miRTarBase - #MIRT020087


—
pre-miRNA Information
pre-miRNA hsa-mir-361   
Genomic Coordinates chrX: 85903636 - 85903707
Synonyms MIRN361, hsa-mir-361, MIR361
Description Homo sapiens miR-361 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-361-5p
Sequence 6| UUAUCAGAAUCUCCAGGGGUAC |27
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 9 X - 85903694 29233923 MiREDiBase
A-to-I 15 X - 85903688 29976955, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1201941835 9 dbSNP
rs1341659793 19 dbSNP
rs1430235395 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FGFR1OP2   
Synonyms HSPC123-like, WIT3.0
Description FGFR1 oncogene partner 2
Transcript NM_001171887   
Other Transcripts NM_001171888 , NM_015633   
Expression
Putative miRNA Targets on FGFR1OP2
3'UTR of FGFR1OP2
(miRNA target sites are highlighted)		 
>FGFR1OP2|NM_001171887|3'UTR
   1 AGAGTTTCTGAGTCTGTGAGCTTCTTACATGGCTCCAAATGGTCAAATAAGTGAATGAATGAATGGACAGAAAATTCAAT
  81 CCTTTATTTTTTTCTCTGTAAATATGTACAGTGCACGGGCTATGAGATAGCAACAAAAAATGCATAGTTAATGGTCATAG
 161 ACTTTATTCCAAAACATAATTGGAAAATAGAAACTGAGCCATTGCCAAATGGTAAAGAAATGAAAAGTTTTCACAGTGAC
 241 TACTGAATATACCAAGAGCTTTTGGCAGTACTGCTGGCTTTCTGGGTGATTAATTAGGTAAACTTGAATATTCCCAGTAA
 321 ATGTTTGAGAATGCATAAAATTATACCAATTTAAAAATATAAATTTTTGCCACTGTTTTGTGAACGGAGGATTTGTACGC
 401 TAAATTTCATCCTTATTTGGCGTCAAAGTTGATGCAAAGTTTATGTACCATGAGACTTCTAGTGATTGCCTACTTTCACA
 481 TTTATTTAAATTTTTGTGAAAGAAAATACAGTTTTAAAGGCTATAGGAATGTGTTATATGTACCTTAAACAGATAATTTA
 561 ATTTTAGCAATTTATCATAACTGATACTTAGCTAACAATTGTCCATAACTTGTTTAAGTGTAAGAAATACCATTTCAGGA
 641 ATGAAAAAGAAGGAATACTACTTTCTAAGAAAGAAGATCTTATAATAGACATATTTAGTAGGTTAAACTACTCCTTTGAA
 721 AGAATAAGTTTTGGTTCAAAGTCAATAATGAAGACGAGATTTGTTTTTCTCTTCTCTGGCTGATTTTTAAGGATATTATG
 801 TAGTTCATTTAGTTAACAGAATTGAAATGTTTGATATGGCAAGATAGGTATGGTAATTTCAAAGTGAATTGGGAATTCCT
 881 CTGGCTCATAGAACCCTTTTTTTTTTCCTTTAAGTATTCTTGAGATACAAAAAAAAAAAGTAAATACAATTTCAAAAAAA
 961 AAGTTCCGGATCTGTTTTTAAGCTCCATCTGGTCCTCATAACCTGCAAGATTTTTCTTAAAACCTTTCAGCTGAAAGTGG
1041 GGGTAAAGGTGGAGTAATCTGTGGATTTGTTTCTGTTGTCTTTTAAAATGTCAAATATATAATATGTAATTTTTTTAAAA
1121 ACCACCAGATACAGAAATGTGCTTTAACATCAGTTGAAACCTAAATTTTCTTATGTTGTGGTGATTGTATTAAAAAGGGA
1201 TAAAAGAAGAGTGTCAAACATGGTTAAATATATTGTACTCATTTATGTTGAATACGTATTAAAATTAAGACAAATGGAAA
1281 ATTATACTTTGAGTATATAATTTGTTAAATATTACTTTATATGGTAATTTTATGTATAATTTCATATATTGGTAAAATTC
1361 AAAACTACACTTGAGAATTTTTTTATCTTAAGTTTGGGGTGAATGGGGTGGATGAGACTGATTGAATAGAAAAGGGCTAA
1441 TGGCCCAAACATTATATAGATTTCTTTTTTTCAGTCAGAGGCCTTATTTGATATTTTATAAATAAATGACAGTTTTTATT
1521 TTTAAACTTTTTATTGTTTTTGGGAAAGTATTCCTTAATTTAATGACACATTCATTCAGATACTTCTTATCCCTGCTAAT
1601 AAAGGAAATCTATTTCAAGCTACACCATTGAGATTAAGTCTGAGGCAGTTCATTGAGGCAGCTCTACTATAAAAGCTTAC
1681 TTGATAAATAATTATTTTTGTAAACAAGTTGGGTTAACTTATTCTTCGTCTTTTTGCTTGGATATGAATTTAAGGTCTTC
1761 ATGTTTAAAGACATTTACTTTGTTATTTAGTGACACATTTCCATCCTATTTTTTTTTTTTTTTTGGTTGTTGTTAAACAG
1841 AACCTTAAGTTTATGTTTGAGGTATGTACTGCATAGGAACCTATTTTATTATTAAAGATGAATGATTAAAATTGG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cauggggACCUCUA-AGACUAUu 5'
                 | || || |:||||| 
Target 5' aacagaaTTGAAATGTTTGATAt 3'
 815 - 837 135.00 -5.60
2 
miRNA  3' cauggggacCUCU---A-AGACUAUu 5'
                   |||:   | |:||||| 
Target 5' tttcagtcaGAGGCCTTATTTGATAt 3'
 1469 - 1494 125.00 -5.60
3 
miRNA  3' caUG-GGGACCUCUA----AGACUauu 5'
            || || | |||||    |||||   
Target 5' ctACACCATTGAGATTAAGTCTGAggc 3'
 1620 - 1646 122.00 -10.92
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN25394306 9 COSMIC
COSN31586986 9 COSMIC
COSN31494700 54 COSMIC
COSN30516014 63 COSMIC
COSN30500779 71 COSMIC
COSN30161507 80 COSMIC
COSN30493178 88 COSMIC
COSN30167781 97 COSMIC
COSN31572839 103 COSMIC
