miRTarBase - #MIRT021733


—
pre-miRNA Information
pre-miRNA hsa-mir-132   
Genomic Coordinates chr17: 2049908 - 2050008
Description Homo sapiens miR-132 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-132-3p
Sequence 59| UAACAGUCUACAGCCAUGGUCG |80
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1211938237 4 dbSNP
rs1173831908 7 dbSNP
rs751170675 10 dbSNP
rs1392699403 15 dbSNP
rs1022001830 17 dbSNP
rs1431105016 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BNMH41 miR-132 Pharmacodynamic Biomarker (PDY) Clinical/Experimental Data Concentration Decrease Plasma Quantitative reverse transcription PCR
Gene Information
Gene Symbol NR1D2   
Synonyms BD73, EAR-1R, RVR
Description nuclear receptor subfamily 1 group D member 2
Transcript NM_001145425   
Other Transcripts NM_005126   
Expression
Putative miRNA Targets on NR1D2
3'UTR of NR1D2
(miRNA target sites are highlighted)		 
>NR1D2|NM_001145425|3'UTR
   1 GGCCTTTGTTTATTTAAACATGAACTGATGGTAACTGTACATTTTGTGCTAAAATGCATATTTATATGTGTATACCATAT
  81 GTGGAGATAGAAAAGACCTTTAAGACAATAAAAGATTGTAGGCTATCTCTGTAATCATGCAATAGCTGTTCGGATTGAGA
 161 ACTCTTCAGCCATGATTAGACGTTGACTGCATCTCCCTGATAGACCAATCAGCTGTGTCGCACTTAAACTGGAGAAGTTA
 241 CACTGAAGTATAATCACACTGAATGTTAGACTTTTTCATCTGCCAAAACCAAAAACCATTTTGATCTCCCTGTGGTTATC
 321 AATATAACGCACAATCACAAGTGTATGAGGACTTAGAAATTAATCCTTTGTGGTAGGAGTTCTGTTGAATGATGGAAATC
 401 TTATTACTACCACAAGACTATTTGATCTGGTAATTGGAGACTTCGGGATTTAGGAGATCTCCATGTCTGTATTTACTCTA
 481 CCACTGCTAAAGTGTGTGGTCCTGGGTAGTTTACTTGCTTGCGGAAAATGAGAATTGATGGTGTCCCCAATGCCCCACCT
 561 CACAGAGTTACTAAAAAATGTCTGTAAAGCATATTTACCTCTTGGGAGATAGGCACTATGTAAATAAGGTAAAATTTCTG
 641 TTATTACAATTATTCATAATAATATTCTTTTCTTATTTCTAAGCCTTTCTGGGAAATCATTTCAGTCCACACCAACCATA
 721 TTATTCAGGGTTCCTGCCATATGTGTGGGGTATCCTACTGATACACACGTATTCAAAGTTTATGGGTACAACAAAGACAT
 801 AGTACATGTACATAATATGTATGTGAATATAGTTAAATATATTTCTTCACAATATTTTAAACTGTGAAGAACTTTATCAT
 881 ACAGGAAACTTAAAACAAGAGGTGTCAAAAGACCCAAATTAGGTGCATTTTACTTGTTTATGATGGCATAACCATTGCTT
 961 TAAAATGTTTAGACAGTAGAATATTGAATTTATGCTCTATTTTTGTTTATTTAAGCAACACTTAATGTAAAAGTGCAACA
1041 GGCAATTGAATCCAAATTTCAACGACAAAAAAAAAAAACATGTATTTTAGAGTTCATCTTTGGCAAAATCTTTGGTTCAG
1121 GGTACTAGTTGTTTAAAAGTTGATTCATATTCTTACCTTGTGCTGAGAAAGGTTGCATTGCTGCCCCTTATACACATGCT
1201 GCAGCTTGATGTTAAAGAATTTTTATTCTTTCTGAAGAACTAATTAATGTTTAAAGCAACTGTTTAATATGATGGCATGT
1281 GTGTGTGTGCGTGCGTGTGTATGTTCTGAGTCCACTTCTTTTTTCCTAAATAACACTACAGGGATTTTGTCATATTAGAT
1361 TTAATTTATAATTTGAAAAATCATCTAGTGTGTGACCTACAGGCTTAGAAATGGTATAGTCAAAGACATTTTATCCACAT
1441 TTCTAATAGTGGACTTGATTAAGTAGATAAGATCAGCATCTGTTTATGGTAGTAGGAGAAATAGCCAAAGTTGAGGATTT
1521 TATGTATGTTTTCCTGTTTACCTGGAAAATAGCAATTAATTGGATTTTTTGGTAAAGATTGCCTTCTGTATAATGTTTGG
1601 ATTATATAAAATTGCAAAAATGATAACAGCCCGCTTTACTGTACTAAGCCTGTTACTTTCATGACGTGTGAGCAGAATGC
1681 CTTATTTTGTAATCTTGTTTAACTTGTTGCTACTGGGACTTGATTTACTGTGGCACTAGTTAAGTAAGTTAAAAAAAAGT
1761 TAAACCCTCTCATTATTAAAGAGGAAAGGCGATGGTGATGTCTGTAGTACAATATAAACCATAATTGTGATTTACCTTAA
1841 GTAGGTATAACTCTTATGGGATATACAGTATAGTTTTTGTGAATCTTTACATGATAGCATTATCTTTTTATAATTTTTTT
1921 TCCTAAGATAAACAAATGCATAGTTTTCTTCTATGGGTGATAGAAACAGCTTTTTGAAGTAATGAAAACCTCAAAAGATC
2001 ATGTTGATTCTTAATTTTTGCCTTTTGCATAAGCCTCTTTATAACATGTATCTTTAAAACAATTAAGTCTTTAGGAATGT
2081 GTAACCAGAACTATGTTAGTATTGCTTATAAAACTTTAGTTAGGTTCAATATATACATATATACATCTCTATATAGGTAT
2161 ATAGATTTGCATTTTGTCTTGTAAAATTTTATTTGAATAAATTCTTCCTGTAGGTAATGGGAAACAAAATTAATAGTTCA
2241 TATGTCACTCATAGCATTTCTATATTTGAAAGTAGCCCAATATAAAACTTTTGATTCTAAAATTAAACCAGCAGCCTATT
2321 ACAAGCACATTCTTTGATTGAGTCATTGGTTATAAACTTACTAAATGCAGAGAAAGCAGCCAATTTAGGAAACTTCTGAG
2401 TTGGTGGGACACTGTTGATTAATAATGTACTGTATGAATTAAGTGATGCTTTAACTTTGATTTTACATTTTAAAGTTAAA
2481 ATGTGGGCATTATGTCAGCAAACTTAAGGGCATTATGTCAGCAAGCTAAAACATTTTTTTTCCTGTGCTTTTAATGTATC
2561 TCTTTACATGATCTGAGAGAGGATTCAAGTTGATAGAAATAGCTGAGGGGAAAAGGGGGAACATCTTGGGATGAAGCTTG
2641 TCCTTATGGTGATGGTTTAATTACAGATTAAAAAATTAGAAGGAAATTTCAGTGGATTAAGTGTATAGCTTTCATATCTA
2721 CATTTCAAGAAATTACCATTGTAACTTGATAAGAGATGATTTATTTTATGTAAACATCTTTGCAAAGCAAGGTGTAGCAG
2801 CTCAGCTAGATTTATTACTGTGCACGAAAGTAAATACCTATCTCAATTATTCTTTTTCTTTTCCAATATAAAGTTTGCTG
2881 AATGTACAAGAAGAGTTTATCACTTAGGATATAGAATTTTTTTAGGGGTTGGGGGAGGGGATCTGTTAGGAAACTGTTAC
2961 CTATAAACAAAGATTGACTGGATTCGATCCAAAAGATAAAACTTGAAGCTATTCTGGAACTAACATGGAAAAATGAAATG
3041 GCTATTGTTTAAAAAAATGATAGAAATACATTGTTGATGGGATATGAGTTAAGTTTATTTTCTACAAACTGTAATTGATG
3121 AGGACATGGATAATATCTTCATGTTTCTGAGAAGTAATCTGTATGTGGGGGGAGGGGATAATAAATATTTCTAACCAACA
3201 AAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gcUGGUACCGAC-AUCUGACAAu 5'
            ||  ||  || |||||| || 
Target 5' tcACACTGAATGTTAGACTTTTt 3'
 254 - 276 128.00 -7.20
2 
miRNA  3' gcugguACCGACAUCUGACAAu 5'
                |||: | | |||||| 
Target 5' ctgagtTGGTGGGACACTGTTg 3'
 2396 - 2417 128.00 -11.80
3 
miRNA  3' gcUGGUACCGACAUCUGACAAu 5'
            |:| || : | | |||||| 
Target 5' ggATC-TGTTAGGAAACTGTTa 3'
 2939 - 2959 123.00 -9.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30115913 87 COSMIC
COSN30153843 87 COSMIC
COSN26438691 97 COSMIC
COSN31605610 106 COSMIC
COSN6573859 166 COSMIC
COSN17132072 221 COSMIC
COSN21974472 233 COSMIC
COSN30526630 249 COSMIC
COSN16396033 253 COSMIC
COSN5533145 399 COSMIC
COSN31962036 559 COSMIC
COSN18998961 645 COSMIC
COSN21055921 711 COSMIC
COSN17470517 992 COSMIC
COSN20098218 1079 COSMIC
COSN27367124 1079 COSMIC
COSN25145773 1164 COSMIC
COSN25523426 1279 COSMIC
COSN20090777 1291 COSMIC
COSN5043105 2053 COSMIC
COSN20252983 2073 COSMIC
COSN8924092 2205 COSMIC
COSN23414892 2894 COSMIC
COSN21364647 3090 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1428255250 2 dbSNP
rs761991177 3 dbSNP
rs370800749 4 dbSNP
rs199724685 5 dbSNP
rs1424242842 9 dbSNP
rs780967231 10 dbSNP
rs752600291 12 dbSNP
rs755844630 20 dbSNP
rs1483138022 21 dbSNP
rs1408758752 23 dbSNP
rs777810436 26 dbSNP
rs201841751 28 dbSNP
rs1202067287 32 dbSNP
rs1336956042 36 dbSNP
rs770590148 39 dbSNP
rs778509259 46 dbSNP
rs1010288339 48 dbSNP
rs116793159 52 dbSNP
rs1013945636 57 dbSNP
rs1225117014 58 dbSNP
rs1417569013 59 dbSNP
rs1343496655 69 dbSNP
rs968854408 70 dbSNP
rs1023050586 73 dbSNP
rs921422233 77 dbSNP
rs970033906 79 dbSNP
rs979094365 82 dbSNP
rs1311048854 89 dbSNP
rs1178614289 93 dbSNP
rs1358061732 103 dbSNP
rs34096691 105 dbSNP
rs925832101 109 dbSNP
rs1448209734 111 dbSNP
rs986967058 118 dbSNP
rs955889782 126 dbSNP
rs988573561 128 dbSNP
rs546255893 135 dbSNP
rs539336507 138 dbSNP
rs534456639 139 dbSNP
rs760768533 139 dbSNP
rs554176425 143 dbSNP
rs1239006012 144 dbSNP
rs879601752 144 dbSNP
rs1308935029 148 dbSNP
rs572331871 152 dbSNP
rs1172916108 164 dbSNP
rs183715156 165 dbSNP
rs1262398759 166 dbSNP
rs1228981019 175 dbSNP
rs186941880 182 dbSNP
rs1390908544 185 dbSNP
rs1380146527 186 dbSNP
rs191415159 190 dbSNP
rs1278895375 192 dbSNP
rs1405876815 194 dbSNP
rs941333627 201 dbSNP
rs1442353883 204 dbSNP
rs776514555 209 dbSNP
rs182635303 211 dbSNP
rs897383365 220 dbSNP
rs1239305599 221 dbSNP
rs1037424045 224 dbSNP
rs1256411275 236 dbSNP
rs919969230 237 dbSNP
rs1479755861 242 dbSNP
rs994367640 244 dbSNP
rs1209154988 248 dbSNP
rs1352682359 254 dbSNP
rs140874702 260 dbSNP
rs576775984 264 dbSNP
rs1218311371 277 dbSNP
rs1044498957 278 dbSNP
rs540958582 281 dbSNP
rs1441380083 286 dbSNP
rs1322451167 293 dbSNP
rs1317404067 298 dbSNP
rs559335670 299 dbSNP
rs1056628911 308 dbSNP
rs895606050 312 dbSNP
rs1424298444 316 dbSNP
rs905959985 323 dbSNP
rs1177546807 325 dbSNP
rs1352293837 327 dbSNP
rs558308043 329 dbSNP
