
rs765807049 865 dbSNP
rs185845198 866 dbSNP
rs1221026231 867 dbSNP
rs547940877 881 dbSNP
rs992510578 901 dbSNP
rs965714216 905 dbSNP
rs753448544 906 dbSNP
rs190256332 910 dbSNP
rs1375068341 911 dbSNP
rs369255949 933 dbSNP
rs1262910309 935 dbSNP
rs527554832 938 dbSNP
rs1301139656 939 dbSNP
rs1436563938 952 dbSNP
rs980638213 953 dbSNP
rs957464557 954 dbSNP
rs1417649032 958 dbSNP
rs1365279211 962 dbSNP
rs924994218 972 dbSNP
rs1182121204 987 dbSNP
rs936463699 1000 dbSNP
rs913341973 1001 dbSNP
rs1485673425 1005 dbSNP
rs1281680515 1015 dbSNP
rs1216461942 1020 dbSNP
rs1349024197 1021 dbSNP
rs1262828656 1026 dbSNP
rs1052038284 1030 dbSNP
rs1240085860 1031 dbSNP
rs1321332622 1034 dbSNP
rs1457486581 1041 dbSNP
rs753212467 1046 dbSNP
rs553378096 1049 dbSNP
rs752022388 1052 dbSNP
rs1398031866 1060 dbSNP
rs928634189 1061 dbSNP
rs1158908406 1063 dbSNP
rs937318177 1066 dbSNP
rs753787868 1069 dbSNP
rs1166574922 1070 dbSNP
rs1475260782 1071 dbSNP
rs1051755008 1074 dbSNP
rs1193624451 1079 dbSNP
rs570462703 1080 dbSNP
rs1421415222 1085 dbSNP
rs1056489340 1086 dbSNP
rs1356003826 1095 dbSNP
rs539043210 1097 dbSNP
rs1361004452 1099 dbSNP
rs995662091 1109 dbSNP
rs1335586632 1116 dbSNP
rs1047200765 1118 dbSNP
rs1018481660 1121 dbSNP
rs1225216083 1135 dbSNP
rs1004603930 1136 dbSNP
rs887254870 1136 dbSNP
rs1391952283 1143 dbSNP
rs1314461031 1145 dbSNP
rs1327537635 1146 dbSNP
rs898571682 1146 dbSNP
rs1461610686 1147 dbSNP
rs1018617675 1150 dbSNP
rs1340663398 1152 dbSNP
rs556273883 1154 dbSNP
rs966105774 1160 dbSNP
rs1375288028 1161 dbSNP
rs995846971 1163 dbSNP
rs1029351347 1168 dbSNP
rs1251484661 1175 dbSNP
rs957290006 1176 dbSNP
rs995621118 1179 dbSNP
rs1194148262 1180 dbSNP
rs1257571642 1180 dbSNP
rs990041158 1183 dbSNP
rs757641318 1192 dbSNP
rs569644399 1196 dbSNP
rs370220813 1205 dbSNP
rs1232389697 1207 dbSNP
rs1312253863 1209 dbSNP
rs1020141691 1212 dbSNP
rs967168570 1216 dbSNP
rs1399085548 1217 dbSNP
rs1326365911 1244 dbSNP
rs182388854 1247 dbSNP
rs928733782 1249 dbSNP
rs1180247079 1261 dbSNP
rs1477973072 1261 dbSNP
rs1238773224 1262 dbSNP
rs1356543707 1263 dbSNP
rs1393715480 1263 dbSNP
rs1454922029 1265 dbSNP
rs937372620 1271 dbSNP
rs1179853083 1281 dbSNP
rs1025634875 1285 dbSNP
rs137970569 1295 dbSNP
rs1199849911 1299 dbSNP
rs1260584501 1301 dbSNP
rs1443953411 1305 dbSNP
rs1282281550 1310 dbSNP
rs992186921 1318 dbSNP
rs1375795786 1321 dbSNP
rs555967219 1321 dbSNP
rs1202489408 1333 dbSNP
rs1047276923 1337 dbSNP
rs1335878261 1341 dbSNP
rs1327624938 1349 dbSNP
rs1374170076 1354 dbSNP
rs1176004861 1361 dbSNP
rs1444199346 1362 dbSNP
rs1011000296 1364 dbSNP
rs1175740366 1371 dbSNP
rs944173031 1388 dbSNP
rs1233577546 1391 dbSNP
rs763430526 1413 dbSNP
rs1382232752 1417 dbSNP
rs1040559364 1421 dbSNP
rs1025278113 1422 dbSNP
rs1484693671 1422 dbSNP
rs1259546040 1426 dbSNP
rs901577751 1431 dbSNP
rs1352759108 1434 dbSNP
rs1281846535 1444 dbSNP
rs969335044 1446 dbSNP
rs996266714 1451 dbSNP
rs764491304 1453 dbSNP
rs1412394491 1484 dbSNP
rs925146333 1492 dbSNP
rs1356754577 1539 dbSNP
rs1344473907 1544 dbSNP
rs957765065 1547 dbSNP
rs572790948 1550 dbSNP
rs987826165 1551 dbSNP
rs1157352544 1554 dbSNP
rs1402727479 1561 dbSNP
rs1028675443 1565 dbSNP
rs1164409163 1566 dbSNP
rs1474278963 1567 dbSNP
rs913665949 1569 dbSNP
rs1304339481 1577 dbSNP
rs1420065832 1586 dbSNP
rs1188625640 1591 dbSNP
rs932945364 1594 dbSNP
rs1051438982 1595 dbSNP
rs912801829 1599 dbSNP
rs1231026352 1603 dbSNP
rs1336356976 1614 dbSNP
rs1020174322 1619 dbSNP
rs759108898 1623 dbSNP
rs1361857608 1631 dbSNP
rs1334203609 1632 dbSNP
rs942998014 1636 dbSNP
rs541778558 1644 dbSNP
rs1039885235 1645 dbSNP
rs1460045061 1650 dbSNP
rs958800039 1656 dbSNP