COSN1568723 109 COSMIC
COSN31567307 112 COSMIC
COSN30105639 125 COSMIC
COSN22722123 344 COSMIC
COSN23051793 436 COSMIC
COSN5796168 570 COSMIC
COSN31530467 680 COSMIC
COSN31568574 807 COSMIC
COSN9083092 1270 COSMIC
COSN21062285 1512 COSMIC
COSN7324933 1814 COSMIC
COSN17182164 1832 COSMIC
COSN5939923 1854 COSMIC
COSN1568724 1908 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1211606073 1 dbSNP
rs1256920104 3 dbSNP
rs780809544 7 dbSNP
rs774079124 10 dbSNP
rs1382290261 15 dbSNP
rs1421345119 15 dbSNP
rs1182772528 22 dbSNP
rs551005221 24 dbSNP
rs1248808974 25 dbSNP
rs188286139 25 dbSNP
rs192613947 28 dbSNP
rs772643690 29 dbSNP
rs199679959 30 dbSNP
rs765970740 32 dbSNP
rs753470029 33 dbSNP
rs372501738 34 dbSNP
rs1413468620 38 dbSNP
rs765619499 39 dbSNP
rs1363296776 40 dbSNP
rs1280228409 45 dbSNP
rs753014631 47 dbSNP
rs748009554 52 dbSNP
rs1279681594 61 dbSNP
rs1237823514 67 dbSNP
rs558212537 80 dbSNP
rs927647725 90 dbSNP
rs1415151101 94 dbSNP
rs939009521 95 dbSNP
rs1291679369 103 dbSNP
rs1352485108 110 dbSNP
rs1052818790 111 dbSNP
rs892373548 117 dbSNP
rs770944768 118 dbSNP
rs1159249403 121 dbSNP
rs1363396914 123 dbSNP
rs1362295506 124 dbSNP
rs1202156663 128 dbSNP
rs1011203438 130 dbSNP
rs1257313677 130 dbSNP
rs1186403496 135 dbSNP
rs148485812 136 dbSNP
rs1209929833 137 dbSNP
rs1347992567 141 dbSNP
rs534810015 147 dbSNP
rs1208375547 154 dbSNP
rs1253538731 173 dbSNP
rs1354559682 176 dbSNP
rs1006992139 177 dbSNP
rs1401723360 180 dbSNP
rs1326957293 181 dbSNP
rs1318998370 188 dbSNP
rs1018357681 189 dbSNP
rs377157814 195 dbSNP
rs965393542 207 dbSNP
rs998195926 209 dbSNP
rs1476640205 223 dbSNP
rs578239874 223 dbSNP
rs1243184307 224 dbSNP
rs1193173455 240 dbSNP
rs544033956 249 dbSNP
rs1444744486 250 dbSNP
rs185347570 253 dbSNP
rs1026351073 260 dbSNP
rs376694629 268 dbSNP
rs1213875259 289 dbSNP
rs369157843 293 dbSNP
rs1361598641 302 dbSNP
rs951670611 349 dbSNP
rs1270964983 350 dbSNP
rs1478710094 359 dbSNP
rs189931599 361 dbSNP
rs1339901904 364 dbSNP
rs1269516934 372 dbSNP
rs1403454580 374 dbSNP
rs1428600833 377 dbSNP
rs1328037602 386 dbSNP
rs541679796 386 dbSNP
rs1270515222 387 dbSNP
rs1311392209 388 dbSNP
rs1163120014 389 dbSNP
rs969500668 399 dbSNP
rs563847526 400 dbSNP
rs1167817667 404 dbSNP
rs867219631 410 dbSNP
rs1474725446 413 dbSNP
rs1396320393 416 dbSNP
rs1193716295 417 dbSNP
rs1467705919 422 dbSNP
rs182011897 423 dbSNP
rs1206264539 424 dbSNP
rs1438155002 436 dbSNP
rs1272087428 438 dbSNP
rs1334117873 445 dbSNP
rs1235508905 451 dbSNP
rs1305639024 468 dbSNP
rs1235094466 470 dbSNP
rs1275372405 490 dbSNP
rs1324093780 493 dbSNP
rs1444692777 497 dbSNP
rs1344144358 508 dbSNP
rs1355429202 508 dbSNP
rs1408644176 519 dbSNP
rs574068216 521 dbSNP
rs1453265812 525 dbSNP
rs913517455 538 dbSNP
rs184900288 539 dbSNP
rs1470323347 544 dbSNP
rs946672460 554 dbSNP
rs545606639 557 dbSNP
rs1044006502 568 dbSNP
rs888980433 578 dbSNP
rs1247958724 589 dbSNP
rs1210125321 590 dbSNP
rs1452842865 592 dbSNP
rs1347209866 593 dbSNP
rs943164433 599 dbSNP
rs564192959 606 dbSNP
rs1378745738 610 dbSNP
rs1039850745 623 dbSNP
rs1374331952 625 dbSNP
rs901250082 629 dbSNP
rs1172283657 658 dbSNP
rs745852693 661 dbSNP
rs1313988862 677 dbSNP
rs1434694619 678 dbSNP
rs998645042 682 dbSNP
rs188437097 683 dbSNP
rs1380389158 684 dbSNP
rs1406813866 690 dbSNP
rs1175183855 691 dbSNP
rs1025647008 711 dbSNP
rs1258018116 712 dbSNP
rs1187072710 716 dbSNP
rs887086547 719 dbSNP
rs1254257556 742 dbSNP
rs1005817147 747 dbSNP
rs540832805 751 dbSNP
rs1297887442 753 dbSNP
rs1283823088 756 dbSNP
rs1017130021 757 dbSNP
rs562223975 763 dbSNP
rs1294314486 767 dbSNP
rs1414667124 769 dbSNP
rs969555291 792 dbSNP
rs1290059402 800 dbSNP