rs1288861342 330 dbSNP
rs1452390940 335 dbSNP
rs1022677999 338 dbSNP
rs970129735 342 dbSNP
rs999792813 352 dbSNP
rs1384241093 353 dbSNP
rs1056909034 354 dbSNP
rs568745561 356 dbSNP
rs1032902851 371 dbSNP
rs529636162 376 dbSNP
rs1331691464 389 dbSNP
rs1259537504 390 dbSNP
rs1204541239 395 dbSNP
rs891682881 405 dbSNP
rs1293995827 407 dbSNP
rs1010176581 408 dbSNP
rs1358920357 411 dbSNP
rs4602333 418 dbSNP
rs1230060397 420 dbSNP
rs375755717 421 dbSNP
rs1449372960 428 dbSNP
rs1387807877 431 dbSNP
rs563380720 434 dbSNP
rs922435158 445 dbSNP
rs774882048 446 dbSNP
rs985953430 449 dbSNP
rs995921589 452 dbSNP
rs911288659 461 dbSNP
rs941372612 464 dbSNP
rs530572713 472 dbSNP
rs367956899 474 dbSNP
rs554053409 474 dbSNP
rs1480685827 476 dbSNP
rs954450604 477 dbSNP
rs1198242092 479 dbSNP
rs1239093135 483 dbSNP
rs1038367258 496 dbSNP
rs751481985 497 dbSNP
rs1191456016 500 dbSNP
rs1275579471 504 dbSNP
rs961918337 505 dbSNP
rs1245936178 509 dbSNP
rs930209256 513 dbSNP
rs550442662 518 dbSNP
rs571857635 519 dbSNP
rs746323705 523 dbSNP
rs1234425016 524 dbSNP
rs1174288296 525 dbSNP
rs1347927227 530 dbSNP
rs1282008109 536 dbSNP
rs896654731 540 dbSNP
rs865906684 548 dbSNP
rs1464708121 551 dbSNP
rs1328976417 555 dbSNP
rs1044555705 557 dbSNP
rs144793932 559 dbSNP
rs1167051032 560 dbSNP
rs547747747 562 dbSNP
rs1470174847 564 dbSNP
rs1431340455 565 dbSNP
rs1044384127 568 dbSNP
rs1480136261 578 dbSNP
rs905582059 583 dbSNP
rs1459565498 597 dbSNP
rs1436226107 599 dbSNP
rs927353600 607 dbSNP
rs1204707056 608 dbSNP
rs938786185 630 dbSNP
rs1261793235 632 dbSNP
rs999845244 633 dbSNP
rs1321939933 635 dbSNP
rs1330924333 638 dbSNP
rs566332560 641 dbSNP
rs891749864 644 dbSNP
rs1443761015 645 dbSNP
rs1333604427 648 dbSNP
rs1327844504 650 dbSNP
rs1453056743 653 dbSNP
rs1408086553 656 dbSNP
rs1277180512 657 dbSNP
rs138639511 658 dbSNP
rs945946589 659 dbSNP
rs1218023381 660 dbSNP
rs1303682796 662 dbSNP
rs1160314622 663 dbSNP
rs1468730514 663 dbSNP
rs1232487216 664 dbSNP
rs1258813208 665 dbSNP
rs1184494783 666 dbSNP
rs1043016155 667 dbSNP
rs772714123 668 dbSNP
rs1203441440 673 dbSNP
rs1029543846 684 dbSNP
rs1287031936 686 dbSNP
rs767265395 704 dbSNP
rs1288843591 705 dbSNP
rs1278565607 716 dbSNP
rs985284144 719 dbSNP
rs554505097 732 dbSNP
rs1185093580 733 dbSNP
rs576133114 737 dbSNP
rs1384582296 739 dbSNP
rs962809022 740 dbSNP
rs1451664088 741 dbSNP
rs1345700297 749 dbSNP
rs1320253719 750 dbSNP
rs974109564 755 dbSNP
rs1407289459 758 dbSNP
rs1200909349 765 dbSNP
rs752571968 769 dbSNP
rs566116119 770 dbSNP
rs186612418 771 dbSNP
rs576614238 772 dbSNP
rs1214336725 776 dbSNP
rs1446950400 779 dbSNP
rs992412397 782 dbSNP
rs1020195442 784 dbSNP
rs918151093 786 dbSNP
rs948232213 787 dbSNP
rs1474002367 789 dbSNP
rs1361079687 791 dbSNP
rs559764503 794 dbSNP
rs1045221168 795 dbSNP
rs973314570 799 dbSNP
rs1362457549 800 dbSNP
rs1271740670 806 dbSNP
rs1428506454 807 dbSNP
rs905630463 809 dbSNP
rs559411058 810 dbSNP
rs1303778802 813 dbSNP
rs1426693314 824 dbSNP
rs1363943960 828 dbSNP
rs1163218748 829 dbSNP
rs574634547 830 dbSNP
rs1422031894 838 dbSNP
rs1325951763 839 dbSNP
rs541462660 840 dbSNP
rs1475334780 841 dbSNP
rs1027204815 842 dbSNP
rs1199491881 846 dbSNP
rs1490716393 848 dbSNP
rs952979856 862 dbSNP
rs980050551 865 dbSNP
rs1399957893 870 dbSNP
rs956383803 871 dbSNP
rs1274776256 875 dbSNP
rs1212605316 887 dbSNP
rs927319392 892 dbSNP
rs1054101153 897 dbSNP
rs938754711 897 dbSNP
rs992961082 897 dbSNP
rs1293036731 899 dbSNP
rs753223211 901 dbSNP
rs1242854372 902 dbSNP
rs1283892836 903 dbSNP
rs1409810506 910 dbSNP
rs1430603355 910 dbSNP
rs1009836061 915 dbSNP
rs1479755635 916 dbSNP
rs1357325196 919 dbSNP
rs756824887 926 dbSNP
rs1030007766 927 dbSNP
rs904410645 943 dbSNP
rs1480723039 954 dbSNP
rs1234314522 955 dbSNP
rs891033540 962 dbSNP
rs1211352058 968 dbSNP
rs1202181978 971 dbSNP
rs931902624 972 dbSNP
rs1225211805 973 dbSNP
rs1050076951 975 dbSNP
rs1300594436 980 dbSNP
rs890162038 984 dbSNP
rs1392048010 987 dbSNP
rs1375782337 998 dbSNP
rs1007160181 999 dbSNP
rs191349086 1000 dbSNP
rs1264674856 1002 dbSNP
rs1179073486 1005 dbSNP
rs1468639862 1005 dbSNP
rs1009062490 1006 dbSNP
rs778625538 1019 dbSNP
rs1419226150 1022 dbSNP
rs1409670037 1028 dbSNP
rs760659372 1029 dbSNP
rs1457056003 1034 dbSNP
rs1205333524 1038 dbSNP
rs962821702 1038 dbSNP
rs1473584130 1040 dbSNP
rs994319493 1043 dbSNP
rs1239854413 1046 dbSNP
rs1318854701 1051 dbSNP
rs149325067 1053 dbSNP
rs1378889252 1061 dbSNP
rs1419596982 1064 dbSNP
rs1299395085 1065 dbSNP
rs1362524976 1066 dbSNP
rs1290014642 1067 dbSNP
rs1385485889 1067 dbSNP
rs1402117344 1067 dbSNP
rs397789593 1067 dbSNP
rs535843216 1067 dbSNP
rs574035079 1067 dbSNP
rs66705087 1067 dbSNP
rs1025694117 1071 dbSNP
rs1185183466 1077 dbSNP
rs951377568 1078 dbSNP
rs992143092 1079 dbSNP
rs1205695618 1080 dbSNP
rs980349636 1081 dbSNP
rs772746873 1082 dbSNP
rs948310360 1096 dbSNP
rs1247297046 1099 dbSNP
rs981384859 1104 dbSNP
rs1317519603 1107 dbSNP
rs1244202846 1111 dbSNP
rs1340302501 1119 dbSNP
rs1352773914 1120 dbSNP
rs1240762862 1125 dbSNP
rs1288153450 1142 dbSNP
rs11547595 1147 dbSNP
rs1383439216 1148 dbSNP
rs925464386 1150 dbSNP
rs780232557 1151 dbSNP
rs1418623662 1152 dbSNP
rs1365804298 1153 dbSNP
rs1165126485 1158 dbSNP
rs1456177644 1159 dbSNP
rs530664039 1161 dbSNP
rs552283294 1180 dbSNP
rs747412362 1192 dbSNP
rs1430176627 1194 dbSNP
rs534075564 1194 dbSNP
rs1054152968 1195 dbSNP
rs1256275214 1197 dbSNP
rs1490546554 1198 dbSNP
rs993237036 1200 dbSNP
rs1355946007 1208 dbSNP
rs1443748761 1214 dbSNP
rs565503861 1216 dbSNP
rs912957057 1217 dbSNP
rs945746137 1218 dbSNP
rs946133751 1234 dbSNP
rs1278191569 1238 dbSNP
rs1398815039 1239 dbSNP
rs978594101 1241 dbSNP
rs1304452000 1242 dbSNP
rs1384648885 1242 dbSNP
rs925806695 1245 dbSNP
rs1439532695 1247 dbSNP
rs76656162 1250 dbSNP
rs891077260 1260 dbSNP
rs1421355628 1269 dbSNP
rs1169944196 1270 dbSNP
rs1491425264 1277 dbSNP
rs1050375450 1278 dbSNP
rs944354138 1278 dbSNP
rs1172029902 1284 dbSNP
rs1006801270 1286 dbSNP
rs897550301 1289 dbSNP
rs554109552 1291 dbSNP
rs898334509 1292 dbSNP
rs72628110 1295 dbSNP
rs1326286045 1296 dbSNP
rs1025746307 1298 dbSNP
rs951428309 1306 dbSNP
rs567426732 1313 dbSNP
rs1375866616 1316 dbSNP
rs1024970085 1317 dbSNP
rs1392893460 1318 dbSNP
rs183154117 1319 dbSNP
rs970075854 1331 dbSNP
rs148098215 1342 dbSNP
rs1431376405 1345 dbSNP
rs540627942 1350 dbSNP
rs1477780351 1355 dbSNP
rs1364571154 1356 dbSNP
rs1014227070 1361 dbSNP
rs1456629425 1362 dbSNP
rs958213954 1368 dbSNP
rs189078126 1384 dbSNP
rs1232486051 1385 dbSNP
rs1297126002 1397 dbSNP
rs1463038336 1400 dbSNP
rs913007812 1404 dbSNP
rs1277199907 1406 dbSNP
rs1216937774 1409 dbSNP
rs1256044498 1422 dbSNP
rs746923690 1422 dbSNP
rs558604401 1447 dbSNP
rs1240688992 1448 dbSNP
rs1196350915 1450 dbSNP
rs1308190232 1453 dbSNP
rs1453181794 1455 dbSNP
rs73038538 1466 dbSNP
rs1332161657 1470 dbSNP
rs1413957904 1472 dbSNP
rs1385700002 1474 dbSNP
rs1457944047 1475 dbSNP
rs912237839 1491 dbSNP
rs773315843 1492 dbSNP
rs1160401464 1502 dbSNP
rs1179598577 1503 dbSNP
rs1438000785 1509 dbSNP
rs925774102 1512 dbSNP
rs534527181 1513 dbSNP
rs553083938 1516 dbSNP
rs1446863159 1518 dbSNP
rs185259942 1519 dbSNP
rs759433384 1524 dbSNP
rs911785138 1537 dbSNP
rs542097029 1543 dbSNP
rs898385379 1549 dbSNP
rs1378261132 1550 dbSNP
rs1036012435 1560 dbSNP
rs557028209 1562 dbSNP
rs1471033053 1587 dbSNP
rs1168626858 1590 dbSNP