rs898690846 1665 dbSNP
rs995694532 1666 dbSNP
rs576975361 1668 dbSNP
rs1240171874 1675 dbSNP
rs1306945811 1678 dbSNP
rs1188144757 1679 dbSNP
rs919952861 1679 dbSNP
rs1475633346 1683 dbSNP
rs931281946 1684 dbSNP
rs1211490838 1686 dbSNP
rs1235938002 1687 dbSNP
rs1256929138 1698 dbSNP
rs1461081695 1699 dbSNP
rs1202004177 1702 dbSNP
rs1047151915 1706 dbSNP
rs1240184364 1713 dbSNP
rs1458280546 1717 dbSNP
rs887200607 1724 dbSNP
rs1013965985 1739 dbSNP
rs1025015622 1751 dbSNP
rs558144744 1752 dbSNP
rs1002150915 1756 dbSNP
rs578005030 1758 dbSNP
rs1407221122 1772 dbSNP
rs1305197932 1789 dbSNP
rs908799176 1794 dbSNP
rs944236753 1799 dbSNP
rs1363144798 1812 dbSNP
rs1439057439 1813 dbSNP
rs543443610 1813 dbSNP
rs1032239021 1822 dbSNP
rs899974616 1825 dbSNP
rs1461561135 1836 dbSNP
rs1352791351 1838 dbSNP
rs185084569 1846 dbSNP
rs1410440167 1858 dbSNP
rs756932821 1866 dbSNP
rs1394311780 1868 dbSNP
rs549088227 1869 dbSNP
rs1253254415 1870 dbSNP
rs1050563866 1871 dbSNP
rs780566839 1872 dbSNP
rs780629181 1873 dbSNP
rs552876250 1880 dbSNP
rs892809259 1881 dbSNP
rs1011244664 1889 dbSNP
rs1020247487 1889 dbSNP
rs1373577265 1889 dbSNP
rs529301481 1890 dbSNP
rs987533243 1894 dbSNP
rs1391004232 1895 dbSNP
rs541645519 1896 dbSNP
rs1297072754 1898 dbSNP
rs1035547306 1899 dbSNP
rs561512276 1899 dbSNP
rs1171617331 1905 dbSNP
rs958756605 1910 dbSNP
rs1395411692 1911 dbSNP
rs1039957415 1913 dbSNP
rs920190598 1915 dbSNP
rs1252123369 1917 dbSNP
rs1027446623 1922 dbSNP
rs1485020906 1933 dbSNP
rs1302492101 1934 dbSNP
rs1257455126 1939 dbSNP
rs1209300225 1955 dbSNP
rs1323279513 1955 dbSNP
rs1350547797 1956 dbSNP
rs527469840 1957 dbSNP
rs952756175 1961 dbSNP
rs190666088 1970 dbSNP
rs1318834344 1971 dbSNP
rs1311026635 1972 dbSNP
rs965616789 1974 dbSNP
rs373126909 1976 dbSNP
rs1479656152 1980 dbSNP
rs1288058841 1985 dbSNP
rs1451264741 1987 dbSNP
rs564222612 1988 dbSNP
rs1159305543 1991 dbSNP
rs977378978 1999 dbSNP
rs1414974717 2006 dbSNP
rs1393871298 2007 dbSNP
rs1486929713 2008 dbSNP
rs41285615 2010 dbSNP
rs865932013 2011 dbSNP
rs1013705026 2015 dbSNP
rs1173943700 2016 dbSNP
rs1425375416 2020 dbSNP
rs1229202239 2026 dbSNP
rs1334309346 2028 dbSNP
rs1291487012 2029 dbSNP
rs780115038 2033 dbSNP
rs1169200536 2034 dbSNP
rs1352252069 2038 dbSNP
rs749417126 2040 dbSNP
rs1002628030 2041 dbSNP
rs747463169 2045 dbSNP
rs1289125139 2047 dbSNP
rs1032185041 2049 dbSNP
rs1458933078 2054 dbSNP
rs957950069 2055 dbSNP
rs184108341 2061 dbSNP
rs569751345 2062 dbSNP
rs1020775823 2070 dbSNP
rs535506798 2071 dbSNP
rs549082582 2091 dbSNP
rs1345380086 2094 dbSNP
rs987264987 2098 dbSNP
rs1403533747 2114 dbSNP
rs1264263954 2136 dbSNP
rs1041387096 2157 dbSNP
rs947065628 2157 dbSNP
rs566303470 2158 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.711 2.2e-4 0.638 1.2e-3 20 Click to see details
GSE28544 Breast cancer 0.633 4.5e-4 0.519 4.7e-3 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.49 8.8e-3 0.460 1.4e-2 23 Click to see details
GSE19350 CNS germ cell tumors 0.455 6.9e-2 0.699 5.7e-3 12 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.284 8.4e-2 0.272 9.4e-2 25 Click to see details
GSE17498 Multiple myeloma 0.218 8.8e-2 0.233 7.4e-2 40 Click to see details
GSE32688 Pancreatic cancer -0.244 8.9e-2 -0.189 1.5e-1 32 Click to see details
GSE21032 Prostate cancer 0.145 9.5e-2 0.124 1.3e-1 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.242 1.2e-1 -0.189 1.8e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.231 1.4e-1 0.199 1.8e-1 24 Click to see details
GSE21687 Ependynoma primary tumors 0.13 1.5e-1 0.148 1.2e-1 64 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.38 1.6e-1 -0.283 2.3e-1 9 Click to see details