rs980895749 810 dbSNP
rs543144677 812 dbSNP
rs139362292 815 dbSNP
rs1156463629 822 dbSNP
rs180910432 823 dbSNP
rs748569937 826 dbSNP
rs111796365 832 dbSNP
rs1438671069 833 dbSNP
rs1474152057 835 dbSNP
rs1263744214 838 dbSNP
rs1299702908 851 dbSNP
rs770391690 880 dbSNP
rs1342676792 888 dbSNP
rs1227384040 889 dbSNP
rs1207004835 890 dbSNP
rs1249279654 894 dbSNP
rs1337265908 895 dbSNP
rs1274130787 896 dbSNP
rs1320357780 897 dbSNP
rs913580181 897 dbSNP
rs1357970503 907 dbSNP
rs1383314220 907 dbSNP
rs1209947371 908 dbSNP
rs1266105278 909 dbSNP
rs1442566539 911 dbSNP
rs1466734426 912 dbSNP
rs1192369432 913 dbSNP
rs1250441822 914 dbSNP
rs1450485510 915 dbSNP
rs1170116152 917 dbSNP
rs1371576737 920 dbSNP
rs1459600903 923 dbSNP
rs1164015302 925 dbSNP
rs551269157 926 dbSNP
rs1438782498 927 dbSNP
rs1171033281 929 dbSNP
rs1427873840 929 dbSNP
rs778273243 929 dbSNP
rs1322541732 936 dbSNP
rs1186764541 938 dbSNP
rs1469946810 943 dbSNP
rs900743 948 dbSNP
rs112380753 950 dbSNP
rs1253467605 951 dbSNP
rs1293130240 952 dbSNP
rs1235831456 954 dbSNP
rs1294692867 954 dbSNP
rs1307427419 954 dbSNP
rs1342012741 960 dbSNP
rs943218191 963 dbSNP
rs1245133167 967 dbSNP
rs551625726 968 dbSNP
rs1398302007 969 dbSNP
rs566950840 975 dbSNP
rs1461363515 978 dbSNP
rs375265775 988 dbSNP
rs1352703756 993 dbSNP
rs149444997 994 dbSNP
rs1455641598 996 dbSNP
rs1270591850 999 dbSNP
rs1395816839 1009 dbSNP
rs1262599738 1010 dbSNP
rs1431690469 1016 dbSNP
rs1465705709 1017 dbSNP
rs1047563436 1019 dbSNP
rs1260131853 1034 dbSNP
rs142600914 1043 dbSNP
rs1005950133 1048 dbSNP
rs1188576613 1050 dbSNP
rs1017172404 1055 dbSNP
rs905458172 1061 dbSNP
rs1230565311 1069 dbSNP
rs1459942579 1070 dbSNP
rs1307374248 1087 dbSNP
rs763056784 1099 dbSNP
rs139875644 1105 dbSNP
rs1348475859 1110 dbSNP
rs185755898 1117 dbSNP
rs1376100102 1118 dbSNP
rs1453021082 1122 dbSNP
rs961130765 1125 dbSNP
rs987936892 1131 dbSNP
rs1182882621 1132 dbSNP
rs1418830156 1134 dbSNP
rs1250125817 1147 dbSNP
rs1190637741 1148 dbSNP
rs1287026424 1151 dbSNP
rs769554965 1154 dbSNP
rs1198246899 1155 dbSNP
rs1352294064 1164 dbSNP
rs967778662 1166 dbSNP
rs774468087 1168 dbSNP
rs1292300344 1175 dbSNP
rs1353117753 1176 dbSNP
rs910185843 1177 dbSNP
rs1354755367 1178 dbSNP
rs116041150 1179 dbSNP
rs975974296 1184 dbSNP
rs191496173 1188 dbSNP
rs1288383519 1200 dbSNP
rs923114630 1202 dbSNP
rs929119744 1202 dbSNP
rs1456936116 1204 dbSNP
rs1215763406 1207 dbSNP
rs1047169158 1208 dbSNP
rs1167559428 1230 dbSNP
rs369681654 1236 dbSNP
rs941418495 1241 dbSNP
rs373181303 1246 dbSNP
rs181144824 1256 dbSNP
rs762044268 1257 dbSNP
rs1474328196 1261 dbSNP
rs551350451 1267 dbSNP
rs896675127 1271 dbSNP
rs12818194 1273 dbSNP
rs1274751698 1280 dbSNP
rs1233659626 1291 dbSNP
rs539408717 1292 dbSNP
rs1418565614 1298 dbSNP
rs1156921668 1302 dbSNP
rs1229584552 1302 dbSNP
rs12819730 1307 dbSNP
rs1360760327 1326 dbSNP
rs1010147686 1336 dbSNP
rs1386748421 1346 dbSNP
rs1020736054 1355 dbSNP
rs1462292880 1368 dbSNP
rs1413580052 1369 dbSNP
rs1161958507 1371 dbSNP
rs968211017 1375 dbSNP
rs1411318642 1377 dbSNP
rs1187402047 1378 dbSNP
rs12824645 1401 dbSNP
rs12823559 1402 dbSNP
rs1254486633 1404 dbSNP
rs1213972576 1414 dbSNP
rs1467850327 1417 dbSNP
rs1287495618 1419 dbSNP
rs1308238321 1419 dbSNP
rs1372051313 1423 dbSNP
rs1339999170 1428 dbSNP
rs377472226 1440 dbSNP
rs564843263 1443 dbSNP
rs1221567205 1451 dbSNP
rs1227748738 1456 dbSNP
rs1363203241 1460 dbSNP
rs1305865242 1463 dbSNP
rs1349616960 1465 dbSNP
rs1441985764 1465 dbSNP
rs866491653 1476 dbSNP
rs964346991 1482 dbSNP
rs1397816668 1492 dbSNP
rs1235521450 1495 dbSNP
rs1447096000 1500 dbSNP
rs1280123860 1503 dbSNP
rs555262231 1509 dbSNP