rs918945049 1591 dbSNP
rs1384787325 1593 dbSNP
rs1399762839 1601 dbSNP
rs1282235516 1607 dbSNP
rs995367401 1609 dbSNP
rs1048834994 1613 dbSNP
rs536461560 1615 dbSNP
rs374591479 1618 dbSNP
rs1466360983 1621 dbSNP
rs1333074578 1622 dbSNP
rs944979533 1623 dbSNP
rs555957647 1624 dbSNP
rs1164500995 1630 dbSNP
rs190092330 1633 dbSNP
rs969436306 1634 dbSNP
rs1181640605 1642 dbSNP
rs752379202 1650 dbSNP
rs1244394557 1651 dbSNP
rs1386123475 1655 dbSNP
rs868299660 1655 dbSNP
rs1014942966 1658 dbSNP
rs564183522 1661 dbSNP
rs1332316155 1663 dbSNP
rs1216188380 1664 dbSNP
rs1323178635 1666 dbSNP
rs1256894607 1667 dbSNP
rs1227590219 1670 dbSNP
rs988309293 1675 dbSNP
rs1280059876 1698 dbSNP
rs1318118721 1713 dbSNP
rs914065066 1714 dbSNP
rs1406920638 1726 dbSNP
rs955010057 1734 dbSNP
rs1164509006 1737 dbSNP
rs1000199906 1739 dbSNP
rs1169227920 1741 dbSNP
rs1422236282 1741 dbSNP
rs760525533 1745 dbSNP
rs1253420513 1749 dbSNP
rs1261787410 1749 dbSNP
rs754840807 1751 dbSNP
rs550047278 1754 dbSNP
rs1487741359 1756 dbSNP
rs763864167 1758 dbSNP
rs953457660 1759 dbSNP
rs985940065 1760 dbSNP
rs1481715163 1765 dbSNP
rs1018814673 1772 dbSNP
rs1317224152 1777 dbSNP
rs1283938624 1783 dbSNP
rs1423049629 1783 dbSNP
rs1221068179 1788 dbSNP
rs912274319 1791 dbSNP
rs1293205062 1792 dbSNP
rs528151436 1807 dbSNP
rs368085703 1813 dbSNP
rs541270558 1825 dbSNP
rs965978534 1826 dbSNP
rs975061149 1832 dbSNP
rs919862791 1837 dbSNP
rs1356594081 1838 dbSNP
rs1329769246 1839 dbSNP
rs559897917 1840 dbSNP
rs1172872770 1848 dbSNP
rs972423040 1851 dbSNP
rs530370703 1857 dbSNP
rs1347890494 1864 dbSNP
rs1434439368 1888 dbSNP
rs1422591357 1893 dbSNP
rs1046963103 1898 dbSNP
rs918924672 1905 dbSNP
rs1457277715 1914 dbSNP
rs1480770846 1914 dbSNP
rs372277608 1918 dbSNP
rs949220348 1922 dbSNP
rs1293902066 1926 dbSNP
rs1392731516 1930 dbSNP
rs1046490541 1933 dbSNP
rs1310571377 1934 dbSNP
rs1224504295 1940 dbSNP
rs984427287 1940 dbSNP
rs1379403470 1943 dbSNP
rs1307455586 1945 dbSNP
rs569744290 1954 dbSNP
rs1002235959 1958 dbSNP
rs926346400 1967 dbSNP
rs1305161148 1968 dbSNP
rs530836926 1969 dbSNP
rs1465001806 1974 dbSNP
rs552120393 1983 dbSNP
rs1032303368 1984 dbSNP
rs1356891367 1986 dbSNP
rs1174746200 1987 dbSNP
rs528646308 1995 dbSNP
rs1276982327 2001 dbSNP
rs1419239080 2002 dbSNP
rs937780204 2004 dbSNP
rs112317436 2005 dbSNP
rs1176536435 2008 dbSNP
rs1438900106 2010 dbSNP
rs570859781 2011 dbSNP
rs1243657973 2015 dbSNP
rs141833564 2016 dbSNP
rs1220069491 2022 dbSNP
rs1310218412 2023 dbSNP
rs1482255441 2025 dbSNP
rs896000108 2030 dbSNP
rs1356107883 2035 dbSNP
rs375847872 2038 dbSNP
rs1383925435 2041 dbSNP
rs1021124188 2042 dbSNP
rs1244443023 2046 dbSNP
rs1394729250 2046 dbSNP
rs1379096353 2056 dbSNP
rs1266430944 2057 dbSNP
rs138839200 2061 dbSNP
rs903443815 2063 dbSNP
rs954919667 2069 dbSNP
rs1215139701 2070 dbSNP
rs753516295 2073 dbSNP
rs568229830 2075 dbSNP
rs1368791341 2078 dbSNP
rs191716619 2078 dbSNP
rs184229082 2080 dbSNP
rs1188501526 2082 dbSNP
rs757020814 2092 dbSNP
rs1255457942 2098 dbSNP
rs1187181946 2110 dbSNP
rs1489340275 2115 dbSNP
rs1261152393 2116 dbSNP
rs554132569 2118 dbSNP
rs1488912799 2120 dbSNP
rs576074248 2129 dbSNP
rs1243142564 2130 dbSNP
rs1195882303 2134 dbSNP
rs1386904162 2136 dbSNP
rs575573541 2138 dbSNP
rs188168460 2141 dbSNP
rs752735189 2143 dbSNP
rs964115947 2144 dbSNP
rs1341787616 2146 dbSNP
rs975113307 2148 dbSNP
rs557691118 2150 dbSNP
rs150649077 2151 dbSNP
rs1360595641 2166 dbSNP
rs572900857 2178 dbSNP
rs930930097 2182 dbSNP
rs1456260518 2185 dbSNP
rs1432203233 2190 dbSNP
rs982696275 2191 dbSNP
rs966309923 2192 dbSNP
rs971923828 2194 dbSNP
rs1228566172 2198 dbSNP
rs908428088 2199 dbSNP
rs1208396721 2202 dbSNP
rs778535565 2213 dbSNP
rs1362105309 2218 dbSNP
rs1046642737 2225 dbSNP
rs749974523 2227 dbSNP
rs1275695852 2228 dbSNP
rs758917158 2228 dbSNP
rs1217546404 2231 dbSNP
rs926314000 2234 dbSNP
rs1325163925 2243 dbSNP
rs1384737745 2245 dbSNP
rs780613527 2251 dbSNP
rs1331793482 2261 dbSNP
rs540316186 2263 dbSNP
rs893810820 2264 dbSNP
rs937747613 2265 dbSNP
rs1170051477 2271 dbSNP
rs180892880 2281 dbSNP
rs1379562798 2283 dbSNP
rs1196969864 2286 dbSNP
rs1021175028 2294 dbSNP
rs1244732320 2296 dbSNP
rs558127868 2298 dbSNP
rs1200934215 2304 dbSNP
rs1456815599 2310 dbSNP
rs1258054480 2315 dbSNP
rs879172037 2322 dbSNP
rs1437661539 2325 dbSNP
rs1197425892 2328 dbSNP
rs530294131 2336 dbSNP
rs1041902370 2346 dbSNP
rs541991912 2349 dbSNP
rs1157827625 2353 dbSNP
rs1330162572 2360 dbSNP
rs1018185147 2362 dbSNP
rs777377906 2364 dbSNP
rs963860283 2367 dbSNP
rs1448799952 2373 dbSNP
rs936263392 2378 dbSNP
rs1330644680 2390 dbSNP
rs1054448372 2393 dbSNP
rs1358114975 2402 dbSNP
rs1170902706 2413 dbSNP
rs1465684052 2419 dbSNP
rs781455999 2423 dbSNP
rs1007644808 2427 dbSNP
rs1026693588 2428 dbSNP
rs1444945489 2437 dbSNP
rs952373523 2440 dbSNP
rs901932523 2453 dbSNP
rs1444637410 2454 dbSNP
rs1280055040 2455 dbSNP
rs1198287546 2457 dbSNP
rs1346692984 2463 dbSNP
rs1286331335 2467 dbSNP
rs1309006411 2474 dbSNP
rs1374316206 2484 dbSNP
rs1374636394 2490 dbSNP
rs1308305352 2493 dbSNP
rs1226016757 2497 dbSNP
rs1276563546 2510 dbSNP
rs1332262586 2513 dbSNP
rs1311736541 2514 dbSNP
rs982434263 2520 dbSNP
rs1491519409 2533 dbSNP
rs993706009 2533 dbSNP
rs1379999272 2534 dbSNP
rs34772025 2534 dbSNP
rs951945747 2534 dbSNP
rs908480708 2539 dbSNP
rs971050018 2542 dbSNP
rs563656376 2544 dbSNP
rs1456619765 2559 dbSNP
rs1184734705 2566 dbSNP
rs1177722607 2569 dbSNP
rs1238598276 2579 dbSNP
rs982003137 2587 dbSNP
rs1218293863 2595 dbSNP
rs1351062448 2596 dbSNP
rs1283230675 2611 dbSNP
rs1228734510 2614 dbSNP
rs1471103970 2632 dbSNP
rs1358377439 2634 dbSNP
rs571712314 2648 dbSNP
rs748335806 2649 dbSNP
rs1423844322 2650 dbSNP
rs1033297438 2665 dbSNP
rs937806559 2668 dbSNP
rs531070089 2670 dbSNP
rs1360195909 2673 dbSNP
rs1397606489 2674 dbSNP
rs769929491 2678 dbSNP
rs1324611693 2685 dbSNP
rs1407474890 2687 dbSNP
rs1412230620 2691 dbSNP
rs991847553 2693 dbSNP
rs1464800229 2700 dbSNP
rs1331060024 2701 dbSNP
rs1195233960 2710 dbSNP
rs552198349 2723 dbSNP
rs915297008 2729 dbSNP
rs1221990497 2733 dbSNP
rs1444973288 2739 dbSNP
rs1177036342 2741 dbSNP
rs1287498689 2751 dbSNP
rs1273651017 2752 dbSNP
rs770030157 2759 dbSNP
rs1367517749 2760 dbSNP
rs917629678 2760 dbSNP
rs1042762261 2765 dbSNP
rs1275710681 2770 dbSNP
rs1438902273 2771 dbSNP
rs773231470 2774 dbSNP
rs1348456813 2778 dbSNP
rs1323320119 2781 dbSNP
rs577636104 2793 dbSNP
rs1285296920 2796 dbSNP
rs966507411 2802 dbSNP
rs544793408 2808 dbSNP
rs1172191129 2809 dbSNP
rs1476578203 2810 dbSNP
rs1418323100 2821 dbSNP
rs1191367068 2823 dbSNP
rs1478824682 2824 dbSNP
rs564496110 2825 dbSNP
rs140842865 2826 dbSNP
rs547047712 2827 dbSNP
rs187009948 2828 dbSNP
rs1039251356 2832 dbSNP
rs1196798955 2847 dbSNP
rs900668937 2847 dbSNP
rs924834227 2850 dbSNP
rs144676268 2851 dbSNP
rs936232027 2856 dbSNP
rs1478323398 2857 dbSNP
rs1054749056 2860 dbSNP
rs76873718 2867 dbSNP
rs952423443 2868 dbSNP
rs771841872 2878 dbSNP
rs910807839 2885 dbSNP
rs1015669143 2888 dbSNP
rs1477277403 2888 dbSNP
rs1379725908 2891 dbSNP
rs1171020862 2903 dbSNP
rs970385647 2910 dbSNP
rs982441992 2912 dbSNP
rs926537987 2913 dbSNP
rs1411934889 2915 dbSNP
rs1176163476 2917 dbSNP
rs569178741 2918 dbSNP
rs1192741225 2919 dbSNP
rs1440129501 2922 dbSNP
rs1349758985 2929 dbSNP
rs1406122682 2931 dbSNP
rs1305003270 2933 dbSNP
rs376491767 2935 dbSNP
rs1480269989 2937 dbSNP