GSE19783 ER+ ER+ breast cancer 0.227 1.7e-1 0.078 3.7e-1 20 Click to see details
GSE19536 Breast cancer 0.08 2.1e-1 0.077 2.2e-1 100 Click to see details
GSE27834 Pluripotent stem cells -0.199 2.3e-1 -0.179 2.5e-1 16 Click to see details
GSE21849 B cell lymphoma -0.09 3.2e-1 -0.107 2.9e-1 29 Click to see details
GSE28260 Renal cortex and medulla 0.134 3.3e-1 -0.060 4.2e-1 13 Click to see details
GSE14794 Lymphoblastoid cells 0.032 3.8e-1 0.014 4.5e-1 90 Click to see details
GSE17306 Multiple myeloma 0.04 3.9e-1 0.021 4.4e-1 49 Click to see details
GSE38226 Liver fibrosis -0.056 4.0e-1 -0.017 4.7e-1 21 Click to see details
GSE19783 ER- ER- breast cancer 0.002 4.9e-1 0.005 4.8e-1 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD -0.985 0.01 -1.000 0.5 4 Click to see details
BLCA -0.454 0.03 -0.527 0.01 18 Click to see details
THCA 0.207 0.06 0.210 0.06 59 Click to see details
ESCA 0.472 0.07 0.373 0.13 11 Click to see details
HNSC -0.22 0.08 -0.159 0.16 42 Click to see details
CHOL -0.504 0.08 -0.450 0.11 9 Click to see details
STAD -0.228 0.1 -0.233 0.1 32 Click to see details
BRCA -0.121 0.14 -0.140 0.1 84 Click to see details
COAD 0.381 0.18 0.429 0.14 8 Click to see details
LIHC -0.117 0.21 -0.114 0.22 49 Click to see details
LUAD 0.249 0.22 0.203 0.26 12 Click to see details
PCPG -0.716 0.25 -0.500 0.33 3 Click to see details
KICH -0.13 0.27 -0.158 0.23 25 Click to see details
UCEC -0.12 0.31 -0.032 0.45 19 Click to see details
LUSC 0.08 0.32 0.042 0.4 38 Click to see details
KIRC 0.051 0.34 0.047 0.35 68 Click to see details
CESC -0.343 0.39 -0.500 0.33 3 Click to see details
PRAD -0.04 0.39 -0.151 0.15 50 Click to see details
KIRP 0.021 0.45 0.090 0.31 32 Click to see details
KIRP 0.021 0.45 0.090 0.31 32 Click to see details
KIRP 0.021 0.45 0.090 0.31 32 Click to see details
152 hsa-miR-361-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004447 VEGFA vascular endothelial growth factor A 4 3
MIRT020074 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT020075 RPUSD4 RNA pseudouridylate synthase domain containing 4 1 1
MIRT020076 DEPDC1B DEP domain containing 1B 1 1
MIRT020077 CENPQ centromere protein Q 1 1
MIRT020078 EAPP E2F associated phosphoprotein 1 1
MIRT020079 CD46 CD46 molecule 1 1
MIRT020080 EDC3 enhancer of mRNA decapping 3 1 1
MIRT020081 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT020082 ZNF92 zinc finger protein 92 1 1
MIRT020083 ZNF776 zinc finger protein 776 1 1
MIRT020084 ARF4 ADP ribosylation factor 4 1 1
MIRT020085 WDR36 WD repeat domain 36 1 1
MIRT020086 ZMYND11 zinc finger MYND-type containing 11 1 1
MIRT020087 FGFR1OP2 FGFR1 oncogene partner 2 1 1
MIRT020088 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT020089 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT020090 CEBPG CCAAT/enhancer binding protein gamma 1 1
MIRT020091 KLHL28 kelch like family member 28 1 1
MIRT020092 G3BP2 G3BP stress granule assembly factor 2 1 1
MIRT020093 SRSF3 serine and arginine rich splicing factor 3 2 3
MIRT020094 RNF141 ring finger protein 141 1 1
MIRT020095 YOD1 YOD1 deubiquitinase 1 1
MIRT020096 DUSP3 dual specificity phosphatase 3 2 3
MIRT020097 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT020098 GTF2E1 general transcription factor IIE subunit 1 1 1
MIRT020099 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT020100 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT020101 ARCN1 archain 1 1 1
MIRT020102 RNF4 ring finger protein 4 1 1
MIRT020103 CPOX coproporphyrinogen oxidase 1 1
MIRT020104 CDC123 cell division cycle 123 1 1
MIRT044053 SLC30A5 solute carrier family 30 member 5 1 1
MIRT044054 ATP6V1A ATPase H+ transporting V1 subunit A 1 1