rs773881017 1510 dbSNP
rs923164988 1513 dbSNP
rs1252810252 1529 dbSNP
rs1193823120 1533 dbSNP
rs1480351924 1542 dbSNP
rs1244698249 1545 dbSNP
rs187102775 1553 dbSNP
rs1206379204 1555 dbSNP
rs1438242333 1564 dbSNP
rs1175499637 1566 dbSNP
rs1202989548 1568 dbSNP
rs1340115805 1569 dbSNP
rs1282594612 1570 dbSNP
rs950620448 1571 dbSNP
rs1433661690 1575 dbSNP
rs1273351854 1578 dbSNP
rs572904892 1580 dbSNP
rs983696388 1584 dbSNP
rs909004598 1594 dbSNP
rs540297315 1600 dbSNP
rs1431383587 1609 dbSNP
rs1428406821 1613 dbSNP
rs1376700944 1619 dbSNP
rs1168908576 1623 dbSNP
rs1413496613 1625 dbSNP
rs1422606249 1627 dbSNP
rs1353490177 1629 dbSNP
rs562290196 1630 dbSNP
rs1038387253 1633 dbSNP
rs1470373763 1639 dbSNP
rs1250868878 1654 dbSNP
rs1179867635 1667 dbSNP
rs1486631933 1679 dbSNP
rs1259629629 1688 dbSNP
rs926653837 1693 dbSNP
rs1311744556 1700 dbSNP
rs937994308 1703 dbSNP
rs1225733644 1708 dbSNP
rs1351786830 1713 dbSNP
rs114344031 1719 dbSNP
rs1408465173 1722 dbSNP
rs896723343 1724 dbSNP
rs1009788022 1725 dbSNP
rs1042953265 1727 dbSNP
rs1356973617 1728 dbSNP
rs903998402 1729 dbSNP
rs1246770961 1743 dbSNP
rs1442350447 1745 dbSNP
rs1303299358 1756 dbSNP
rs1410906462 1778 dbSNP
rs868717738 1795 dbSNP
rs1156696012 1804 dbSNP
rs1446863134 1807 dbSNP
rs1482953534 1807 dbSNP
rs1235827424 1808 dbSNP
rs1000631881 1809 dbSNP
rs1228305205 1809 dbSNP
rs1290153841 1809 dbSNP
rs1376287426 1809 dbSNP
rs1387432459 1809 dbSNP
rs1478835417 1809 dbSNP
rs370100358 1809 dbSNP
rs199530858 1810 dbSNP
rs79079534 1810 dbSNP
rs1418366431 1811 dbSNP
rs74835021 1811 dbSNP
rs1411004784 1812 dbSNP
rs1422017338 1812 dbSNP
rs964398935 1818 dbSNP
rs1188373009 1822 dbSNP
rs1450232127 1822 dbSNP
rs80002985 1825 dbSNP
rs1161284185 1826 dbSNP
rs1207105067 1826 dbSNP
rs61923403 1827 dbSNP
rs910926360 1830 dbSNP
rs943616059 1833 dbSNP
rs1202561164 1836 dbSNP
rs116043123 1837 dbSNP
rs1320470281 1841 dbSNP
rs1297029977 1842 dbSNP
rs1488834477 1850 dbSNP
rs1192993130 1853 dbSNP
rs1251055379 1854 dbSNP
rs190496025 1865 dbSNP
rs533220620 1867 dbSNP
rs1294932094 1869 dbSNP
rs1442670698 1873 dbSNP
rs551752434 1884 dbSNP
rs950693085 1885 dbSNP
rs1451100116 1889 dbSNP
rs1168924529 1908 dbSNP
rs1292760334 1912 dbSNP
rs1418374910 1915 dbSNP
rs767047308 1916 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.815 6.2e-7 0.544 3.0e-3 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.654 8.8e-4 0.651 9.4e-4 20 Click to see details
GSE21032 Prostate cancer -0.306 2.5e-3 -0.310 2.2e-3 83 Click to see details
GSE27834 Pluripotent stem cells -0.647 3.4e-3 -0.691 1.5e-3 16 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.712 1.6e-2 0.633 3.4e-2 9 Click to see details
GSE21849 B cell lymphoma 0.275 7.4e-2 0.356 2.9e-2 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.267 9.8e-2 0.263 1.0e-1 25 Click to see details
GSE21687 Ependynoma primary tumors -0.163 9.9e-2 -0.072 2.9e-1 64 Click to see details
GSE28260 Renal cortex and medulla -0.37 1.1e-1 -0.473 5.1e-2 13 Click to see details
GSE42095 Differentiated embryonic stem cells 0.231 1.4e-1 0.331 6.1e-2 23 Click to see details
GSE26953 Aortic valvular endothelial cells 0.171 2.1e-1 0.198 1.8e-1 24 Click to see details
GSE19783 ER- ER- breast cancer -0.081 2.4e-1 -0.024 4.2e-1 79 Click to see details
GSE14794 Lymphoblastoid cells 0.058 2.9e-1 0.057 3.0e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.113 3.0e-1 0.097 3.2e-1 25 Click to see details
GSE19536 Breast cancer -0.022 4.1e-1 0.011 4.6e-1 100 Click to see details
GSE19350 CNS germ cell tumors 0.063 4.2e-1 0.126 3.5e-1 12 Click to see details
GSE32688 Pancreatic cancer -0.02 4.6e-1 0.004 4.9e-1 32 Click to see details