rs989260053 2938 dbSNP
rs796433330 2940 dbSNP
rs369052461 2942 dbSNP
rs71324123 2955 dbSNP
rs1341743105 2956 dbSNP
rs1226342702 2959 dbSNP
rs1310665406 2961 dbSNP
rs572784355 2962 dbSNP
rs1241298461 2963 dbSNP
rs371453829 2966 dbSNP
rs1490482056 2970 dbSNP
rs1356239389 2971 dbSNP
rs1224691908 2973 dbSNP
rs1391256716 2978 dbSNP
rs945461110 2986 dbSNP
rs147510446 2987 dbSNP
rs1172572671 2995 dbSNP
rs1419959998 2997 dbSNP
rs1381861039 2998 dbSNP
rs140078810 3000 dbSNP
rs1193758917 3014 dbSNP
rs1374375454 3016 dbSNP
rs1471616455 3018 dbSNP
rs1013646818 3021 dbSNP
rs1413572314 3025 dbSNP
rs79977932 3027 dbSNP
rs1256928347 3034 dbSNP
rs753616183 3039 dbSNP
rs1358701671 3045 dbSNP
rs1284252139 3048 dbSNP
rs1238865066 3051 dbSNP
rs900744685 3066 dbSNP
rs1359229052 3067 dbSNP
rs565065022 3068 dbSNP
rs1227124596 3077 dbSNP
rs924772686 3079 dbSNP
rs1311746774 3082 dbSNP
rs563059585 3083 dbSNP
rs1286900595 3085 dbSNP
rs957485127 3087 dbSNP
rs990323458 3087 dbSNP
rs543976036 3091 dbSNP
rs1417173061 3095 dbSNP
rs1474203662 3095 dbSNP
rs1194497420 3100 dbSNP
rs910776609 3102 dbSNP
rs1261351655 3106 dbSNP
rs563767605 3109 dbSNP
rs943650884 3110 dbSNP
rs1267635279 3116 dbSNP
rs1049258169 3119 dbSNP
rs923325074 3120 dbSNP
rs1292116661 3126 dbSNP
rs1218784523 3127 dbSNP
rs888233315 3128 dbSNP
rs1341958653 3134 dbSNP
rs764994101 3137 dbSNP
rs1359959758 3154 dbSNP
rs1381328142 3159 dbSNP
rs1301541941 3160 dbSNP
rs1248074038 3162 dbSNP
rs150071854 3166 dbSNP
rs1459758792 3167 dbSNP
rs542028859 3168 dbSNP
rs532626166 3169 dbSNP
rs1478871009 3174 dbSNP
rs1263257432 3176 dbSNP
rs970819213 3178 dbSNP
rs1440306688 3179 dbSNP
rs772626278 3180 dbSNP
rs1433983379 3181 dbSNP
rs1269837798 3186 dbSNP
rs1208486190 3189 dbSNP
rs887871768 3197 dbSNP
rs1003182795 3199 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.829 5.1e-7 0.400 2.9e-2 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.573 4.1e-3 0.689 3.9e-4 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.377 3.5e-2 0.456 1.3e-2 24 Click to see details
GSE28260 Renal cortex and medulla 0.448 6.2e-2 0.456 5.9e-2 13 Click to see details
GSE32688 Pancreatic cancer -0.237 9.6e-2 -0.186 1.5e-1 32 Click to see details
GSE28544 Breast cancer 0.267 1.0e-1 0.228 1.4e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.258 1.1e-1 -0.241 1.2e-1 25 Click to see details
GSE17306 Multiple myeloma -0.171 1.2e-1 -0.124 2.0e-1 49 Click to see details
GSE19536 Breast cancer 0.11 1.4e-1 0.126 1.1e-1 100 Click to see details
GSE19350 CNS germ cell tumors 0.327 1.5e-1 0.196 2.7e-1 12 Click to see details
GSE19783 ER- ER- breast cancer 0.097 2.0e-1 0.060 3.0e-1 79 Click to see details
GSE21687 Ependynoma primary tumors 0.094 2.3e-1 0.034 3.9e-1 64 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.254 2.5e-1 -0.383 1.5e-1 9 Click to see details
GSE21032 Prostate cancer 0.07 2.6e-1 0.024 4.1e-1 83 Click to see details
GSE19783 ER+ ER+ breast cancer -0.13 2.9e-1 -0.026 4.6e-1 20 Click to see details
GSE17498 Multiple myeloma -0.059 3.6e-1 -0.071 3.3e-1 40 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.064 3.8e-1 0.175 2.0e-1 25 Click to see details
GSE38226 Liver fibrosis -0.046 4.2e-1 -0.054 4.1e-1 21 Click to see details
GSE21849 B cell lymphoma -0.03 4.4e-1 0.324 4.3e-2 29 Click to see details
GSE27834 Pluripotent stem cells 0.035 4.5e-1 0.103 3.5e-1 16 Click to see details
GSE14794 Lymphoblastoid cells -0.012 4.6e-1 0.078 2.3e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD -0.321 0.04 -0.372 0.02 32 Click to see details
LUSC -0.231 0.08 -0.230 0.08 38 Click to see details
PAAD -0.816 0.09 -0.400 0.3 4 Click to see details
KIRP 0.212 0.12 0.208 0.13 32 Click to see details
BRCA 0.128 0.12 0.108 0.16 84 Click to see details
ESCA -0.276 0.21 -0.209 0.27 11 Click to see details
THCA 0.103 0.22 0.108 0.21 59 Click to see details
BLCA 0.192 0.22 0.220 0.19 18 Click to see details
KICH -0.14 0.25 -0.135 0.26 25 Click to see details
CESC -0.645 0.28 -0.500 0.33 3 Click to see details
COAD 0.237 0.29 0.024 0.48 8 Click to see details
PRAD 0.077 0.3 0.061 0.34 50 Click to see details
LUAD 0.17 0.3 0.210 0.26 12 Click to see details
HNSC 0.082 0.3 0.084 0.3 42 Click to see details
CHOL -0.195 0.31 -0.117 0.38 9 Click to see details
UCEC -0.09 0.36 -0.088 0.36 19 Click to see details
PCPG -0.408 0.37 -0.500 0.33 3 Click to see details
KIRC -0.037 0.38 0.042 0.37 68 Click to see details
LIHC -0.037 0.4 -0.044 0.38 49 Click to see details
LIHC -0.037 0.4 -0.044 0.38 49 Click to see details
LIHC -0.037 0.4 -0.044 0.38 49 Click to see details
247 hsa-miR-132-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000333 SIRT1 sirtuin 1 4 1
MIRT000334 MECP2 methyl-CpG binding protein 2 1 1
MIRT000601 CDKN1A cyclin dependent kinase inhibitor 1A 4 1
MIRT002329 RFX4 regulatory factor X4 1 1
MIRT003926 ARHGAP32 Rho GTPase activating protein 32 4 3
MIRT006503 RB1 RB transcriptional corepressor 1 5 1
MIRT006628 Mecp2 methyl CpG binding protein 2 4 1
MIRT006659 HBEGF heparin binding EGF like growth factor 4 3
MIRT007010 RASA1 RAS p21 protein activator 1 1 1
MIRT007166 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT007167 TJAP1 tight junction associated protein 1 3 3
MIRT007253 TLN2 talin 2 1 2
MIRT021716 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 1 1
MIRT021717 COX8C cytochrome c oxidase subunit 8C 1 1
MIRT021718 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase type 1 alpha 1 1
MIRT021719 CDH3 cadherin 3 1 1
MIRT021720 LOXL1 lysyl oxidase like 1 1 1
MIRT021721 TNFRSF17 TNF receptor superfamily member 17 1 1
MIRT021722 ADH1A alcohol dehydrogenase 1A (class I), alpha polypeptide 1 1
MIRT021723 KCTD4 potassium channel tetramerization domain containing 4 1 1
MIRT021724 PROSC pyridoxal phosphate binding protein 1 1
MIRT021725 WNT3A Wnt family member 3A 1 1
MIRT021726 KCNJ9 potassium voltage-gated channel subfamily J member 9 1 1
MIRT021727 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT021728 KIR3DL1 killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 1 1 1
MIRT021729 ARF6 ADP ribosylation factor 6 1 1
MIRT021730 PLSCR1 phospholipid scramblase 1 1 1
MIRT021731 CSTF2T cleavage stimulation factor subunit 2 tau variant 1 1
MIRT021732 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT021733 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT021734 EPHA4 EPH receptor A4 1 1
MIRT021735 RTEL1-TNFRSF6B RTEL1-TNFRSF6B readthrough (NMD candidate) 1 1
MIRT021736 MUC17 mucin 17, cell surface associated 1 1
MIRT021737 CA1 carbonic anhydrase 1 1 1
MIRT021738 S100A1 S100 calcium binding protein A1 1 1
MIRT021739 FKBP10 FK506 binding protein 10 1 1
MIRT021740 PLA2G4C phospholipase A2 group IVC 1 1
MIRT021741 GSTCD glutathione S-transferase C-terminal domain containing 1 1
MIRT021742 LIG4 DNA ligase 4 1 1
MIRT021743 POLK DNA polymerase kappa 1 1
MIRT021744 STMN1 stathmin 1 1 1
MIRT021745 DMGDH dimethylglycine dehydrogenase 1 1
MIRT021746 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 1 1
MIRT021747 TRIM36 tripartite motif containing 36 1 1
MIRT021748 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 1 1
MIRT021749 ANKRD28 ankyrin repeat domain 28 1 1
MIRT021750 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 1 1
MIRT021751 PTPLAD1 3-hydroxyacyl-CoA dehydratase 3 1 1
MIRT021752 SSR3 signal sequence receptor subunit 3 1 1
MIRT021753 KBTBD3 kelch repeat and BTB domain containing 3 1 1