MIRT044055 TMEM62 transmembrane protein 62 1 1
MIRT044056 ZNF554 zinc finger protein 554 1 1
MIRT044057 MAGEF1 MAGE family member F1 1 1
MIRT044058 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT044059 DDX23 DEAD-box helicase 23 1 1
MIRT044060 BSG basigin (Ok blood group) 1 1
MIRT044061 VCPIP1 valosin containing protein interacting protein 1 1 1
MIRT044062 VCP valosin containing protein 1 1
MIRT044063 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT044064 SLC25A5 solute carrier family 25 member 5 1 1
MIRT044065 ZNF207 zinc finger protein 207 1 1
MIRT044066 EGFL7 EGF like domain multiple 7 1 1
MIRT044067 SETD1A SET domain containing 1A 1 1
MIRT044068 KIAA1549L KIAA1549 like 1 1
MIRT044069 COX1 cytochrome c oxidase subunit I 1 1
MIRT044070 SON SON DNA binding protein 1 1
MIRT044071 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT044072 PPA1 pyrophosphatase (inorganic) 1 1 1
MIRT044073 DCTN1 dynactin subunit 1 1 1
MIRT044074 ERAL1 Era like 12S mitochondrial rRNA chaperone 1 1 1
MIRT044075 CYCS cytochrome c, somatic 1 1
MIRT044076 ACTG1 actin gamma 1 1 1
MIRT044077 RANBP17 RAN binding protein 17 1 1
MIRT044078 QTRTD1 queuine tRNA-ribosyltransferase accessory subunit 2 1 1
MIRT044079 NCOA6 nuclear receptor coactivator 6 1 1
MIRT044080 ACLY ATP citrate lyase 1 1
MIRT044081 LNPEP leucyl and cystinyl aminopeptidase 1 1
MIRT044082 C14orf80 tubulin epsilon and delta complex 1 1 1
MIRT044083 VBP1 VHL binding protein 1 1 1
MIRT044084 OGDH oxoglutarate dehydrogenase 1 1
MIRT044085 ASH1L ASH1 like histone lysine methyltransferase 1 1
MIRT044086 MDC1 mediator of DNA damage checkpoint 1 1 1
MIRT044087 RPS2 ribosomal protein S2 1 1
MIRT044088 UCK2 uridine-cytidine kinase 2 1 1
MIRT044089 PRPF8 pre-mRNA processing factor 8 1 1
MIRT044090 GSPT1 G1 to S phase transition 1 1 1
MIRT044091 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT044092 USP22 ubiquitin specific peptidase 22 1 1
MIRT044093 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT044094 CNOT2 CCR4-NOT transcription complex subunit 2 1 1
MIRT044095 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT044096 WBP2 WW domain binding protein 2 1 1
MIRT044097 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT044098 GPC6 glypican 6 1 1
MIRT044099 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT044100 EIF3C eukaryotic translation initiation factor 3 subunit C 1 1
MIRT044101 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT044102 DOCK6 dedicator of cytokinesis 6 1 1
MIRT044103 ECD ecdysoneless cell cycle regulator 1 1
MIRT044104 EPHA4 EPH receptor A4 1 1
MIRT044105 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT044106 PSMD2 proteasome 26S subunit, non-ATPase 2 1 1
MIRT044107 RAE1 ribonucleic acid export 1 1 1
MIRT044108 RAVER1 ribonucleoprotein, PTB binding 1 1 1
MIRT044109 TP53BP1 tumor protein p53 binding protein 1 1 1
MIRT044110 COPS7A COP9 signalosome subunit 7A 1 1
MIRT044111 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT044112 CDK2 cyclin dependent kinase 2 1 1
MIRT044113 NOP2 NOP2 nucleolar protein 1 1
MIRT112226 MDM4 MDM4, p53 regulator 2 2
MIRT127737 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT226898 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT235959 BACH1 BTB domain and CNC homolog 1 2 2
MIRT241215 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT243416 ZMAT3 zinc finger matrin-type 3 2 2
MIRT294566 ZNF460 zinc finger protein 460 2 4
MIRT321041 RAC1 Rac family small GTPase 1 2 4
MIRT437351 STAT6 signal transducer and activator of transcription 6 3 1
MIRT438339 SND1 staphylococcal nuclease and tudor domain containing 1 3 1