GSE17306 Multiple myeloma -0.015 4.6e-1 -0.100 2.5e-1 49 Click to see details
GSE38226 Liver fibrosis 0.01 4.8e-1 -0.084 3.6e-1 21 Click to see details
GSE19783 ER+ ER+ breast cancer 0.01 4.8e-1 0.020 4.7e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC -0.317 0 -0.333 0 68 Click to see details
PRAD -0.305 0.02 -0.222 0.06 50 Click to see details
PCPG -0.993 0.04 -1.000 0.5 3 Click to see details
STAD -0.28 0.06 -0.326 0.03 32 Click to see details
KICH -0.257 0.11 -0.240 0.12 25 Click to see details
UCEC -0.295 0.11 -0.282 0.12 19 Click to see details
CHOL -0.411 0.14 -0.167 0.33 9 Click to see details
LUSC 0.139 0.2 0.189 0.13 38 Click to see details
COAD 0.342 0.2 0.167 0.35 8 Click to see details
LUAD 0.263 0.2 0.056 0.43 12 Click to see details
PAAD 0.561 0.22 0.800 0.1 4 Click to see details
CESC -0.768 0.22 -0.500 0.33 3 Click to see details
BRCA 0.074 0.25 0.073 0.25 84 Click to see details
THCA 0.083 0.27 0.075 0.29 59 Click to see details
ESCA 0.149 0.33 0.418 0.1 11 Click to see details
LIHC -0.052 0.36 -0.066 0.33 49 Click to see details
BLCA 0.042 0.43 0.137 0.29 18 Click to see details
HNSC 0.013 0.47 0.091 0.28 42 Click to see details
KIRP 0.001 0.5 -0.025 0.45 32 Click to see details
KIRP 0.001 0.5 -0.025 0.45 32 Click to see details
KIRP 0.001 0.5 -0.025 0.45 32 Click to see details
152 hsa-miR-361-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004447 VEGFA vascular endothelial growth factor A 4 3
MIRT020074 U2SURP U2 snRNP associated SURP domain containing 1 1
MIRT020075 RPUSD4 RNA pseudouridylate synthase domain containing 4 1 1
MIRT020076 DEPDC1B DEP domain containing 1B 1 1
MIRT020077 CENPQ centromere protein Q 1 1
MIRT020078 EAPP E2F associated phosphoprotein 1 1
MIRT020079 CD46 CD46 molecule 1 1
MIRT020080 EDC3 enhancer of mRNA decapping 3 1 1
MIRT020081 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT020082 ZNF92 zinc finger protein 92 1 1
MIRT020083 ZNF776 zinc finger protein 776 1 1
MIRT020084 ARF4 ADP ribosylation factor 4 1 1
MIRT020085 WDR36 WD repeat domain 36 1 1
MIRT020086 ZMYND11 zinc finger MYND-type containing 11 1 1
MIRT020087 FGFR1OP2 FGFR1 oncogene partner 2 1 1
MIRT020088 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT020089 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT020090 CEBPG CCAAT/enhancer binding protein gamma 1 1
MIRT020091 KLHL28 kelch like family member 28 1 1
MIRT020092 G3BP2 G3BP stress granule assembly factor 2 1 1
MIRT020093 SRSF3 serine and arginine rich splicing factor 3 2 3
MIRT020094 RNF141 ring finger protein 141 1 1
MIRT020095 YOD1 YOD1 deubiquitinase 1 1
MIRT020096 DUSP3 dual specificity phosphatase 3 2 3
MIRT020097 NCEH1 neutral cholesterol ester hydrolase 1 1 1
MIRT020098 GTF2E1 general transcription factor IIE subunit 1 1 1
MIRT020099 PHACTR4 phosphatase and actin regulator 4 1 1
MIRT020100 ZC3H12C zinc finger CCCH-type containing 12C 1 1
MIRT020101 ARCN1 archain 1 1 1
MIRT020102 RNF4 ring finger protein 4 1 1
MIRT020103 CPOX coproporphyrinogen oxidase 1 1
MIRT020104 CDC123 cell division cycle 123 1 1
MIRT044053 SLC30A5 solute carrier family 30 member 5 1 1
MIRT044054 ATP6V1A ATPase H+ transporting V1 subunit A 1 1
MIRT044055 TMEM62 transmembrane protein 62 1 1
MIRT044056 ZNF554 zinc finger protein 554 1 1
MIRT044057 MAGEF1 MAGE family member F1 1 1
MIRT044058 GRK6 G protein-coupled receptor kinase 6 1 1
MIRT044059 DDX23 DEAD-box helicase 23 1 1
MIRT044060 BSG basigin (Ok blood group) 1 1
MIRT044061 VCPIP1 valosin containing protein interacting protein 1 1 1
MIRT044062 VCP valosin containing protein 1 1