MIRT021754 SYT14 synaptotagmin 14 1 1
MIRT021755 MAP1B microtubule associated protein 1B 1 1
MIRT021756 YKT6 YKT6 v-SNARE homolog 1 1
MIRT021757 CD55 CD55 molecule (Cromer blood group) 1 1
MIRT021758 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 1 1
MIRT021759 UBE2W ubiquitin conjugating enzyme E2 W 1 1
MIRT021760 GBAS nipsnap homolog 2 1 1
MIRT021761 TMEM47 transmembrane protein 47 1 1
MIRT021762 BNIP2 BCL2 interacting protein 2 1 1
MIRT021763 ZNF652 zinc finger protein 652 1 1
MIRT021764 FAM199X family with sequence similarity 199, X-linked 1 1
MIRT021765 FAM81A family with sequence similarity 81 member A 1 1
MIRT021766 CHRNA5 cholinergic receptor nicotinic alpha 5 subunit 1 1
MIRT021767 FRY FRY microtubule binding protein 1 1
MIRT021768 PTGS2 prostaglandin-endoperoxide synthase 2 1 1
MIRT021769 TUSC2 tumor suppressor candidate 2 1 1
MIRT021770 OSBPL8 oxysterol binding protein like 8 1 1
MIRT021771 CTDSPL2 CTD small phosphatase like 2 1 1
MIRT021772 MEF2A myocyte enhancer factor 2A 1 1
MIRT021773 PSMD12 proteasome 26S subunit, non-ATPase 12 1 1
MIRT021774 SPAST spastin 1 1
MIRT021775 ATP6V0E1 ATPase H+ transporting V0 subunit e1 1 1
MIRT021776 PRSS22 protease, serine 22 1 1
MIRT021777 SH3BGRL SH3 domain binding glutamate rich protein like 1 1
MIRT021778 KRT6C keratin 6C 1 1
MIRT021779 CST9L cystatin 9 like 1 1
MIRT021780 EBPL emopamil binding protein like 1 1
MIRT021781 SYNE3 spectrin repeat containing nuclear envelope family member 3 1 1
MIRT021782 FAM221B family with sequence similarity 221 member B 1 1
MIRT021783 GATA3 GATA binding protein 3 1 1
MIRT021784 EMILIN3 elastin microfibril interfacer 3 1 1
MIRT021785 ARL13B ADP ribosylation factor like GTPase 13B 1 1
MIRT021786 CYP26A1 cytochrome P450 family 26 subfamily A member 1 1 1
MIRT021787 SAMSN1 SAM domain, SH3 domain and nuclear localization signals 1 1 1
MIRT021788 GNL3L G protein nucleolar 3 like 1 1
MIRT021789 ETNK2 ethanolamine kinase 2 1 1
MIRT021790 DEPDC7 DEP domain containing 7 1 1
MIRT021791 FGF22 fibroblast growth factor 22 1 1
MIRT021792 FUT1 fucosyltransferase 1 (H blood group) 1 1
MIRT021793 KRTAP4-11 keratin associated protein 4-11 1 1
MIRT021794 SEC61A1 Sec61 translocon alpha 1 subunit 1 1
MIRT021795 CR2 complement C3d receptor 2 1 1
MIRT021796 MMP13 matrix metallopeptidase 13 1 1
MIRT021797 SYNDIG1L synapse differentiation inducing 1 like 1 1
MIRT021798 TFPI tissue factor pathway inhibitor 1 1
MIRT021799 RNF128 ring finger protein 128, E3 ubiquitin protein ligase 1 1
MIRT021800 SFXN2 sideroflexin 2 1 1
MIRT021801 PSMA2 proteasome subunit alpha 2 3 5
MIRT021802 FABP7 fatty acid binding protein 7 1 1
MIRT021803 CNTNAP1 contactin associated protein 1 1 1
MIRT021804 FBN3 fibrillin 3 1 1
MIRT021805 KIR3DL2 killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 2 1 1
MIRT021806 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT021807 B3GAT1 beta-1,3-glucuronyltransferase 1 1 1
MIRT021808 ARR3 arrestin 3 1 1
MIRT021809 GK glycerol kinase 1 1
MIRT021810 SMN1 survival of motor neuron 1, telomeric 1 1
MIRT021811 ALK ALK receptor tyrosine kinase 1 1
MIRT021812 PRX periaxin 1 1
MIRT021813 CYP2E1 cytochrome P450 family 2 subfamily E member 1 1 1
MIRT021814 ADAMTSL1 ADAMTS like 1 1 1
MIRT021815 NCS1 neuronal calcium sensor 1 1 1
MIRT021816 CFTR cystic fibrosis transmembrane conductance regulator 1 1
MIRT021817 OAS2 2'-5'-oligoadenylate synthetase 2 1 1
MIRT021818 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT021819 FAT4 FAT atypical cadherin 4 1 1
MIRT021820 GPR115 adhesion G protein-coupled receptor F4 1 1
MIRT021821 ZDHHC2 zinc finger DHHC-type containing 2 1 1
MIRT021822 INTS8 integrator complex subunit 8 1 1
MIRT021823 IMPA1 inositol monophosphatase 1 1 1
MIRT021824 FAT3 FAT atypical cadherin 3 1 1
MIRT021825 VPS13D vacuolar protein sorting 13 homolog D 1 1
MIRT021826 DOCK10 dedicator of cytokinesis 10 1 1
MIRT021827 LCA5 LCA5, lebercilin 1 1
MIRT021828 ARL14EP ADP ribosylation factor like GTPase 14 effector protein 1 1
MIRT021829 MTMR10 myotubularin related protein 10 1 1
MIRT021830 TRIM23 tripartite motif containing 23 1 1
MIRT021831 CHL1 cell adhesion molecule L1 like 1 1
MIRT021832 NDUFB10 NADH:ubiquinone oxidoreductase subunit B10 1 1
MIRT021833 NBN nibrin 1 1
MIRT021834 THBS1 thrombospondin 1 1 1
MIRT021835 GJE1 gap junction protein epsilon 1 1 1
MIRT021836 SNX7 sorting nexin 7 1 1
MIRT021837 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT021838 CASP7 caspase 7 1 1
MIRT021839 ECT2 epithelial cell transforming 2 1 1
MIRT021840 EXOC5 exocyst complex component 5 1 1
MIRT021841 CD164 CD164 molecule 1 1
MIRT021842 STAU1 staufen double-stranded RNA binding protein 1 1 1
MIRT021843 ANKRD29 ankyrin repeat domain 29 1 1
MIRT021844 CCSER2 coiled-coil serine rich protein 2 1 1
MIRT021845 RTN4 reticulon 4 1 1
MIRT021846 MDFIC MyoD family inhibitor domain containing 1 1
MIRT021847 ZNF236 zinc finger protein 236 1 1
MIRT021848 SDF2 stromal cell derived factor 2 1 1
MIRT021849 SPRED1 sprouty related EVH1 domain containing 1 1 1
MIRT021850 CMTM3 CKLF like MARVEL transmembrane domain containing 3 1 1
MIRT021851 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT021852 ACTR2 ARP2 actin related protein 2 homolog 1 1
MIRT021853 NAP1L1 nucleosome assembly protein 1 like 1 1 1
MIRT021854 FBXO28 F-box protein 28 1 1
MIRT021855 LGR4 leucine rich repeat containing G protein-coupled receptor 4 1 1
MIRT021856 ZNF148 zinc finger protein 148 1 1
MIRT021857 TBC1D9 TBC1 domain family member 9 1 1
MIRT021858 VDAC2 voltage dependent anion channel 2 1 1
MIRT021859 CC2D1B coiled-coil and C2 domain containing 1B 1 1
MIRT021860 MUC13 mucin 13, cell surface associated 1 1
MIRT021861 TSPAN6 tetraspanin 6 1 1
MIRT021862 GTF2H1 general transcription factor IIH subunit 1 1 1
MIRT021863 CALU calumenin 1 1
MIRT021864 CAMSAP2 calmodulin regulated spectrin associated protein family member 2 1 1
MIRT021865 CCNA2 cyclin A2 2 1
MIRT021866 CCNB1 cyclin B1 2 1
MIRT045838 PARP10 poly(ADP-ribose) polymerase family member 10 1 1
MIRT045839 RPL7 ribosomal protein L7 1 1
MIRT045840 FOXO1 forkhead box O1 4 2
MIRT045841 GNB2L1 receptor for activated C kinase 1 1 1
MIRT045842 CSTF3 cleavage stimulation factor subunit 3 1 1
MIRT045843 RPSA ribosomal protein SA 1 1
MIRT045844 ANXA2 annexin A2 1 1
MIRT045845 NCKAP1 NCK associated protein 1 1 1
MIRT045846 RPS5 ribosomal protein S5 1 1
MIRT045847 IRAK1 interleukin 1 receptor associated kinase 1 1 1
MIRT045848 PDLIM7 PDZ and LIM domain 7 1 1
MIRT054502 BDNF brain derived neurotrophic factor 2 1
MIRT054835 HN1 Jupiter microtubule associated homolog 1 4 1
MIRT054836 KLHL11 kelch like family member 11 4 1
MIRT054837 MAPK1 mitogen-activated protein kinase 1 4 1
MIRT054894 SOX5 SRY-box 5 2 1
MIRT091255 FXR1 FMR1 autosomal homolog 1 2 4
MIRT100367 HSPA1B heat shock protein family A (Hsp70) member 1B 2 2
MIRT106174 RRS1 ribosome biogenesis regulator homolog 2 2
MIRT149855 LDLR low density lipoprotein receptor 2 2
MIRT217679 ASF1A anti-silencing function 1A histone chaperone 2 2
MIRT259587 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT289307 TNRC6C trinucleotide repeat containing 6C 2 2
MIRT368374 ARID2 AT-rich interaction domain 2 2 2
MIRT438882 IRAK4 interleukin 1 receptor associated kinase 4 1 1
MIRT442189 HOOK3 hook microtubule tethering protein 3 2 2
MIRT449483 STAG1 stromal antigen 1 2 2