MIRT444521 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT447699 ERP44 endoplasmic reticulum protein 44 2 2
MIRT464962 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT468193 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT473767 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT482630 AAR2 AAR2 splicing factor homolog 2 2
MIRT484150 CENPN centromere protein N 2 2
MIRT490457 PROSER2 proline and serine rich 2 2 2
MIRT493066 MTCH1 mitochondrial carrier 1 2 2
MIRT493579 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT506495 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT514833 ZNF154 zinc finger protein 154 2 6
MIRT519028 KYNU kynureninase 2 6
MIRT521750 PPIL1 peptidylprolyl isomerase like 1 2 4
MIRT522899 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 4
MIRT527368 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT530684 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT531397 TMEM18 transmembrane protein 18 2 2
MIRT533163 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT534579 RPL28 ribosomal protein L28 2 2
MIRT545955 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT553282 TSR1 TSR1, ribosome maturation factor 2 2
MIRT553531 TMEM185B transmembrane protein 185B 2 4
MIRT555601 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT556005 NAPG NSF attachment protein gamma 2 2
MIRT556738 KLHL15 kelch like family member 15 2 2
MIRT556971 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT558904 CCDC58 coiled-coil domain containing 58 2 2
MIRT559220 BLMH bleomycin hydrolase 2 2
MIRT559821 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT562671 AKT3 AKT serine/threonine kinase 3 2 2
MIRT564793 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT564827 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT570505 TFIP11 tuftelin interacting protein 11 2 2
MIRT571381 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572562 AFF1 AF4/FMR2 family member 1 2 2
MIRT610398 AR androgen receptor 2 2
MIRT641614 DEFB118 defensin beta 118 2 2
MIRT642143 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT643846 EPGN epithelial mitogen 2 4
MIRT651751 VEGFB vascular endothelial growth factor B 2 2
MIRT657353 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT662436 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT700990 PDE3A phosphodiesterase 3A 2 2
MIRT707393 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT712064 XRCC5 X-ray repair cross complementing 5 2 2
MIRT721145 PLCL1 phospholipase C like 1 (inactive) 2 2
MIRT724466 SMAD2 SMAD family member 2 2 2
MIRT731374 CXCR6 C-X-C motif chemokine receptor 6 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-361 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-361 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-361 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-361 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-361 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-361 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
miR-361-5p Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-mir-361 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-361 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-361-5p (5r,6s)-5-phenyl-3,4-diazatricyclo[8.4.0.02,6]tetradeca-1(14),2,10,12-tetraene-4-carbothioamide 5467466 NSC652809 sensitive
hsa-miR-361-5p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-361-5p [(4e,6z,8r,9r,10e,12r,13r,14r,16r)-9-carbamoyloxy-8,14-dimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-19-(prop-2-enylamino)-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-13-yl] 5-aminopentanoate 5469153 NSC683666 sensitive