MIRT044063 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT044064 SLC25A5 solute carrier family 25 member 5 1 1
MIRT044065 ZNF207 zinc finger protein 207 1 1
MIRT044066 EGFL7 EGF like domain multiple 7 1 1
MIRT044067 SETD1A SET domain containing 1A 1 1
MIRT044068 KIAA1549L KIAA1549 like 1 1
MIRT044069 COX1 cytochrome c oxidase subunit I 1 1
MIRT044070 SON SON DNA binding protein 1 1
MIRT044071 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT044072 PPA1 pyrophosphatase (inorganic) 1 1 1
MIRT044073 DCTN1 dynactin subunit 1 1 1
MIRT044074 ERAL1 Era like 12S mitochondrial rRNA chaperone 1 1 1
MIRT044075 CYCS cytochrome c, somatic 1 1
MIRT044076 ACTG1 actin gamma 1 1 1
MIRT044077 RANBP17 RAN binding protein 17 1 1
MIRT044078 QTRTD1 queuine tRNA-ribosyltransferase accessory subunit 2 1 1
MIRT044079 NCOA6 nuclear receptor coactivator 6 1 1
MIRT044080 ACLY ATP citrate lyase 1 1
MIRT044081 LNPEP leucyl and cystinyl aminopeptidase 1 1
MIRT044082 C14orf80 tubulin epsilon and delta complex 1 1 1
MIRT044083 VBP1 VHL binding protein 1 1 1
MIRT044084 OGDH oxoglutarate dehydrogenase 1 1
MIRT044085 ASH1L ASH1 like histone lysine methyltransferase 1 1
MIRT044086 MDC1 mediator of DNA damage checkpoint 1 1 1
MIRT044087 RPS2 ribosomal protein S2 1 1
MIRT044088 UCK2 uridine-cytidine kinase 2 1 1
MIRT044089 PRPF8 pre-mRNA processing factor 8 1 1
MIRT044090 GSPT1 G1 to S phase transition 1 1 1
MIRT044091 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT044092 USP22 ubiquitin specific peptidase 22 1 1
MIRT044093 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT044094 CNOT2 CCR4-NOT transcription complex subunit 2 1 1
MIRT044095 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT044096 WBP2 WW domain binding protein 2 1 1
MIRT044097 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT044098 GPC6 glypican 6 1 1
MIRT044099 PRKCSH protein kinase C substrate 80K-H 1 1
MIRT044100 EIF3C eukaryotic translation initiation factor 3 subunit C 1 1
MIRT044101 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 1 1
MIRT044102 DOCK6 dedicator of cytokinesis 6 1 1
MIRT044103 ECD ecdysoneless cell cycle regulator 1 1
MIRT044104 EPHA4 EPH receptor A4 1 1
MIRT044105 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT044106 PSMD2 proteasome 26S subunit, non-ATPase 2 1 1
MIRT044107 RAE1 ribonucleic acid export 1 1 1
MIRT044108 RAVER1 ribonucleoprotein, PTB binding 1 1 1
MIRT044109 TP53BP1 tumor protein p53 binding protein 1 1 1
MIRT044110 COPS7A COP9 signalosome subunit 7A 1 1
MIRT044111 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT044112 CDK2 cyclin dependent kinase 2 1 1
MIRT044113 NOP2 NOP2 nucleolar protein 1 1
MIRT112226 MDM4 MDM4, p53 regulator 2 2
MIRT127737 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT226898 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT235959 BACH1 BTB domain and CNC homolog 1 2 2
MIRT241215 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT243416 ZMAT3 zinc finger matrin-type 3 2 2
MIRT294566 ZNF460 zinc finger protein 460 2 4
MIRT321041 RAC1 Rac family small GTPase 1 2 4
MIRT437351 STAT6 signal transducer and activator of transcription 6 3 1
MIRT438339 SND1 staphylococcal nuclease and tudor domain containing 1 3 1
MIRT444521 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT447699 ERP44 endoplasmic reticulum protein 44 2 2
MIRT464962 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT468193 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT473767 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT482630 AAR2 AAR2 splicing factor homolog 2 2
MIRT484150 CENPN centromere protein N 2 2
MIRT490457 PROSER2 proline and serine rich 2 2 2
MIRT493066 MTCH1 mitochondrial carrier 1 2 2
MIRT493579 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT506495 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT514833 ZNF154 zinc finger protein 154 2 6
MIRT519028 KYNU kynureninase 2 6
MIRT521750 PPIL1 peptidylprolyl isomerase like 1 2 4
MIRT522899 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 4
MIRT527368 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT530684 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT531397 TMEM18 transmembrane protein 18 2 2
MIRT533163 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT534579 RPL28 ribosomal protein L28 2 2
MIRT545955 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT553282 TSR1 TSR1, ribosome maturation factor 2 2
MIRT553531 TMEM185B transmembrane protein 185B 2 4
MIRT555601 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT556005 NAPG NSF attachment protein gamma 2 2
MIRT556738 KLHL15 kelch like family member 15 2 2
MIRT556971 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT558904 CCDC58 coiled-coil domain containing 58 2 2
MIRT559220 BLMH bleomycin hydrolase 2 2
MIRT559821 SLPI secretory leukocyte peptidase inhibitor 2 2
MIRT562671 AKT3 AKT serine/threonine kinase 3 2 2
MIRT564793 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT564827 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT570505 TFIP11 tuftelin interacting protein 11 2 2
MIRT571381 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572562 AFF1 AF4/FMR2 family member 1 2 2
MIRT610398 AR androgen receptor 2 2
MIRT641614 DEFB118 defensin beta 118 2 2
MIRT642143 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT643846 EPGN epithelial mitogen 2 4
MIRT651751 VEGFB vascular endothelial growth factor B 2 2
MIRT657353 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT662436 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT700990 PDE3A phosphodiesterase 3A 2 2
MIRT707393 DCAF4L1 DDB1 and CUL4 associated factor 4 like 1 2 2
MIRT712064 XRCC5 X-ray repair cross complementing 5 2 2
MIRT721145 PLCL1 phospholipase C like 1 (inactive) 2 2
MIRT724466 SMAD2 SMAD family member 2 2 2
MIRT731374 CXCR6 C-X-C motif chemokine receptor 6 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-361 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-361 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-361 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-361 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-361 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-361 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
miR-361-5p Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-361 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-mir-361 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-361 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-361-5p (5r,6s)-5-phenyl-3,4-diazatricyclo[8.4.0.02,6]tetradeca-1(14),2,10,12-tetraene-4-carbothioamide 5467466 NSC652809 sensitive
hsa-miR-361-5p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-361-5p [(4e,6z,8r,9r,10e,12r,13r,14r,16r)-9-carbamoyloxy-8,14-dimethoxy-4,10,12,16-tetramethyl-3,20,22-trioxo-19-(prop-2-enylamino)-2-azabicyclo[16.3.1]docosa-1(21),4,6,10,18-pentaen-13-yl] 5-aminopentanoate 5469153 NSC683666 sensitive
hsa-miR-361-5p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-361-5p 2-(1-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468781 NSC676184 sensitive
hsa-miR-361-5p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-361-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-361-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-361-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-361-5p 4-[3-(3,4-dihydro-1h-isoquinolin-2-yl)prop-1-en-2-yl]-n-pyrazin-2-ylbenzamide 24205286 NSC734949 sensitive
hsa-miR-361-5p 6-(acetylamino)-2-(3-fluorophenyl)quinolin-4(1h)-one 376375 NSC657277 sensitive
hsa-miR-361-5p 6-aryl alkyl fluoro quinolone derivative 135465400 NSC731099 resistant
hsa-miR-361-5p 7-bromo-2,4,7-triphenyl-6H-benzo[a]quinolizin-5-ium;bromide 386208 NSC677924 sensitive
hsa-miR-361-5p 7-epi-10-deacetylbaccatin iii 6712096 NSC656178 sensitive
hsa-miR-361-5p Acetonitrile;iridium;tetramethyl buta-1,3-diene-1,2,3,4-tetracarboxylate;triphenylphosphane;triphenylphosphanium;tetrafluoroborate 498529 NSC630734 sensitive
hsa-miR-361-5p Antineoplastic-642316 369949 NSC642316 sensitive
hsa-miR-361-5p Auranofin 6333901 NSC321521 sensitive
hsa-miR-361-5p Ayanin 5280682 NSC691652 resistant
hsa-miR-361-5p Bis(trifluoromethylsulfonyl)azanide;trihexyl(tetradecyl)phosphanium 11181836 NSC747251 sensitive
hsa-miR-361-5p Capri blue 102162 NSC7821 sensitive
hsa-miR-361-5p Cbdive_010867 269887 NSC111580 resistant
hsa-miR-361-5p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-361-5p Ethyl 3-(9-chloro-4-hydroxy-2,5,11-trimethyl-6h-pyrido[3,2-b]carbazol-3-yl)propanoate 386719 NSC679261 sensitive
hsa-miR-361-5p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 sensitive
hsa-miR-361-5p Jasplakinolide epoxide c 372550 NSC647763 sensitive
hsa-miR-361-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 resistant
hsa-miR-361-5p N'-butyl-4-[2-[2-[4-(N'-butylcarbamimidoyl)phenoxy]ethylsulfanyl]ethoxy]benzenecarboximidamide;hydrochloride 54613223 NSC750501 sensitive
hsa-miR-361-5p N-(1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl)benzamide 369939 NSC642306 sensitive
hsa-miR-361-5p Rogiolol 402519 NSC716545 sensitive
hsa-miR-361-5p Salinomycin, sodium 60148415 NSC758465 sensitive
hsa-miR-361-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7, MDA-MB-231)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-361-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-miR-361-5p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-361-5p Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-361-5p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-361-5p Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-361-5p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-361-5p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-361-5p Docetaxel 148124 NSC628503 approved sensitive Low Gastric Cancer cell line (SGC-7901, MKN28)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3-R)
hsa-miR-361-5p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (MGC-803)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-361-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-361-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-361-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-361-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-361-5p Testosterone+Tamoxifen sensitive cell line (MCF-7)
hsa-miR-361-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-361-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-361-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-361-5p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-361-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-361-5p Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-miR-361-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-361-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-361-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-361-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)
hsa-miR-361-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MDAH-2774)

Error report submission