MIRT453131 HOXC4 homeobox C4 2 2
MIRT455372 KDM5C lysine demethylase 5C 2 2
MIRT455526 C6orf106 chromosome 6 open reading frame 106 2 2
MIRT458882 PFAS phosphoribosylformylglycinamidine synthase 2 2
MIRT464180 VMP1 vacuole membrane protein 1 2 21
MIRT467690 SLC38A2 solute carrier family 38 member 2 2 4
MIRT476656 FZD6 frizzled class receptor 6 2 4
MIRT477439 EML4 echinoderm microtubule associated protein like 4 2 4
MIRT479294 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT485291 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT495258 BMPER BMP binding endothelial regulator 2 2
MIRT497153 PRDM15 PR/SET domain 15 2 2
MIRT500830 TCEB1 elongin C 2 2
MIRT506948 HS3ST3B1 heparan sulfate-glucosamine 3-sulfotransferase 3B1 2 4
MIRT507623 CRTC1 CREB regulated transcription coactivator 1 2 2
MIRT508137 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT526271 CCDC169 coiled-coil domain containing 169 2 2
MIRT526867 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT532420 ART4 ADP-ribosyltransferase 4 (Dombrock blood group) 2 2
MIRT532508 TWISTNB TWIST neighbor 2 4
MIRT534833 RAB18 RAB18, member RAS oncogene family 2 2
MIRT542577 ZNF280B zinc finger protein 280B 2 2
MIRT546160 TSPAN12 tetraspanin 12 2 2
MIRT547255 NUP50 nucleoporin 50 2 4
MIRT547614 LIFR LIF receptor alpha 2 2
MIRT547705 KPNA1 karyopherin subunit alpha 1 2 4
MIRT549141 BRWD1 bromodomain and WD repeat domain containing 1 2 2
MIRT549455 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT551640 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT554985 RAB5B RAB5B, member RAS oncogene family 2 2
MIRT555924 OCLN occludin 5 4
MIRT557610 GNB1 G protein subunit beta 1 2 2
MIRT571512 ZNF711 zinc finger protein 711 2 2
MIRT572928 PRAMEF1 PRAME family member 1 2 2
MIRT573617 ZNF724P zinc finger protein 724 2 2
MIRT574924 Vmp1 vacuole membrane protein 1 2 12
MIRT614465 ALKBH4 alkB homolog 4, lysine demethylase 2 2
MIRT623025 OLFML2A olfactomedin like 2A 2 2
MIRT639080 CD226 CD226 molecule 2 2
MIRT642134 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT653734 SLC25A32 solute carrier family 25 member 32 2 2
MIRT655167 PHF20L1 PHD finger protein 20 like 1 2 2
MIRT680989 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT681564 UBXN2A UBX domain protein 2A 2 2
MIRT696294 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT697724 USP8 ubiquitin specific peptidase 8 2 2
MIRT703296 GID4 GID complex subunit 4 homolog 2 2
MIRT718422 CALN1 calneuron 1 2 2
MIRT719460 APBA1 amyloid beta precursor protein binding family A member 1 2 2
MIRT731713 EGFR epidermal growth factor receptor 3 1
MIRT731714 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 3 1
MIRT732779 ZEB2 zinc finger E-box binding homeobox 2 2 0
MIRT732980 GSK3B glycogen synthase kinase 3 beta 3 0
MIRT734466 HDAC3 histone deacetylase 3 2 0
MIRT734880 FOXO3 forkhead box O3 3 0
MIRT735319 SNHG16 small nucleolar RNA host gene 16 2 0
MIRT755706 BNC2 basonuclin 2 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-132 5-aza-2'-deoxycytidine (5-Aza-CdR) + 4-phenylbutyric acid (PBA) NULL NULL Microarray T24 human bladder cancer cells 16766263 2006 up-regulated
miR-132 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 up-regulated
miR-132 Gemcitabine approved 60750 Microarray ovarian cancer 19237188 2009 down-regulated
miR-132 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-132 Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 up-regulated
miR-132 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-132 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-132 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miR-132 Luteolin NULL 5280445 Quantitative real-time PCR PC12 cells 22916239 2012 up-regulated
miR-132 ACTH approved 16132265 Quantitative real-time PCR adrenals and granulosa cells 24205079 2014 up-regulated
miR-132 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-132 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-mir-132 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-mir-132 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-mir-132 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-mir-132 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-132 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-132 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-132-3p (1Z)-2-anilino-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-oxoethanimidoyl cyanide 5466279 NSC683605 resistant
hsa-miR-132-3p (2Z)-2-(tert-butylhydrazinylidene)-N-(3-chloro-1,4-dioxonaphthalen-2-yl)-3-(3,7,12-trioxo-4H-naphtho[2,3-h]quinoxalin-2-yl)propanamide 5479912 NSC649574 resistant
hsa-miR-132-3p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-132-3p (e)-1-(benzenesulfonyl)-3-(2-phenyl-1h-indol-3-yl)prop-2-en-1-one 54613416 NSC749193 sensitive
hsa-miR-132-3p (E)-3-[3,5-bis(trifluoromethyl)phenyl]sulfanyl-1-(4-chlorophenyl)prop-2-en-1-one 6181983 NSC735169 resistant
hsa-miR-132-3p (Z)-3-[5-[3,5-bis(trifluoromethyl)phenyl]furan-2-yl]prop-2-enenitrile 5468615 NSC672868 sensitive
hsa-miR-132-3p (z)-6-(2-(pyridin-2-ylmethylene)hydrazinyl)-9h-purine 60147744 NSC752329 resistant
hsa-miR-132-3p [(5s,8ar,9r)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl] 3-aminobenzoate NSC642276 sensitive
hsa-miR-132-3p [3,4,5-triacetyloxy-6-(3-cyano-6-phenyl-2-sulfanyl-4-thiophen-2-yl-4h-pyridin-1-yl)oxan-2-yl]methyl acetate 381303 NSC667740 sensitive
hsa-miR-132-3p 1-(2-thiazoylazo)-2-naphthol 93572 NSC139021 resistant
hsa-miR-132-3p 1-(4-methoxyphenyl)-3-[(z)-1-[6-[(z)-n-[(4-methoxyphenyl)carbamothioylamino]-c-methylcarbonimidoyl]pyridin-2-yl]ethylideneamino]thiourea 6375828 NSC668486 resistant
hsa-miR-132-3p 1-(6,7-dichloro-1-(4-chlorophenyl)-1h-pyrazolo[3,4-b]quinoxalin-3-yl)-1,2,3,4-butanetetrol 365567 NSC633362 sensitive
hsa-miR-132-3p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-132-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 sensitive
hsa-miR-132-3p 10-nitrosophenanthren-9-ol 95223 NSC48526 sensitive
hsa-miR-132-3p 12-imino-4,10,14,20-tetrazapentacyclo[11.7.0.03,11.04,9.014,19]icosa-1(13),3(11),9,19-tetraen-2-one 46861729 NSC753790 sensitive
hsa-miR-132-3p 15-benzyl-9-pyridin-3-yl-15-azatetracyclo[8.6.1.02,7.014,17]heptadeca-1(16),2,4,6,10(17),11,13-heptaen-8-one 57409953 NSC762458 sensitive
hsa-miR-132-3p 2-((5-methyl-3-isoxazolyl)amino)-4-((5-methyl-3-isoxazolyl)imino)-1(4h)-naphthalenone 373420 NSC649750 sensitive
hsa-miR-132-3p 2-(3-chloropropyloxy)naphthazarin 378771 NSC661941 sensitive
hsa-miR-132-3p 2-(4-methylphenyl)-5-phenyl-1h-[1,2,4]triazino[4,3-a]quinoxaline 399104 NSC709520 resistant
hsa-miR-132-3p 2-(6-benzoyl-1h-benzimidazol-2-yl)-3,4,5,6-tetrachloro-n-(furan-2-yl)benzamide 402231 NSC716122 sensitive
hsa-miR-132-3p 2-(diethylamino)ethyl (E)-3-(4-methoxyphenyl)-2-(3,4,5-trimethoxyphenyl)prop-2-enoate 5388753 NSC638408 sensitive
hsa-miR-132-3p 2-(furan-2-yl)-5-phenyl-1h-pyrazolo[1,5-a]pyrimidin-7-one 342597 NSC379651 sensitive
hsa-miR-132-3p 2-[(e)-[[1-(4-chlorophenyl)-3-methylpyrazolo[3,4-d]pyrimidin-4-yl]hydrazinylidene]methyl]phenol 136040127 NSC753018 resistant
hsa-miR-132-3p 2-[(z)-6-[2-(trifluoromethyl)phenyl]hex-3-en-1,5-diynyl]aniline 24203959 NSC730269 sensitive
hsa-miR-132-3p 2-amino-4-cyclopropyl-6-(4-fluorophenyl)cyclohexa-2,4-diene-1,1,3-tricarbonitrile 400138 NSC711632 sensitive