hsa-miR-361-5p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-361-5p 2-(1-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468781 NSC676184 sensitive
hsa-miR-361-5p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-361-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-361-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-361-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-361-5p 4-[3-(3,4-dihydro-1h-isoquinolin-2-yl)prop-1-en-2-yl]-n-pyrazin-2-ylbenzamide 24205286 NSC734949 sensitive
hsa-miR-361-5p 6-(acetylamino)-2-(3-fluorophenyl)quinolin-4(1h)-one 376375 NSC657277 sensitive
hsa-miR-361-5p 6-aryl alkyl fluoro quinolone derivative 135465400 NSC731099 resistant
hsa-miR-361-5p 7-bromo-2,4,7-triphenyl-6H-benzo[a]quinolizin-5-ium;bromide 386208 NSC677924 sensitive
hsa-miR-361-5p 7-epi-10-deacetylbaccatin iii 6712096 NSC656178 sensitive
hsa-miR-361-5p Acetonitrile;iridium;tetramethyl buta-1,3-diene-1,2,3,4-tetracarboxylate;triphenylphosphane;triphenylphosphanium;tetrafluoroborate 498529 NSC630734 sensitive
hsa-miR-361-5p Antineoplastic-642316 369949 NSC642316 sensitive
hsa-miR-361-5p Auranofin 6333901 NSC321521 sensitive
hsa-miR-361-5p Ayanin 5280682 NSC691652 resistant
hsa-miR-361-5p Bis(trifluoromethylsulfonyl)azanide;trihexyl(tetradecyl)phosphanium 11181836 NSC747251 sensitive
hsa-miR-361-5p Capri blue 102162 NSC7821 sensitive
hsa-miR-361-5p Cbdive_010867 269887 NSC111580 resistant
hsa-miR-361-5p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-361-5p Ethyl 3-(9-chloro-4-hydroxy-2,5,11-trimethyl-6h-pyrido[3,2-b]carbazol-3-yl)propanoate 386719 NSC679261 sensitive
hsa-miR-361-5p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 sensitive
hsa-miR-361-5p Jasplakinolide epoxide c 372550 NSC647763 sensitive
hsa-miR-361-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 resistant
hsa-miR-361-5p N'-butyl-4-[2-[2-[4-(N'-butylcarbamimidoyl)phenoxy]ethylsulfanyl]ethoxy]benzenecarboximidamide;hydrochloride 54613223 NSC750501 sensitive
hsa-miR-361-5p N-(1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl)benzamide 369939 NSC642306 sensitive
hsa-miR-361-5p Rogiolol 402519 NSC716545 sensitive
hsa-miR-361-5p Salinomycin, sodium 60148415 NSC758465 sensitive
hsa-miR-361-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7, MDA-MB-231)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-361-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-miR-361-5p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-361-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-361-5p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-361-5p Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-361-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-361-5p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive Low Gastric Cancer cell line (SGC-7901, MKN28)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-361-5p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (MGC-803)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-361-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-361-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-361-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-361-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-361-5p Testosterone+Tamoxifen sensitive cell line (MCF-7)
hsa-miR-361-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-361-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-361-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-361-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-361-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-361-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MDAH-2774)

Error report submission