hsa-miR-132-3p 2-amino-9-chloro-3,5-bis(4-chlorophenyl)pyrimido[4,5-c]quinolin-1-one 16126264 NSC741296 resistant
hsa-miR-132-3p 2-amino-N-[4-chloro-2-(1H-pyrrole-2-carbonyl)phenyl]acetamide 284708 NSC140873 sensitive
hsa-miR-132-3p 2-bromo-1-[6-(2-bromopyridin-1-ium-1-yl)naphthalen-2-yl]pyridin-1-ium;bromide 54608313 NSC129757 resistant
hsa-miR-132-3p 2-methoxy-5h-pyrido[3,2:4,5]pyrrolo[3,2-c]cinnoline 54613488 NSC749296 resistant
hsa-miR-132-3p 2-methylthieno[3,2-f][1]benzothiole-4,8-dione 375901 NSC656238 sensitive
hsa-miR-132-3p 2-nitro-3-phenylspiro[cyclopropane-1,9'-fluorene] 282082 NSC135168 sensitive
hsa-miR-132-3p 2-oxo-n-(pyridin-4-yl)-2-(1-tosyl-1h-indol-3-yl)acetamide 155814544 NSC758357 sensitive
hsa-miR-132-3p 2,3,10,11-tetramethoxy-5,6-dihydroisoquinolino[2,1-b]isoquinolin-8-one 392605 NSC693145 resistant
hsa-miR-132-3p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-132-3p 2,6-bis[1-(3-ethylthioureidoimino)ethyl]pyridine 6393657 NSC668337 resistant
hsa-miR-132-3p 3-(3,5-dibromo-4-methoxyphenyl)-2-(3-pyridinyl)acrylonitrile 5467796 NSC659319 sensitive
hsa-miR-132-3p 3-(3,5-dichlorophenyl)-2-(2-pyridinyl)acrylonitrile 5467799 NSC659323 sensitive
hsa-miR-132-3p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-132-3p 3-[(E)-[(4-nitrophenyl)hydrazinylidene]methyl]-1H-benzo[g]quinoxaline-2,5,10-trione 135436193 NSC713198 sensitive
hsa-miR-132-3p 3-[(Z)-[1-(3,4,5-trimethoxyphenyl)pyrido[3,4-b]indol-3-ylidene]methyl]-1H-indol-2-ol 155808310 NSC761816 sensitive
hsa-miR-132-3p 3-[(Z)-[1-(3,5-dimethoxyphenyl)pyrido[3,4-b]indol-3-ylidene]methyl]-5-methoxy-1H-indol-2-ol 155813091 NSC761832 sensitive
hsa-miR-132-3p 3-[[3-(furan-2-carbonyl)-2-sulfanylideneimidazolidin-1-yl]methylidene]pentane-2,4-dione 24203787 NSC729519 resistant
hsa-miR-132-3p 3-[5-(4-amino-2,6-dibromophenyl)-1,3,4-oxadiazol-2-yl]-1-(1H-benzimidazol-2-yl)propan-1-one 71451481 NSC761980 sensitive
hsa-miR-132-3p 3-[6-(2,5-dioxo-4,4-diphenylimidazolidin-1-yl)hexyl]-5,5-diphenylimidazolidine-2,4-dione 343242 NSC382386 sensitive
hsa-miR-132-3p 3-amino-N-(2-fluorophenyl)-5-oxo-7,8-dihydro-6H-thieno[2,3-b]quinoline-2-carboxamide 1856915 NSC754567 sensitive
hsa-miR-132-3p 4-(4,7-dimethoxy-1,3-benzodioxol-5-yl)-5-(4-methoxyphenyl)-2H-triazole 73334660 NSC763198 sensitive
hsa-miR-132-3p 4-[(13R)-13-hydroxy-13-[(2S,5S)-5-[(2S,5S)-5-[1-hydroxy-13-[(2S)-2-methyl-5-oxo-2H-furan-4-yl]tridecyl]oxolan-2-yl]oxolan-2-yl]tridecyl]-2-methyl-2H-furan-5-one 374064 NSC651320 sensitive
hsa-miR-132-3p 4-[(2Z)-2-[1-amino-3-(methylamino)-1,3-bis(sulfanylidene)propan-2-ylidene]hydrazinyl]-1H-imidazole-5-carboxamide 5466293 NSC684046 resistant
hsa-miR-132-3p 4-[(e)-(9-ethylcarbazol-3-yl)azo]benzonitrile 394667 NSC698269 sensitive
hsa-miR-132-3p 4-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]quinoline 6285127 NSC87197 sensitive
hsa-miR-132-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 sensitive
hsa-miR-132-3p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-132-3p 4-[2-[2-(4-carbamimidoylanilino)ethoxy]ethylamino]benzenecarboximidamide;hydrochloride 24206088 NSC740025 sensitive
hsa-miR-132-3p 4-[4-(diethylamino)benzenecarboximidoyl]-n,n-dimethylaniline;hydrochloride NSC33566 sensitive
hsa-miR-132-3p 4-[4,6-bis(methylsulfanyl)pyrazolo[3,4-d]pyrimidin-1-yl]-7-chloroquinoline 24203467 NSC728188 sensitive
hsa-miR-132-3p 4-methylsulfanyl-N-[(3,4,5-trimethoxyphenyl)methyl]aniline 373808 NSC650772 sensitive
hsa-miR-132-3p 4-methylthio-n-(3,4,5-trimethoxybenzyl)aniline 373808 NSC650771 sensitive
hsa-miR-132-3p 4,5-bis(4-methoxyphenyl)-1h-imidazol-2(5h)-one 231112 NSC26692 sensitive
hsa-miR-132-3p 5-[2-(3-hydroxy-4-methoxyphenyl)ethynyl]-6-(3,4,5-trimethoxyphenyl)pyran-2-one 45028148 NSC741289 sensitive
hsa-miR-132-3p 5-bromo-3h-triazolo[4,5-d]pyrimidin-7-ol 135440019 NSC680827 resistant
hsa-miR-132-3p 5-hydroxy-10-methoxy-1-methylbenzo[g]quinolin-4(1h)-one 406554 NSC724702 sensitive
hsa-miR-132-3p 5-methylphenanthroline 72791 NSC4272 resistant
hsa-miR-132-3p 5,10-dimethoxybenzo[g]quinolin-2(1h)-one 54612875 NSC750104 sensitive
hsa-miR-132-3p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-132-3p 7-[(1-hydroxy-1-phenylpropan-2-yl)amino]quinoline-5,8-dione 386231 NSC677949 sensitive
hsa-miR-132-3p 7-[(3,4-dimethoxyphenyl)methyl]-6-phenyl-4,5-dihydropyrrolo[3,4-g][1,2]benzoxazole 60148271 NSC754077 sensitive
hsa-miR-132-3p 8-azadenosine 251928 NSC72961 resistant
hsa-miR-132-3p 9-methyl-2-[4-(4-phenylpiperazin-1-yl)butyl]-3,4-dihydropyrido[3,4-b]indol-1-one 365677 NSC633530 sensitive
hsa-miR-132-3p Acetonitrile;carbon monoxide;dibromoosmium;triphenylphosphane 498712 NSC634761 resistant
hsa-miR-132-3p Antineoplastic-642316 369949 NSC642316 sensitive
hsa-miR-132-3p B1a8bpf5u8 72574 NSC84167 sensitive
hsa-miR-132-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 sensitive
hsa-miR-132-3p Benzyl 4-[(3,6-dioxocyclohexa-1,4-dien-1-yl)methylamino]benzoate 386492 NSC678636 resistant
hsa-miR-132-3p Bindschedler's green 73516 NSC7811 sensitive
hsa-miR-132-3p Chlorotriethyltin 13820 NSC5283 sensitive
hsa-miR-132-3p Chrome black t 3246023 NSC7223 resistant
hsa-miR-132-3p Cinnoline, 4-nitro-, 1-oxide 100397 NSC294846 resistant
hsa-miR-132-3p Dezaguanine 55710 NSC261726 resistant
hsa-miR-132-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 sensitive
hsa-miR-132-3p Dimethyl 1-[(z)-2-[(z)-1,4-dimethoxy-1,4-dioxobut-2-en-2-yl]sulfanyl-1,2-bis(4-methoxyphenyl)ethenyl]pyrazole-3,4-dicarboxylate 5471659 NSC712735 resistant
hsa-miR-132-3p Erlotinib 176870 NSC718781 approved resistant
hsa-miR-132-3p Ethanol, 2-[4-(2,2':6',2"-terpyridin-4'-yl)phenoxy]- 368990 NSC640499 resistant
hsa-miR-132-3p Ethanone, 1-(2-pyrimidinyl)-, (2-benzoxazolyl)hydrazone 9572051 NSC693639 resistant
hsa-miR-132-3p Ethaverine hydrochloride 5702159 NSC757818 sensitive
hsa-miR-132-3p Fluorene, 9-bromo-2,4,7-trichloro- 248608 NSC65921 sensitive
hsa-miR-132-3p Gardenin b 96539 NSC79093 sensitive
hsa-miR-132-3p Gw693881a 44571452 NSC756316 resistant
hsa-miR-132-3p Hedamycin 98033 NSC70929 sensitive
hsa-miR-132-3p Hymenialdisine 135413546 NSC607173 resistant
hsa-miR-132-3p Ls-94160 135408599 NSC52426 resistant
hsa-miR-132-3p Megxp0_000612 5386961 NSC618932 resistant
hsa-miR-132-3p Methyl (1s,10r)-6-methyl-10-nonyl-7,9,12-triazatricyclo[6.3.1.04,12]dodeca-5,8-diene-5-carboxylate 401693 NSC715423 sensitive
hsa-miR-132-3p Methyl (2e)-2-[(1r,7r,10s,12r)-14-acetamido-7,14-dimethyl-4-oxo-6-azatetracyclo[8.3.1.02,6.07,12]tetradec-2-en-5-ylidene]acetate 5470606 NSC703547 resistant
hsa-miR-132-3p Methyl 2-(4,6-dimethyl-3-oxospiro[1h-indene-2,5'-3,4-dihydropyrazole]-4'-yl)benzoate 386181 NSC677803 sensitive
hsa-miR-132-3p Methyl 2-[[4,6-bis[hydroxy(methyl)amino]-1,3,5-triazin-2-yl]amino]acetate 45029484 NSC746930 resistant
hsa-miR-132-3p Methyl 2-[2-[3-hydroxy-3-(2-methoxy-2-oxo-ethyl)indol-2-yl]-1h-indol-3-yl]acetate 392215 NSC692348 resistant
hsa-miR-132-3p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-132-3p Methyl 6-[[(3S,4aR,6aR,6bS,8R,8aR,12aS,14aR,14bR)-8a-[3-[4-[3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-3-hydroxy-6-methyl-5-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-2-yl]oxy-4,5-dihydroxyoxan-2-yl]oxycarbonyl-8-hydroxy-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3, 385536 NSC676794 sensitive
hsa-miR-132-3p Methyl n-[6-(methoxycarbonylamino)pyren-1-yl]carbamate;methyl n-[8-(methoxycarbonylamino)pyren-1-yl]carbamate NSC33092 sensitive
hsa-miR-132-3p Michler's thione 71045 NSC30656 sensitive
hsa-miR-132-3p Miltefosin c 3599 NSC605583 resistant
hsa-miR-132-3p Mitomycin c,methylamine fr. streptomyces caespitosus 213803 NSC329086 sensitive
hsa-miR-132-3p N'-(4-chlorobenzoyl)-n-[(e)-1-(2-hydroxyphenyl)ethylideneamino]-n'-(4-methylphenyl)propanediamide 135499196 NSC644474 resistant
hsa-miR-132-3p N-(1,3-benzothiazol-2-yl)-2-phenyl-7-(3,4,5-trimethoxyphenyl)pyrazolo[1,5-a]pyrimidine-5-carboxamide 71624130 NSC763635 sensitive
hsa-miR-132-3p N-(2,3-dimethyl-7-nitroquinolin-4-yl)-N',N'-dimethylpropane-1,3-diamine;hydrochloride 372712 NSC648273 sensitive
hsa-miR-132-3p N-(4-aziridinylbutyl)-1,3-diaminopropane 160395 NSC658397 resistant
hsa-miR-132-3p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-132-3p N-[(e)-(2,4-dihydroxyphenyl)methylideneamino]-3-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968269 NSC748262 resistant
hsa-miR-132-3p N-[(E)-(2,4-dihydroxyphenyl)methylideneamino]-8-ethoxy-4-hydroxy-1-oxo-6-phenyl-2H-2,7-naphthyridine-3-carboxamide 135968282 NSC747284 resistant
hsa-miR-132-3p N-[(e)-(5-chloro-2-hydroxyphenyl)methylideneamino]-2-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968273 NSC747459 resistant
hsa-miR-132-3p N-[(e)-[4-(diethylamino)-2-hydroxyphenyl]methylideneamino]-2-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968272 NSC747458 resistant
hsa-miR-132-3p N-[(e)-[4-(diethylamino)-2-hydroxyphenyl]methylideneamino]-4-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968274 NSC747460 resistant
hsa-miR-132-3p N-[(E)-1-(6-methylpyridin-2-yl)ethylideneamino]-3-azabicyclo[3.2.2]nonane-3-carbothioamide 5464837 NSC335789 resistant
hsa-miR-132-3p N-[(Z)-[[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]-[(4-methoxyphenyl)diazenyl]methylidene]amino]benzamide 135493921 NSC681972 sensitive
hsa-miR-132-3p N-[2-(hydrazinecarbonyl)-4-nitrophenyl]adamantane-1-carboxamide 5472393 NSC718359 resistant
hsa-miR-132-3p N-[3-[2-[(7-chloroquinolin-4-yl)amino]ethyl-ethylamino]propyl]-2-[7-(dimethylamino)-2-oxochromen-4-yl]acetamide 49856402 NSC754328 sensitive
hsa-miR-132-3p N-[4-[(2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl)oxy]butyl]-1h-indole-2-carboxamide 20826874 NSC726365 resistant
hsa-miR-132-3p N-[4-[hydroxy(methyl)amino]-6-(propylamino)-1,3,5-triazin-2-yl]-n-methylhydroxylamine 45029482 NSC746928 resistant
hsa-miR-132-3p Naphth[2,3-d]oxazol-9-one, 2-methyl-4-(phenylimino)- 160386 NSC650573 sensitive
hsa-miR-132-3p Naphthalene-1,2-dione, 1,2-dihydro-4-[(3-pyridinyl)amino]- 367787 NSC637729 sensitive
hsa-miR-132-3p Neuro_000310 368991 NSC640500 resistant
hsa-miR-132-3p Pan (van) 6825 NSC5332 resistant
hsa-miR-132-3p Questiomycin a 72725 NSC94945 sensitive
hsa-miR-132-3p Resorufin 69462 NSC12097 sensitive
hsa-miR-132-3p S-(3,5-dioxo-2h-1,2,4-triazin-6-yl) phenazine-1-carbothioate 403975 NSC719923 sensitive
hsa-miR-132-3p Toddalin 5351594 NSC76023 sensitive
hsa-miR-132-3p Tributylgermyl 3-oxo-3-phenyl-propanoate 16683249 NSC653557 sensitive
hsa-miR-132-3p Tributyrin 6050 NSC661583 resistant
hsa-miR-132-3p Tris(1,10-phenanthroline)lanthanum(iii)-trithiocyanate 24202211 NSC632737 resistant
hsa-miR-132-3p Tris(1,10-phenanthroline)neodymium(iii)-trithiocyanate 24202207 NSC632730 resistant
hsa-miR-132-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-132-3p Doxorubicin 31703 NSC123127 approved resistant High Ovarian Cancer cell line (OV19, TOV21G, TOV112D, FUOV1, C13, OV2008, A2780CP, A2780S, IGROV1, T8, OVCAR5, IMCC3, A2008, OVCAR3, SKOV3, IOSER)
hsa-miR-132-3p Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-132-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-132-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-132-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-132-3p 10-Hydroxycamptothecin 97226 NSC107124 resistant High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-miR-132-3p Paroxetine 43815 approved sensitive High Normal lymphoblastoid cell line
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-132-3p Chemotherapy resistant High Osteosarcoma tissue
hsa-miR-132-3p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-132-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-132-3p Gefitinib 123631 NSC715055 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-132-3p Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-132-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-132-3p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (TAMR1)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant Low Gastric Cancer cell line (MKN45, MKN28)
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-132-3p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87MG)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive Low Nasopharyngeal Cancer cell line (CNE2)
hsa-miR-132-3p Doxorubicin 31703 NSC123127 approved resistant Low Breast Cancer tissue and cell line (MCF-7)
hsa-miR-132-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-132-3p Panobinostat 6918837 NSC761190 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-132-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-132-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (200nM)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-132-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-132-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (200nM)
hsa-miR-132-3p Gefitinib 123631 NSC715055 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKVO3ip1, HeyA8)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-132-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) resistant High Metastatic Colorectal Cancer tissue
hsa-miR-132-3p Trastuzumab resistant High Breast Cancer cell line (MDA‐MB‐231, SKBR3, HEK‐293T)
hsa-miR-132-3p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer cell line (MGC-803)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive Low Oral Cancer cell line (CAL-27)
hsa-miR-132-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (MHCC97)
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3ip1, HeyA8)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-132-3p Etoposide 36462 NSC141540 approved sensitive Low Breast Cancer cell line
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-132-3p Antiepileptic Drug sensitive High Pediatric Epilepsy tissue
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-132-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-132-3p Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-miR-132-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-132-3p Fluorouracil 3385 NSC19893 approved resistant cell line (HCT15)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-132-3p Sunitinib 5329102 NSC750690 approved sensitive tissue (CardA)
hsa-miR-132-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-132-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR1)
hsa-miR-132-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-132-3p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-132-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-132-3p Cetuximab resistant tissue (colorectal carcinoma)
hsa-miR-132-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine sensitive cell line (Bats-72)
hsa-miR-132-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission