pre-miRNA Information
pre-miRNA hsa-mir-181a-1   
Genomic Coordinates chr1: 198859044 - 198859153
Synonyms MIR213, MIRN181A1, MIRN213, mir-213, MIR181A1
Description Homo sapiens miR-181a-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-181a-2   
Genomic Coordinates chr9: 124692442 - 124692551
Synonyms MIRN181A, MIRN181A2, MIR181A2, MIR181A2HG
Description Homo sapiens miR-181a-2 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-181a-5p
Sequence 24| AACAUUCAACGCUGUCGGUGAGU |46
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 1 1 - 198859130 29233923 MiREDiBase
A-to-I 2 1 - 198859129 29233923 MiREDiBase
A-to-I 8 1 - 198859123 29233923 MiREDiBase
A-to-I 9 1 - 198859122 29233923 MiREDiBase
A-to-I 21 1 - 198859110 27229138 MiREDiBase
A-to-I 21 9 + 124692500 27229138 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30132665 12 COSMIC
COSN26574811 17 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs749545428 1 dbSNP
rs757530482 3 dbSNP
rs1201117339 8 dbSNP
rs868055902 10 dbSNP
rs779228370 10 dbSNP
rs1406655910 11 dbSNP
rs1249847028 11 dbSNP
rs1409955599 12 dbSNP
rs745991765 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BT9Q0O miR-181a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase HK-2 cell line Real-time polymerase chain reaction
B95MYE miR-181a-5p Predictive Biomarker (PRD) Clinical/Experimental Data Expression High Tumor tissue Immunohistochemical analysis
Gene Information
Gene Symbol PRR4   
Synonyms LPRP, PROL4
Description proline rich 4 (lacrimal)
Transcript NM_007244   
Other Transcripts NM_001098538   
Expression
Putative miRNA Targets on PRR4
3'UTR of PRR4
(miRNA target sites are highlighted)
>PRR4|NM_007244|3'UTR
   1 TCTAGAATTCAGTGGCAGAAAATAAATAAGAAGATAACTTCCTTCAGAAAGCCATGACATTGAAATAATGTGGTCATAAC
  81 TCTTTCTTCAGTATACCAATAAAATATTAATAGCATGCAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ugaGUGGCUGUCGC--AACUUACAa 5'
             || :|||| :|   | ||||| 
Target 5' agcCA-TGACATTGAAAT-AATGTg 3'
50 - 72 101.00 -7.70
2
miRNA  3' ugAGUGGCUGUC-GCAACUUAcaa 5'
            ||| :|:|||    | |||   
Target 5' atTCAGTGGCAGAAAATAAATaag 3'
7 - 30 85.00 -11.61
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20088324 3 COSMIC
COSN28173932 10 COSMIC
COSN30485479 10 COSMIC
COSN20064457 120 COSMIC
COSN30601118 130 COSMIC
COSN10097416 184 COSMIC
COSN5315280 247 COSMIC
COSN8694268 294 COSMIC
COSN19287474 531 COSMIC
COSN4726685 764 COSMIC
COSN21691618 766 COSMIC
COSN19730061 1063 COSMIC
COSN8694266 1094 COSMIC
COSN1141776 1095 COSMIC
COSN5712423 1095 COSMIC
COSN26963929 1106 COSMIC
COSN28187556 1201 COSMIC
COSN30589680 1202 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1299879405 2 dbSNP
rs767645332 3 dbSNP
rs1299026856 18 dbSNP
rs1419391527 18 dbSNP
rs377703018 19 dbSNP
rs77818542 20 dbSNP
rs749269147 21 dbSNP
rs775248403 25 dbSNP
rs769701456 29 dbSNP
rs745659201 33 dbSNP
rs780842218 34 dbSNP
rs926356428 37 dbSNP
rs1287678764 41 dbSNP
rs756884431 47 dbSNP
rs138794458 48 dbSNP
rs1208219016 49 dbSNP
rs957376438 50 dbSNP
rs35791875 52 dbSNP
rs1311800396 57 dbSNP
rs777465787 62 dbSNP
rs541175498 63 dbSNP
rs754461643 67 dbSNP
rs1033055759 70 dbSNP
rs915533182 72 dbSNP
rs552682608 79 dbSNP
rs1419142768 92 dbSNP
rs372491724 94 dbSNP
rs532598877 97 dbSNP
rs1159533708 100 dbSNP
rs903307700 103 dbSNP
rs1347205589 110 dbSNP
rs1275691317 115 dbSNP
rs1464700027 119 dbSNP
rs1302637817 121 dbSNP
rs777807196 131 dbSNP
rs1334362792 143 dbSNP
rs1009176824 146 dbSNP
rs1455104684 154 dbSNP
rs559116573 166 dbSNP
rs956903771 170 dbSNP
rs889010615 179 dbSNP
rs987593598 187 dbSNP
rs1310103340 188 dbSNP
rs1331454384 189 dbSNP
rs1050792310 190 dbSNP
rs953468503 194 dbSNP
rs1484110389 195 dbSNP
rs1196715914 204 dbSNP
rs930288898 211 dbSNP
rs1400365725 217 dbSNP
rs1335547227 232 dbSNP
rs577792070 239 dbSNP
rs576689025 243 dbSNP
rs1179375513 248 dbSNP
rs1036023465 254 dbSNP
rs1410171430 256 dbSNP
rs879521405 260 dbSNP
rs1172804197 273 dbSNP
rs994875971 275 dbSNP
rs1469433935 276 dbSNP
rs1361902128 287 dbSNP
rs755144899 291 dbSNP
rs556612662 292 dbSNP
rs927739166 295 dbSNP
rs1242487463 297 dbSNP
rs1201802604 299 dbSNP
rs1329972573 302 dbSNP
rs1016866914 328 dbSNP
rs1448114038 328 dbSNP
rs55883403 330 dbSNP
rs886963318 332 dbSNP
rs1218349052 333 dbSNP
rs1223503883 334 dbSNP
rs560278501 345 dbSNP
rs1363240573 350 dbSNP
rs950274905 353 dbSNP
rs904985429 354 dbSNP
rs1257150253 355 dbSNP
rs1044790270 357 dbSNP
rs1281691758 366 dbSNP
rs1241469153 367 dbSNP
rs1382624127 370 dbSNP
rs1190866888 372 dbSNP
rs1426106527 381 dbSNP
rs1169023998 382 dbSNP
rs1481513339 382 dbSNP
rs946389865 383 dbSNP
rs916140521 385 dbSNP
rs11054051 387 dbSNP
rs992152400 389 dbSNP
rs914876956 396 dbSNP
rs1173159622 399 dbSNP
rs988425473 401 dbSNP
rs935560483 402 dbSNP
rs1435098829 423 dbSNP
rs912130317 427 dbSNP
rs1347047437 430 dbSNP
rs34763333 437 dbSNP
rs1360456403 438 dbSNP
rs1334382618 439 dbSNP
rs1277347310 447 dbSNP
rs568107249 450 dbSNP
rs749900125 452 dbSNP
rs1033003303 453 dbSNP
rs1216324506 457 dbSNP
rs953521360 458 dbSNP
rs780797279 464 dbSNP
rs977443807 467 dbSNP
rs1247323761 470 dbSNP
rs967442872 472 dbSNP
rs540923246 473 dbSNP
rs780469190 478 dbSNP
rs1384475519 483 dbSNP
rs1008708343 498 dbSNP
rs1263004047 513 dbSNP
rs575002365 517 dbSNP
rs74060696 530 dbSNP
rs1188851007 532 dbSNP
rs1412298078 532 dbSNP
rs963384132 532 dbSNP
rs1238183134 544 dbSNP
rs758630939 548 dbSNP
rs1366833691 550 dbSNP
rs534714789 552 dbSNP
rs1004866093 557 dbSNP
rs1340934533 565 dbSNP
rs561547012 566 dbSNP
rs565595128 573 dbSNP
rs559432625 574 dbSNP
rs906261522 575 dbSNP
rs1292606100 583 dbSNP
rs544512924 588 dbSNP
rs1044801900 589 dbSNP
rs1285552799 590 dbSNP
rs1359178079 592 dbSNP
rs1447749617 595 dbSNP
rs769592576 608 dbSNP
rs1218426096 610 dbSNP
rs757504886 611 dbSNP
rs950206701 612 dbSNP
rs1182940354 615 dbSNP
rs916071950 621 dbSNP
rs1429449802 622 dbSNP
rs1157723792 628 dbSNP
rs1324267237 628 dbSNP
rs1299671479 635 dbSNP
rs191589787 643 dbSNP
rs1331954251 647 dbSNP
rs1358301368 651 dbSNP
rs936220550 653 dbSNP
rs1448753685 658 dbSNP
rs116563392 667 dbSNP
rs912167213 668 dbSNP
rs1051980338 671 dbSNP
rs1308577153 672 dbSNP
rs977391552 673 dbSNP
rs1161586589 680 dbSNP
rs932143150 684 dbSNP
rs1442200347 689 dbSNP
rs1204902122 694 dbSNP
rs1245482243 696 dbSNP
rs1456785423 704 dbSNP
rs754390853 705 dbSNP
rs967390655 707 dbSNP
rs911942991 711 dbSNP
rs1170430362 712 dbSNP
rs1185965105 735 dbSNP
rs987969588 742 dbSNP
rs953525093 749 dbSNP
rs1029243503 750 dbSNP
rs186747740 755 dbSNP
rs1445875161 756 dbSNP
rs983891384 764 dbSNP
rs960065896 765 dbSNP
rs963250490 769 dbSNP
rs1241533167 774 dbSNP
rs529936084 778 dbSNP
rs1273266041 780 dbSNP
rs1014806161 786 dbSNP
rs1004480589 801 dbSNP
rs1224528535 802 dbSNP
rs1265339476 813 dbSNP
rs1290103936 815 dbSNP
rs1316599410 818 dbSNP
rs1198506179 821 dbSNP
rs1250684682 824 dbSNP
rs906192362 826 dbSNP
rs1170137729 831 dbSNP
rs1225328170 834 dbSNP
rs1046112942 837 dbSNP
rs1245792700 840 dbSNP
rs1480537430 843 dbSNP
rs1178333627 850 dbSNP
rs1421139309 853 dbSNP
rs1322805927 856 dbSNP
rs1012401059 857 dbSNP
rs1171297847 863 dbSNP
rs371753238 873 dbSNP
rs1397349148 878 dbSNP
rs1393188874 884 dbSNP
rs1321613102 886 dbSNP
rs1330769918 887 dbSNP
rs1405706138 889 dbSNP
rs1285598104 891 dbSNP
rs894934201 905 dbSNP
rs560988839 909 dbSNP
rs1055959929 913 dbSNP
rs936168538 916 dbSNP
rs1252384888 925 dbSNP
rs926170600 929 dbSNP
rs756885042 932 dbSNP
rs945998541 944 dbSNP
rs540987238 945 dbSNP
rs1490416514 949 dbSNP
rs1400291013 956 dbSNP
rs140937764 959 dbSNP
rs1301109966 963 dbSNP
rs953571253 965 dbSNP
rs922067090 969 dbSNP
rs973180005 982 dbSNP
rs999598811 985 dbSNP
rs890092024 991 dbSNP
rs1169658857 995 dbSNP
rs1364975768 995 dbSNP
rs1425599308 995 dbSNP
rs963199058 998 dbSNP
rs1014753955 1001 dbSNP
rs1052028957 1003 dbSNP
rs1328713766 1007 dbSNP
rs932196842 1018 dbSNP
rs1283157611 1019 dbSNP
rs1425939215 1032 dbSNP
rs1224307109 1035 dbSNP
rs1171617762 1038 dbSNP
rs1205532099 1044 dbSNP
rs1263500538 1052 dbSNP
rs183695248 1054 dbSNP
rs1384758081 1058 dbSNP
rs545467448 1062 dbSNP
rs766996342 1063 dbSNP
rs1445280960 1064 dbSNP
rs1025059010 1066 dbSNP
rs1400543213 1073 dbSNP
rs540414197 1075 dbSNP
rs1300889002 1078 dbSNP
rs1011943785 1079 dbSNP
rs1465403067 1079 dbSNP
rs1391492215 1080 dbSNP
rs983517266 1082 dbSNP
rs1394873166 1084 dbSNP
rs1178215770 1089 dbSNP
rs1463553763 1090 dbSNP
rs894859616 1092 dbSNP
rs1456780482 1093 dbSNP
rs1032113270 1094 dbSNP
rs756441195 1095 dbSNP
rs1247558961 1096 dbSNP
rs1264537141 1105 dbSNP
rs71434160 1106 dbSNP
rs755425084 1106 dbSNP
rs758686111 1106 dbSNP
rs867149853 1106 dbSNP
rs1180445447 1107 dbSNP
rs576588123 1110 dbSNP
rs1472414330 1111 dbSNP
rs1249856072 1112 dbSNP
rs1483163895 1116 dbSNP
rs928626165 1120 dbSNP
rs556711710 1126 dbSNP
rs558275040 1128 dbSNP
rs750457861 1129 dbSNP
rs767224839 1131 dbSNP
rs1219115636 1143 dbSNP
rs1378495901 1145 dbSNP
rs1309163788 1146 dbSNP
rs1310536997 1152 dbSNP
rs761979207 1163 dbSNP
rs1365957005 1164 dbSNP
rs1379638664 1167 dbSNP
rs969301551 1170 dbSNP
rs1407506883 1171 dbSNP
rs1454984288 1179 dbSNP
rs1328700094 1180 dbSNP
rs1402511470 1187 dbSNP
rs151029213 1190 dbSNP
rs1010731367 1193 dbSNP
rs1194728916 1201 dbSNP
rs73048498 1204 dbSNP
rs1031173491 1207 dbSNP
rs999252571 1209 dbSNP
rs1196661183 1214 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Grimson A; Farh KK; Johnston WK; et al.
- Molecular cell, 2007
Mammalian microRNAs (miRNAs) pair to 3'UTRs of mRNAs to direct their posttranscriptional repression. Important for target recognition are approximately 7 nt sites that match the seed region of the miRNA. However, these seed matches are not always sufficient for repression, indicating that other characteristics help specify targeting. By combining computational and experimental approaches, we uncovered five general features of site context that boost site efficacy: AU-rich nucleotide composition near the site, proximity to sites for coexpressed miRNAs (which leads to cooperative action), proximity to residues pairing to miRNA nucleotides 13-16, positioning within the 3'UTR at least 15 nt from the stop codon, and positioning away from the center of long UTRs. A model combining these context determinants quantitatively predicts site performance both for exogenously added miRNAs and for endogenous miRNA-message interactions. Because it predicts site efficacy without recourse to evolutionary conservation, the model also identifies effective nonconserved sites and siRNA off-targets.
LinkOut: [PMID: 17612493]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE27834 Pluripotent stem cells 0.758 3.3e-4 0.779 1.9e-4 16 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.863 1.4e-3 -0.683 2.1e-2 9 Click to see details
GSE42095 Differentiated embryonic stem cells -0.379 3.7e-2 -0.292 8.8e-2 23 Click to see details
GSE19783 ER+ ER+ breast cancer -0.387 4.6e-2 -0.337 7.3e-2 20 Click to see details
GSE38226 Liver fibrosis 0.317 8.1e-2 0.335 6.9e-2 21 Click to see details
GSE14794 Lymphoblastoid cells 0.143 8.9e-2 0.070 2.6e-1 90 Click to see details
GSE26953 Aortic valvular endothelial cells 0.278 9.4e-2 0.300 7.7e-2 24 Click to see details
GSE21032 Prostate cancer -0.129 1.2e-1 -0.116 1.5e-1 83 Click to see details
GSE19350 CNS germ cell tumors 0.334 1.4e-1 0.776 1.5e-3 12 Click to see details
GSE28544 Breast cancer -0.218 1.5e-1 -0.163 2.2e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.21 1.6e-1 0.142 2.5e-1 25 Click to see details
GSE17306 Multiple myeloma -0.143 1.6e-1 -0.218 6.6e-2 49 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.226 1.7e-1 -0.398 4.1e-2 20 Click to see details
GSE21849 B cell lymphoma 0.177 1.8e-1 -0.040 4.2e-1 29 Click to see details
GSE28260 Renal cortex and medulla 0.255 2.0e-1 0.176 2.8e-1 13 Click to see details
GSE21687 Ependynoma primary tumors 0.049 3.5e-1 0.034 3.9e-1 64 Click to see details
GSE19783 ER- ER- breast cancer 0.043 3.5e-1 -0.135 1.2e-1 79 Click to see details
GSE17498 Multiple myeloma 0.056 3.7e-1 0.078 3.2e-1 40 Click to see details
GSE19536 Breast cancer 0.015 4.4e-1 -0.169 4.6e-2 100 Click to see details
GSE32688 Pancreatic cancer -0.027 4.4e-1 0.114 2.7e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.002 5.0e-1 0.153 2.3e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA 0.433 0 0.434 0 59 Click to see details
HNSC -0.411 0 -0.491 0 42 Click to see details
KICH 0.356 0.04 0.322 0.06 25 Click to see details
CESC 0.985 0.06 1.000 0.5 3 Click to see details
PAAD 0.842 0.08 0.800 0.1 4 Click to see details
LUAD 0.393 0.1 0.077 0.41 12 Click to see details
PRAD -0.181 0.1 -0.043 0.38 50 Click to see details
BRCA 0.132 0.12 0.198 0.04 84 Click to see details
STAD 0.204 0.13 0.148 0.21 32 Click to see details
PCPG -0.876 0.16 -0.500 0.33 3 Click to see details
LUSC -0.153 0.18 -0.112 0.25 38 Click to see details
BLCA -0.18 0.24 -0.185 0.23 18 Click to see details
LIHC -0.081 0.29 -0.141 0.17 49 Click to see details
COAD -0.187 0.33 0.000 0.5 8 Click to see details
ESCA 0.098 0.39 0.318 0.17 11 Click to see details
KIRP 0.045 0.4 0.096 0.3 32 Click to see details
KIRC 0.026 0.42 0.031 0.4 68 Click to see details
UCEC 0.041 0.43 -0.028 0.45 19 Click to see details
UCEC 0.041 0.43 -0.028 0.45 19 Click to see details
CHOL 0 0.5 -0.050 0.45 9 Click to see details
CHOL 0 0.5 -0.050 0.45 9 Click to see details
551 hsa-miR-181a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000242 BDNF brain derived neurotrophic factor 1 1
MIRT000243 NLK nemo like kinase 2 1
MIRT000244 GATA6 GATA binding protein 6 3 2
MIRT000245 CDX2 caudal type homeobox 2 2 1
MIRT000698 PLAG1 PLAG1 zinc finger 4 1
MIRT002870 HOXA11 homeobox A11 1 1
MIRT003501 BCL2 BCL2, apoptosis regulator 5 8
MIRT003630 PROX1 prospero homeobox 1 4 1
MIRT004327 KAT2B lysine acetyltransferase 2B 3 1
MIRT004554 CDKN1B cyclin dependent kinase inhibitor 1B 5 3
MIRT005544 ZNF763 zinc finger protein 763 4 1
MIRT005575 DDIT4 DNA damage inducible transcript 4 5 4
MIRT005576 ATM ATM serine/threonine kinase 6 7
MIRT005577 HIPK2 homeodomain interacting protein kinase 2 3 1
MIRT005767 BCL2L11 BCL2 like 11 3 2
MIRT005880 HRAS HRas proto-oncogene, GTPase 3 1
MIRT006166 RNF2 ring finger protein 2 4 1
MIRT006194 RALA RAS like proto-oncogene A 4 2
MIRT006213 SIRT1 sirtuin 1 2 3
MIRT006395 PRAP1 proline rich acidic protein 1 1 1
MIRT006481 DUSP6 dual specificity phosphatase 6 2 1
MIRT006482 PTPN11 protein tyrosine phosphatase, non-receptor type 11 2 1
MIRT006483 DUSP5 dual specificity phosphatase 5 3 2
MIRT006484 PTPN22 protein tyrosine phosphatase, non-receptor type 22 2 1
MIRT006851 FOS Fos proto-oncogene, AP-1 transcription factor subunit 1 1
MIRT006871 MTMR3 myotubularin related protein 3 1 1
MIRT006939 KLF6 Kruppel like factor 6 3 2
MIRT006949 MCL1 MCL1, BCL2 family apoptosis regulator 1 1
MIRT006950 XIAP X-linked inhibitor of apoptosis 1 1
MIRT007058 GPR78 G protein-coupled receptor 78 1 1
MIRT025038 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 1 1
MIRT025039 LRRC17 leucine rich repeat containing 17 1 1
MIRT025040 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 1 1
MIRT025041 CD46 CD46 molecule 1 1
MIRT025042 RASSF6 Ras association domain family member 6 1 1
MIRT025043 FXYD6 FXYD domain containing ion transport regulator 6 1 1
MIRT025044 KCTD3 potassium channel tetramerization domain containing 3 1 1
MIRT025045 TSHR thyroid stimulating hormone receptor 1 1
MIRT025046 ZNF558 zinc finger protein 558 1 1
MIRT025047 C8A complement C8 alpha chain 1 1
MIRT025048 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 1 1
MIRT025049 ZNF426 zinc finger protein 426 1 1
MIRT025050 ESR1 estrogen receptor 1 1 1
MIRT025051 ATF7IP2 activating transcription factor 7 interacting protein 2 1 1
MIRT025052 PRR4 proline rich 4 (lacrimal) 1 1
MIRT025053 TCF21 transcription factor 21 1 1
MIRT025054 PHOX2A paired like homeobox 2a 1 1
MIRT025055 PROSC pyridoxal phosphate binding protein 1 1
MIRT025056 PTPLAD1 3-hydroxyacyl-CoA dehydratase 3 1 1
MIRT025057 GSTM2 glutathione S-transferase mu 2 1 1
MIRT025058 FSIP1 fibrous sheath interacting protein 1 1 1
MIRT025059 KBTBD3 kelch repeat and BTB domain containing 3 1 1
MIRT025060 PTPRZ1 protein tyrosine phosphatase, receptor type Z1 1 1
MIRT025061 WNT3A Wnt family member 3A 1 1
MIRT025062 TUSC1 tumor suppressor candidate 1 1 1
MIRT025063 LRRN3 leucine rich repeat neuronal 3 1 1
MIRT025064 TMEM45A transmembrane protein 45A 1 1
MIRT025065 ARF6 ADP ribosylation factor 6 3 3
MIRT025066 C1orf109 chromosome 1 open reading frame 109 1 1
MIRT025067 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT025068 PLXDC2 plexin domain containing 2 1 1
MIRT025069 NMRK2 nicotinamide riboside kinase 2 1 1
MIRT025070 WNT2 Wnt family member 2 1 1
MIRT025071 ATG10 autophagy related 10 1 1
MIRT025072 PRDX3 peroxiredoxin 3 1 1
MIRT025073 ZNF652 zinc finger protein 652 1 1
MIRT025074 RTEL1-TNFRSF6B RTEL1-TNFRSF6B readthrough (NMD candidate) 1 1
MIRT025075 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 1 1
MIRT025076 PCDHB8 protocadherin beta 8 1 1
MIRT025077 ENAH ENAH, actin regulator 1 1
MIRT025078 ZNF25 zinc finger protein 25 1 1
MIRT025079 TAF6L TATA-box binding protein associated factor 6 like 1 1
MIRT025080 S100A1 S100 calcium binding protein A1 1 1
MIRT025081 PLA2G4C phospholipase A2 group IVC 1 1
MIRT025082 NOL4 nucleolar protein 4 1 1
MIRT025083 SIX6 SIX homeobox 6 1 1
MIRT025084 FKBP10 FK506 binding protein 10 1 1
MIRT025085 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT025086 OR11A1 olfactory receptor family 11 subfamily A member 1 1 1
MIRT025087 INCENP inner centromere protein 2 2
MIRT025088 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT025089 CLUAP1 clusterin associated protein 1 1 1
MIRT025090 LYSMD3 LysM domain containing 3 1 1
MIRT025091 CCDC6 coiled-coil domain containing 6 1 1
MIRT025092 BAG2 BCL2 associated athanogene 2 1 1
MIRT025093 GPR83 G protein-coupled receptor 83 1 1
MIRT025094 PTGS2 prostaglandin-endoperoxide synthase 2 1 1
MIRT025095 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT025096 RLF rearranged L-myc fusion 2 2
MIRT025097 FBXO28 F-box protein 28 1 1
MIRT025098 ZNF350 zinc finger protein 350 1 1
MIRT025099 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 1 1
MIRT025100 RNF34 ring finger protein 34 1 1
MIRT025101 LCLAT1 lysocardiolipin acyltransferase 1 2 4
MIRT025102 KIAA1462 junctional cadherin 5 associated 1 1
MIRT025103 ZNF35 zinc finger protein 35 1 1
MIRT025104 PITPNB phosphatidylinositol transfer protein beta 1 1
MIRT025105 SCD stearoyl-CoA desaturase 2 5
MIRT025106 H3F3B H3 histone family member 3B 1 1
MIRT025107 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT025108 LGALSL galectin like 1 1
MIRT025109 TGIF2 TGFB induced factor homeobox 2 1 1
MIRT025110 MOB1A MOB kinase activator 1A 1 1
MIRT025111 SLC35B4 solute carrier family 35 member B4 1 1
MIRT025112 FAM160A2 family with sequence similarity 160 member A2 1 2
MIRT025113 NUPL1 nucleoporin 58 1 1
MIRT025114 GPRIN3 GPRIN family member 3 1 1
MIRT025115 H1F0 H1 histone family member 0 1 1
MIRT025116 ARHGAP12 Rho GTPase activating protein 12 1 1
MIRT025117 SPRY2 sprouty RTK signaling antagonist 2 1 1
MIRT025118 TGFBR3 transforming growth factor beta receptor 3 1 1
MIRT025119 TMED4 transmembrane p24 trafficking protein 4 1 1
MIRT025120 MAP2K1 mitogen-activated protein kinase kinase 1 5 2
MIRT025121 PUM1 pumilio RNA binding family member 1 1 1
MIRT025122 TRIM2 tripartite motif containing 2 1 1
MIRT025123 FBXO33 F-box protein 33 1 1
MIRT025124 NRP1 neuropilin 1 2 2
MIRT025125 FAM47B family with sequence similarity 47 member B 1 1
MIRT025126 CCNG1 cyclin G1 3 3
MIRT025127 BRMS1L breast cancer metastasis-suppressor 1 like 1 1
MIRT025128 OTUD1 OTU deubiquitinase 1 3 3
MIRT025129 ATP6V0E1 ATPase H+ transporting V0 subunit e1 1 1
MIRT025130 WNT16 Wnt family member 16 1 1
MIRT025131 CST5 cystatin D 1 1
MIRT025132 SH3BGRL SH3 domain binding glutamate rich protein like 1 1
MIRT025133 GPR137B G protein-coupled receptor 137B 1 1
MIRT025134 OFCC1 orofacial cleft 1 candidate 1 1 1
MIRT025135 IQCG IQ motif containing G 3 3
MIRT025136 NKX3-2 NK3 homeobox 2 1 1
MIRT025137 OTX2 orthodenticle homeobox 2 1 1
MIRT025138 ROPN1L rhophilin associated tail protein 1 like 1 1
MIRT025139 TMEM14A transmembrane protein 14A 1 1
MIRT025140 TAF2 TATA-box binding protein associated factor 2 1 1
MIRT025141 IDS iduronate 2-sulfatase 1 1
MIRT025142 FRA10AC1 FRA10A associated CGG repeat 1 1 1
MIRT025143 COL27A1 collagen type XXVII alpha 1 chain 1 1
MIRT025144 EPHA5 EPH receptor A5 1 1
MIRT025145 DCST1 DC-STAMP domain containing 1 1 1
MIRT025146 ZNF562 zinc finger protein 562 1 1
MIRT025147 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT025148 CHL1 cell adhesion molecule L1 like 1 1
MIRT025149 TAAR6 trace amine associated receptor 6 1 1
MIRT025150 SLCO2A1 solute carrier organic anion transporter family member 2A1 1 1
MIRT025152 HMGB2 high mobility group box 2 1 1
MIRT025153 HERC3 HECT and RLD domain containing E3 ubiquitin protein ligase 3 1 1
MIRT025154 BTBD3 BTB domain containing 3 1 1
MIRT025155 SRPK2 SRSF protein kinase 2 1 1
MIRT025156 DNAJC7 DnaJ heat shock protein family (Hsp40) member C7 1 1
MIRT025157 ANKRD1 ankyrin repeat domain 1 1 1
MIRT025158 CFI complement factor I 1 1
MIRT025159 MRPS14 mitochondrial ribosomal protein S14 3 3
MIRT025160 HEY2 hes related family bHLH transcription factor with YRPW motif 2 1 1
MIRT025161 MTMR12 myotubularin related protein 12 1 1
MIRT025162 ACOT12 acyl-CoA thioesterase 12 1 1
MIRT025163 KIAA0101 PCNA clamp associated factor 1 1
MIRT025164 USP28 ubiquitin specific peptidase 28 1 1
MIRT025165 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 1 1
MIRT025166 BPGM bisphosphoglycerate mutase 1 1
MIRT025167 DSCR8 Down syndrome critical region 8 (non-protein coding) 1 1
MIRT025168 UGT3A1 UDP glycosyltransferase family 3 member A1 1 1
MIRT025169 HSD17B3 hydroxysteroid 17-beta dehydrogenase 3 1 1
MIRT025170 GADD45G growth arrest and DNA damage inducible gamma 1 1
MIRT025171 FBXO34 F-box protein 34 1 1
MIRT025172 C1QTNF9 C1q and TNF related 9 1 1
MIRT025173 KLRC4 killer cell lectin like receptor C4 1 1
MIRT025174 MOB3B MOB kinase activator 3B 1 1
MIRT025175 FKBP7 FK506 binding protein 7 1 1
MIRT025176 TBX4 T-box 4 1 1
MIRT025177 TMPRSS11A transmembrane protease, serine 11A 1 1
MIRT025178 SNAI2 snail family transcriptional repressor 2 1 1
MIRT025179 SLC7A11 solute carrier family 7 member 11 1 1
MIRT025180 NUDT12 nudix hydrolase 12 1 1
MIRT025181 COPS2 COP9 signalosome subunit 2 1 1
MIRT025182 ZNF12 zinc finger protein 12 1 1
MIRT025183 PRLR prolactin receptor 1 1
MIRT025184 PLCL2 phospholipase C like 2 1 1
MIRT025185 ZNF594 zinc finger protein 594 1 1
MIRT025186 METAP1 methionyl aminopeptidase 1 1 1
MIRT025187 HSPA13 heat shock protein family A (Hsp70) member 13 1 1
MIRT025188 NR6A1 nuclear receptor subfamily 6 group A member 1 2 4
MIRT025189 YOD1 YOD1 deubiquitinase 1 1
MIRT025190 SLC37A3 solute carrier family 37 member 3 1 1
MIRT025191 FBXO11 F-box protein 11 1 2
MIRT025192 ZNF445 zinc finger protein 445 1 1
MIRT025193 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT025194 ATP8A1 ATPase phospholipid transporting 8A1 1 1
MIRT025195 TMEM64 transmembrane protein 64 1 1
MIRT025196 MOB1B MOB kinase activator 1B 1 1
MIRT025197 GNAI3 G protein subunit alpha i3 1 1
MIRT025198 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT025199 SRSF7 serine and arginine rich splicing factor 7 1 1
MIRT025200 DDX3X DEAD-box helicase 3, X-linked 5 7
MIRT025201 KRAS KRAS proto-oncogene, GTPase 4 2
MIRT025202 LBR lamin B receptor 2 3
MIRT025203 GIGYF1 GRB10 interacting GYF protein 1 2 6
MIRT025204 KLHL42 kelch like family member 42 1 1
MIRT025205 TMEM132B transmembrane protein 132B 1 1
MIRT025206 AFTPH aftiphilin 1 1
MIRT025207 ZNF148 zinc finger protein 148 1 1
MIRT025208 NOTCH2 notch 2 2 2
MIRT025209 NFYB nuclear transcription factor Y subunit beta 1 1
MIRT035538 NOTCH1 notch 1 2 1
MIRT047302 SIK2 salt inducible kinase 2 1 1
MIRT047303 HOOK3 hook microtubule tethering protein 3 1 1
MIRT047304 FAM222B family with sequence similarity 222 member B 1 1
MIRT047305 RPS8 ribosomal protein S8 1 1
MIRT047306 STAG2 stromal antigen 2 1 1
MIRT047307 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 1 1
MIRT047308 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT047309 ZEB2 zinc finger E-box binding homeobox 2 1 1
MIRT047310 MAZ MYC associated zinc finger protein 1 1
MIRT047311 RPL14 ribosomal protein L14 1 1
MIRT047312 KCTD2 potassium channel tetramerization domain containing 2 1 1
MIRT047313 UBA2 ubiquitin like modifier activating enzyme 2 1 1
MIRT047314 DDX27 DEAD-box helicase 27 1 1
MIRT047315 FAT1 FAT atypical cadherin 1 1 1
MIRT047316 HDAC6 histone deacetylase 6 1 1
MIRT047317 TMEM192 transmembrane protein 192 1 1
MIRT047318 LAMA3 laminin subunit alpha 3 1 1
MIRT047319 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT047320 ND2 MTND2 1 1
MIRT047321 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 1 1
MIRT047322 OCA2 OCA2 melanosomal transmembrane protein 1 1
MIRT047323 AP1M1 adaptor related protein complex 1 mu 1 subunit 1 1
MIRT047324 UCHL1 ubiquitin C-terminal hydrolase L1 1 1
MIRT047325 PGD phosphogluconate dehydrogenase 1 1
MIRT047326 ZFP36L2 ZFP36 ring finger protein like 2 1 2
MIRT047327 AKAP12 A-kinase anchoring protein 12 1 1
MIRT047328 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT047329 GANAB glucosidase II alpha subunit 1 1
MIRT047330 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT047331 H2AFY H2A histone family member Y 1 1
MIRT047332 TEAD4 TEA domain transcription factor 4 1 1
MIRT047333 KLHL15 kelch like family member 15 1 2
MIRT047334 PRRC2B proline rich coiled-coil 2B 1 1
MIRT047335 BRCA1 BRCA1, DNA repair associated 1 1
MIRT047336 SOGA2 microtubule crosslinking factor 1 1 1
MIRT047337 KIAA0100 KIAA0100 1 1
MIRT047338 PPP1R9A protein phosphatase 1 regulatory subunit 9A 1 1
MIRT047339 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 1 1
MIRT047340 TNIP1 TNFAIP3 interacting protein 1 1 1
MIRT052976 PBX3 PBX homeobox 3 3 1
MIRT052992 TIMP1 TIMP metallopeptidase inhibitor 1 3 1
MIRT052993 PGR progesterone receptor 3 1
MIRT053039 COL16A1 collagen type XVI alpha 1 chain 3 1
MIRT053196 PPP3CA protein phosphatase 3 catalytic subunit alpha 1 1
MIRT053197 ATG5 autophagy related 5 7 3
MIRT053201 CD4 CD4 molecule 2 1
MIRT053662 TGFBRAP1 transforming growth factor beta receptor associated protein 1 4 2
MIRT053663 TGFBR1 transforming growth factor beta receptor 1 4 2
MIRT053664 TNFRSF11B TNF receptor superfamily member 11b 1 1
MIRT053665 PCDHAC1 protocadherin alpha subfamily C, 1 1 1
MIRT053666 PCDHAC2 protocadherin alpha subfamily C, 2 1 1
MIRT053667 PCDHA1 protocadherin alpha 1 1 1
MIRT053668 PCDHA10 protocadherin alpha 10 1 1
MIRT053669 PCDHA11 protocadherin alpha 11 1 1
MIRT053670 PCDHA12 protocadherin alpha 12 1 1
MIRT053671 PCDHA13 protocadherin alpha 13 1 1
MIRT053672 PCDHA2 protocadherin alpha 2 1 1
MIRT053673 PCDHA3 protocadherin alpha 3 1 1
MIRT053674 PCDHA4 protocadherin alpha 4 1 1
MIRT053675 PCDHA5 protocadherin alpha 5 1 1
MIRT053676 PCDHA6 protocadherin alpha 6 1 1
MIRT053677 PCDHA7 protocadherin alpha 7 1 1
MIRT053678 PCDHA8 protocadherin alpha 8 1 1
MIRT053679 PDGFRA platelet derived growth factor receptor alpha 1 1
MIRT053680 BMP3 bone morphogenetic protein 3 1 1
MIRT053681 SOX5 SRY-box 5 1 1
MIRT053682 MAP3K3 mitogen-activated protein kinase kinase kinase 3 2 2
MIRT053683 TAB3 TGF-beta activated kinase 1 and MAP3K7 binding protein 3 1 1
MIRT053684 PDAP1 PDGFA associated protein 1 1 1
MIRT053685 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1 like 1 1
MIRT053686 BMPR2 bone morphogenetic protein receptor type 2 2 2
MIRT053687 SMAD2 SMAD family member 2 1 1
MIRT053688 MADD MAP kinase activating death domain 1 1
MIRT053689 CDH13 cadherin 13 1 1
MIRT053690 ACAN aggrecan 1 1
MIRT053691 MAP3K10 mitogen-activated protein kinase kinase kinase 10 1 1
MIRT053692 PCDHB6 protocadherin beta 6 1 1
MIRT053693 MAP4K4 mitogen-activated protein kinase kinase kinase kinase 4 1 1
MIRT053694 MMP14 matrix metallopeptidase 14 1 1
MIRT054422 E2F5 E2F transcription factor 5 3 1
MIRT054562 RAP1B RAP1B, member of RAS oncogene family 3 1
MIRT067357 C12ORF29 chromosome 12 open reading frame 29 2 1
MIRT068600 NHLRC3 NHL repeat containing 3 1 1
MIRT071713 CCNK cyclin K 2 3
MIRT074780 PAPD5 poly(A) RNA polymerase D5, non-canonical 1 1
MIRT081041 CARM1 coactivator associated arginine methyltransferase 1 1 1
MIRT081140 LDLR low density lipoprotein receptor 2 2
MIRT086584 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT088064 SEPT2 septin 2 2 4
MIRT097056 TNPO1 transportin 1 2 2
MIRT106868 PTBP3 polypyrimidine tract binding protein 3 2 2
MIRT128339 CUL5 cullin 5 1 1
MIRT131427 PRRC2C proline rich coiled-coil 2C 1 1
MIRT133211 PEBP1 phosphatidylethanolamine binding protein 1 1 1
MIRT134656 PNRC2 proline rich nuclear receptor coactivator 2 1 1
MIRT137301 IPO5 importin 5 1 1
MIRT137700 RCOR1 REST corepressor 1 1 1
MIRT138427 KIF2C kinesin family member 2C 2 3
MIRT143445 CHD9 chromodomain helicase DNA binding protein 9 2 3
MIRT149117 LRRC8D leucine rich repeat containing 8 VRAC subunit D 1 1
MIRT149977 ZNF136 zinc finger protein 136 1 1
MIRT152745 KIF3B kinesin family member 3B 1 1
MIRT153572 TTPAL alpha tocopherol transfer protein like 1 1
MIRT153852 NCOA3 nuclear receptor coactivator 3 1 1
MIRT161695 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT163342 PRKCD protein kinase C delta 5 4
MIRT172788 SLC25A37 solute carrier family 25 member 37 1 1
MIRT172871 CHCHD7 coiled-coil-helix-coiled-coil-helix domain containing 7 1 1
MIRT175455 ZBTB33 zinc finger and BTB domain containing 33 1 1
MIRT182137 ADRBK1 G protein-coupled receptor kinase 2 1 1
MIRT183809 ELK4 ELK4, ETS transcription factor 2 2
MIRT184927 ZNF268 zinc finger protein 268 2 2
MIRT194174 ZFAND6 zinc finger AN1-type containing 6 2 6
MIRT199130 LMAN1 lectin, mannose binding 1 1 1
MIRT199773 MRPL34 mitochondrial ribosomal protein L34 2 2
MIRT202709 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT210750 CHMP2B charged multivesicular body protein 2B 2 2
MIRT231560 DRAM1 DNA damage regulated autophagy modulator 1 1 1
MIRT234620 KIAA0195 transmembrane protein 94 2 2
MIRT234945 ZNF440 zinc finger protein 440 2 4
MIRT234951 ZNF439 zinc finger protein 439 2 2
MIRT237875 WHSC1 nuclear receptor binding SET domain protein 2 2 4
MIRT247903 KIAA1551 KIAA1551 1 1
MIRT252248 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1 1
MIRT253450 FKBP1A FK506 binding protein 1A 2 2
MIRT256742 HIGD2A HIG1 hypoxia inducible domain family member 2A 1 1
MIRT257371 ID4 inhibitor of DNA binding 4, HLH protein 2 2
MIRT273444 DAZAP2 DAZ associated protein 2 1 1
MIRT279875 ZFP36L1 ZFP36 ring finger protein like 1 1 1
MIRT305128 SLC35G2 solute carrier family 35 member G2 2 2
MIRT314550 MTX3 metaxin 3 1 1
MIRT437399 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 4 1
MIRT437649 PHACTR2 phosphatase and actin regulator 2 2 1
MIRT437650 SASH1 SAM and SH3 domain containing 1 2 1
MIRT437651 PHLDA1 pleckstrin homology like domain family A member 1 2 1
MIRT437652 MOSPD1 motile sperm domain containing 1 2 1
MIRT437653 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 1
MIRT437654 UBL3 ubiquitin like 3 2 1
MIRT437655 PHACTR4 phosphatase and actin regulator 4 2 1
MIRT437656 EREG epiregulin 2 1
MIRT437924 TERT telomerase reverse transcriptase 2 1
MIRT437942 RGS5 regulator of G protein signaling 5 3 1
MIRT437969 IFNG interferon gamma 3 1
MIRT438216 AHR aryl hydrocarbon receptor 2 1
MIRT438217 STAT3 signal transducer and activator of transcription 3 2 1
MIRT438437 WIF1 WNT inhibitory factor 1 4 1
MIRT438509 TWIST1 twist family bHLH transcription factor 1 1 1
MIRT438857 MAPK1 mitogen-activated protein kinase 1 4 1
MIRT445123 DCAF4 DDB1 and CUL4 associated factor 4 2 2
MIRT447015 RSF1 remodeling and spacing factor 1 2 2
MIRT451642 FAM96A family with sequence similarity 96 member A 2 2
MIRT467860 SLC25A25 solute carrier family 25 member 25 2 2
MIRT470383 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT477002 FAM73B mitoguardin 2 2 2
MIRT479955 CBX4 chromobox 4 2 6
MIRT480026 CAPRIN2 caprin family member 2 2 4
MIRT498152 FKBP1C FK506 binding protein 1C 2 4
MIRT498526 ZNF83 zinc finger protein 83 2 8
MIRT499144 HSPA1B heat shock protein family A (Hsp70) member 1B 2 8
MIRT499474 ZNF669 zinc finger protein 669 2 8
MIRT500270 ZNF788 zinc finger family member 788 2 6
MIRT500279 ZNF781 zinc finger protein 781 2 6
MIRT500299 ZNF667 zinc finger protein 667 2 8
MIRT500335 ZNF487P zinc finger protein 487 1 3
MIRT502621 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 2 6
MIRT507379 EPS8 epidermal growth factor receptor pathway substrate 8 2 4
MIRT513011 MAN1A2 mannosidase alpha class 1A member 2 2 2
MIRT513569 FKBP14 FK506 binding protein 14 2 2
MIRT519607 ZNF791 zinc finger protein 791 2 6
MIRT519846 ZFP69B ZFP69 zinc finger protein B 2 4
MIRT520651 NPM3 nucleophosmin/nucleoplasmin 3 2 6
MIRT523128 HSP90B1 heat shock protein 90 beta family member 1 2 4
MIRT526145 GJB7 gap junction protein beta 7 2 2
MIRT528359 ZDHHC15 zinc finger DHHC-type containing 15 2 2
MIRT529134 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT532856 ZNF699 zinc finger protein 699 2 2
MIRT535284 PHOX2B paired like homeobox 2b 2 2
MIRT535319 PHC3 polyhomeotic homolog 3 2 3
MIRT536908 HEPHL1 hephaestin like 1 2 2
MIRT539055 ATP8B1 ATPase phospholipid transporting 8B1 2 2
MIRT542777 PPAP2B phospholipid phosphatase 3 2 2
MIRT543609 ZNF844 zinc finger protein 844 2 4
MIRT543636 ZNF780B zinc finger protein 780B 2 2
MIRT543952 NCOA7 nuclear receptor coactivator 7 2 2
MIRT544390 ZNF266 zinc finger protein 266 2 2
MIRT544463 KRBOX4 KRAB box domain containing 4 2 2
MIRT545438 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT546317 TMCC1 transmembrane and coiled-coil domain family 1 2 4
MIRT548177 FOXL1 forkhead box L1 2 4
MIRT551119 ZNF107 zinc finger protein 107 2 2
MIRT554022 SPIRE1 spire type actin nucleation factor 1 2 2
MIRT554674 RNF6 ring finger protein 6 2 4
MIRT555162 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT557276 HMGA2 high mobility group AT-hook 2 2 2
MIRT558550 CSNK1A1 casein kinase 1 alpha 1 2 2
MIRT559453 ARSJ arylsulfatase family member J 2 2
MIRT559797 ZNF415 zinc finger protein 415 2 2
MIRT560747 ZNF616 zinc finger protein 616 2 2
MIRT560844 SUV39H2 suppressor of variegation 3-9 homolog 2 2 2
MIRT562334 FAM3C family with sequence similarity 3 member C 2 2
MIRT562767 ZNF846 zinc finger protein 846 2 2
MIRT564741 ZNF23 zinc finger protein 23 2 2
MIRT565163 TUBB2A tubulin beta 2A class IIa 2 2
MIRT567388 GTPBP3 GTP binding protein 3, mitochondrial 2 2
MIRT568682 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 2 2
MIRT575088 Ddit4 DNA-damage-inducible transcript 4 2 3
MIRT575950 Unc5b unc-5 netrin receptor B 2 4
MIRT611626 SLC35G3 solute carrier family 35 member G3 2 2
MIRT613091 ETS1 ETS proto-oncogene 1, transcription factor 2 4
MIRT614684 UNC5B unc-5 netrin receptor B 2 5
MIRT620870 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT622409 RPS6KA3 ribosomal protein S6 kinase A3 2 2
MIRT624717 AP5M1 adaptor related protein complex 5 mu 1 subunit 2 4
MIRT631079 ZNF829 zinc finger protein 829 2 2
MIRT633493 WDR72 WD repeat domain 72 2 2
MIRT635716 HFM1 HFM1, ATP dependent DNA helicase homolog 2 2
MIRT637039 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT639503 SCN8A sodium voltage-gated channel alpha subunit 8 2 2
MIRT641325 ATXN7 ataxin 7 2 2
MIRT646844 TLDC1 TBC/LysM-associated domain containing 1 2 2
MIRT649738 RBM25 RNA binding motif protein 25 2 2
MIRT651418 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT660606 AP3M2 adaptor related protein complex 3 mu 2 subunit 2 2
MIRT669768 ZNF556 zinc finger protein 556 2 2
MIRT683299 ZNF253 zinc finger protein 253 2 2
MIRT698129 TOPBP1 DNA topoisomerase II binding protein 1 2 2
MIRT698676 TEF TEF, PAR bZIP transcription factor 2 2
MIRT702063 RNMT RNA guanine-7 methyltransferase 2 2
MIRT705938 ADAM17 ADAM metallopeptidase domain 17 2 2
MIRT707909 RSBN1L round spermatid basic protein 1 like 2 2
MIRT708830 KLHL24 kelch like family member 24 2 2
MIRT708958 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT711041 RNF187 ring finger protein 187 2 2
MIRT711103 ZNF597 zinc finger protein 597 2 2
MIRT712563 CENPO centromere protein O 2 2
MIRT713217 FAM13A family with sequence similarity 13 member A 2 2
MIRT714106 RLIM ring finger protein, LIM domain interacting 2 2
MIRT715363 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT716288 LAPTM4B lysosomal protein transmembrane 4 beta 2 2
MIRT720070 ZNF449 zinc finger protein 449 2 2
MIRT722502 PNKD paroxysmal nonkinesigenic dyskinesia 2 2
MIRT725542 EN2 engrailed homeobox 2 2 2
MIRT726025 ZNF664 zinc finger protein 664 1 1
MIRT726057 ZNF121 zinc finger protein 121 1 1
MIRT726088 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT726178 ULK1 unc-51 like autophagy activating kinase 1 1 1
MIRT726218 TUBB tubulin beta class I 1 1
MIRT726225 TSG101 tumor susceptibility 101 1 1
MIRT726256 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT726274 TMF1 TATA element modulatory factor 1 1 1
MIRT726294 TMEM30A transmembrane protein 30A 1 1
MIRT726333 TFRC transferrin receptor 1 1
MIRT726352 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT726364 TBC1D7 TBC1 domain family member 7 1 1
MIRT726375 TBC1D13 TBC1 domain family member 13 1 1
MIRT726418 STX2 syntaxin 2 1 1
MIRT726436 STAG1 stromal antigen 1 1 1
MIRT726441 SSX2IP SSX family member 2 interacting protein 1 1
MIRT726459 SRGN serglycin 1 1
MIRT726474 SORT1 sortilin 1 1 1
MIRT726490 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 1 1
MIRT726518 SLC7A1 solute carrier family 7 member 1 1 1
MIRT726539 SLC38A2 solute carrier family 38 member 2 1 1
MIRT726557 SLC19A2 solute carrier family 19 member 2 1 1
MIRT726566 SLC10A7 solute carrier family 10 member 7 1 1
MIRT726571 SIPA1L1 signal induced proliferation associated 1 like 1 1 1
MIRT726581 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 1
MIRT726709 RP2 RP2, ARL3 GTPase activating protein 1 1
MIRT726743 RHOG ras homolog family member G 1 1
MIRT726747 RGS16 regulator of G protein signaling 16 4 2
MIRT726793 RAN RAN, member RAS oncogene family 1 1
MIRT726822 RAB2B RAB2B, member RAS oncogene family 1 1
MIRT726829 PURB purine rich element binding protein B 1 1
MIRT726971 PGAP1 post-GPI attachment to proteins 1 1 1
MIRT726984 PER2 period circadian clock 2 1 1
MIRT727004 PBRM1 polybromo 1 1 1
MIRT727043 OSBPL3 oxysterol binding protein like 3 1 1
MIRT727078 NMT2 N-myristoyltransferase 2 1 1
MIRT727081 FAM192A family with sequence similarity 192 member A 1 1
MIRT727086 NIN ninein 1 1
MIRT727100 NCAPG non-SMC condensin I complex subunit G 1 1
MIRT727112 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT727132 MTUS1 microtubule associated scaffold protein 1 1 1
MIRT727160 MPP5 membrane palmitoylated protein 5 1 1
MIRT727181 KMT2E lysine methyltransferase 2E 1 1
MIRT727287 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT727291 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT727332 KPNA1 karyopherin subunit alpha 1 1 1
MIRT727374 EFCAB14 EF-hand calcium binding domain 14 1 1
MIRT727382 KIAA0196 WASH complex subunit 5 1 1
MIRT727404 KDM5A lysine demethylase 5A 1 1
MIRT727450 INO80D INO80 complex subunit D 1 1
MIRT727459 IL1A interleukin 1 alpha 1 1
MIRT727494 HIST1H3D histone cluster 1 H3 family member d 1 1
MIRT727507 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT727537 GOT1 glutamic-oxaloacetic transaminase 1 1 1
MIRT727542 GOLGA8B golgin A8 family member B 1 1
MIRT727551 GOLGA1 golgin A1 1 1
MIRT727558 GNS glucosamine (N-acetyl)-6-sulfatase 1 1
MIRT727578 GK5 glycerol kinase 5 (putative) 1 1
MIRT727625 G3BP2 G3BP stress granule assembly factor 2 1 1
MIRT727644 FSD1L fibronectin type III and SPRY domain containing 1 like 1 1
MIRT727705 FAM58A cyclin Q 1 1
MIRT727757 EPS15 epidermal growth factor receptor pathway substrate 15 1 1
MIRT727802 EED embryonic ectoderm development 1 1
MIRT727835 DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 1 1
MIRT727892 DDX52 DExD-box helicase 52 1 1
MIRT727945 CPOX coproporphyrinogen oxidase 1 1
MIRT727964 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT727984 CLCC1 chloride channel CLIC like 1 1 1
MIRT728032 CCL22 C-C motif chemokine ligand 22 1 1
MIRT728039 CCDC88C coiled-coil domain containing 88C 1 1
MIRT728138 ELMSAN1 ELM2 and Myb/SANT domain containing 1 1 1
MIRT728158 GSKIP GSK3B interacting protein 1 1
MIRT728166 C11orf30 EMSY, BRCA2 interacting transcriptional repressor 1 1
MIRT728200 BLOC1S2 biogenesis of lysosomal organelles complex 1 subunit 2 1 1
MIRT728224 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT728256 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 1 1
MIRT728278 ATG2B autophagy related 2B 5 2
MIRT728296 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT728301 ARRDC3 arrestin domain containing 3 1 1
MIRT728304 ARRB2 arrestin beta 2 1 1
MIRT728326 APOL6 apolipoprotein L6 1 1
MIRT728361 ALDH9A1 aldehyde dehydrogenase 9 family member A1 1 1
MIRT728380 AFF4 AF4/FMR2 family member 4 1 1
MIRT728392 ACYP1 acylphosphatase 1 1 1
MIRT731063 CTDSPL CTD small phosphatase like 3 1
MIRT731403 TUSC3 tumor suppressor candidate 3 2 1
MIRT731765 MEG3 maternally expressed 3 (non-protein coding) 3 1
MIRT731852 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 4 1
MIRT731887 GPD1L glycerol-3-phosphate dehydrogenase 1 like 3 1
MIRT732079 PTEN phosphatase and tensin homolog 4 2
MIRT732869 OCLN occludin 2 0
MIRT733131 TFAM transcription factor A, mitochondrial 2 0
MIRT733229 SFRP4 secreted frizzled related protein 4 2 0
MIRT733417 EGFR epidermal growth factor receptor 1 0
MIRT735016 POSTN periostin 1 0
MIRT735017 CDH11 cadherin 11 1 0
MIRT735227 CCND1 cyclin D1 2 0
MIRT735678 CARD11 caspase recruitment domain family member 11 3 0
MIRT736296 AGO4 argonaute 4, RISC catalytic component 2 0
MIRT736297 DNMT3A DNA methyltransferase 3 alpha 2 0
MIRT736560 CBLB Cbl proto-oncogene B 3 0
MIRT736696 CCAT1 colon cancer associated transcript 1 (non-protein coding) 3 0
MIRT755393 CTNNB1 catenin beta 1 3 1
MIRT755446 RUNX1 runt related transcription factor 1 3 1
MIRT756076 PCYOX1 prenylcysteine oxidase 1 3 1
MIRT756199 IL33 interleukin 33 3 1
MIRT756422 HSPA5 heat shock protein family A (Hsp70) member 5 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-181a Amphetamine approved 3007 Quantitative real-time PCR neurons. 22144581 2012 up-regulated
miR-181a Cocaine NULL 446220 Quantitative real-time PCR neurons. 22144581 2012 up-regulated
miR-181a 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 up-regulated
miR-181a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-181a Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 up-regulated
miR-181a Ethanol NULL 702 Quantitative real-time PCR Cerebellar Granule Neurons cells 24554719 2014 up-regulated
miR-181a Cisplatin approved 84093 Microarray human cervical squamous cell 24183997 2014 up-regulated
miR-181a Bufalin NULL 9547215 Quantitative real-time PCR PC-3 prostate cancer cells 24267199 2014 up-regulated
miR-181a Adriamycin Approved 31703 Quantitative real-time PCR low-invasive breast cancer cells 24335172 2014 up-regulated
miR-181a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 up-regulated
miR-181a Doxorubicin approved 31703 Microarray ovarian cancer 19237188 2009 up-regulated
miR-181a Gemcitabine approved 60750 Microarray ovarian cancer 19237188 2009 up-regulated
miR-181a Cocaine NULL 446220 Quantitative real-time PCR HEK293 cells or rat brain parts 19703567 2009 up-regulated
miR-181a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-181a Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-181a Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 up-regulated
miR-181a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-181a 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-181a 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-181a 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-181a Triptolide NULL 107985 Quantitative real-time PCR multiple myeloma (MM) cells 22260163 2012 down-regulated
miR-181a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-181a Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-181a Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-181a Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miR-181a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 down-regulated
miR-181a Lenalidomide approved 216326 Quantitative real-time PCR cytogenetically normal acute myeloid leukemia (CN-AML). 23100311 2012 up-regulated
miR-181a Glucocorticoid NULL NULL Microarray acute lymphoblastic leukemia 19148136 2009 up-regulated
miR-181a Formaldehyde NULL 712 Quantitative real-time PCR Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-181a Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miR-181a-5p Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-181a-5p Oleic acid NULL 445639 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-181a-5p (2r)-2-[[(2s)-2-[[2-[5-acetamido-3-hydroxy-2-(hydroxymethyl)-6-phenylmethoxyoxan-4-yl]oxyacetyl]amino]propanoyl]amino]-n'-[4-[(1-nitroacridin-9-yl)amino]butyl]pentanediamide 393684 NSC696073 resistant
hsa-miR-181a-5p (2r)-2-[[(2s)-2-[2-[5-acetamido-3-hydroxy-2-(hydroxymethyl)-6-phenylmethoxyoxan-4-yl]oxypropanoylamino]propanoyl]amino]-n'-[2-[2-[(1-nitroacridin-9-yl)amino]ethylamino]ethyl]pentanediamide 393686 NSC696075 resistant
hsa-miR-181a-5p (4S,4aS,5aS,6S,12aR)-4-(dimethylamino)-1,6,10,11,12a-pentahydroxy-6-methyl-3,12-dioxo-N-[[(7-oxo-2,6-dihydrotriazolo[4,5-d]pyrimidin-5-yl)amino]methyl]-4,4a,5,5a-tetrahydrotetracene-2-carboxamide 135422275 NSC67586 sensitive
hsa-miR-181a-5p (5R,5aS)-5-[2-(dimethylamino)ethoxy]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5H-[2]benzofuro[5,6-f][1,3]benzodioxol-8-one;hydrochloride 371049 NSC644945 sensitive
hsa-miR-181a-5p (5s,5as)-5-[3-(dimethylamino)propylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 375034 NSC653860 sensitive
hsa-miR-181a-5p (5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-5-(2-piperidin-1-ylethylamino)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 374326 NSC651850 sensitive
hsa-miR-181a-5p (5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-5-(2-piperidin-1-ylethylamino)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374327 NSC651851 sensitive
hsa-miR-181a-5p (5s,8ar,9r)-5-[(3-fluorophenyl)methylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 369915 NSC642282 sensitive
hsa-miR-181a-5p (5Z)-5-[(4-aminophenyl)methylidene]-3-[[4-[[(4Z)-4-[(4-aminophenyl)methylidene]-2-methyl-5-oxoimidazol-1-yl]amino]phthalazin-1-yl]amino]-2-methylimidazol-4-one 6412823 NSC654895 sensitive
hsa-miR-181a-5p (E)-3-[2-(4-methoxyphenyl)imidazo[1,2-a]pyridin-3-yl]-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613570 NSC750335 resistant
hsa-miR-181a-5p (z)-6-(2-(pyridin-2-ylmethylene)hydrazinyl)-9h-purine 60147744 NSC752329 sensitive
hsa-miR-181a-5p .beta.-phenylethyl 2,4,5-trihydroxycinnamate 5933247 NSC666592 sensitive
hsa-miR-181a-5p [(1S,5Z,9S,10R)-12-oxo-11-azabicyclo[8.2.0]dodec-5-en-3,7-diyn-9-yl] acetate 5470109 NSC697685 sensitive
hsa-miR-181a-5p [(6aS,11aR)-2,3,8-trimethoxy-6-methyl-5,11-dioxo-6a,11a-dihydroindeno[1,2-c]isoquinolin-9-yl] methanesulfonate 341886 NSC376254 sensitive
hsa-miR-181a-5p [2-(12,14-dioxo-3,13,23-triazahexacyclo[14.7.0.02,10.04,9.011,15.017,22]tricosa-1,4,6,8,10,15,17,19,21-nonaen-3-yl)-3-hydroxy-6-(hydroxymethyl)-5-methoxyoxan-4-yl] 2,6-diaminohexanoate;hydrochloride 24203046 NSC726578 sensitive
hsa-miR-181a-5p [2-[(2E)-2-[1-(2-hydroxyphenyl)-2-(3-oxo-1H-2-benzofuran-1-yl)ethylidene]hydrazinyl]-2-oxoethyl]-trimethylazanium;chloride 135483962 NSC647614 sensitive
hsa-miR-181a-5p [3-[1,2-bis(propan-2-ylcarbamoyloxymethyl)-6,7-dihydro-5h-pyrrolizin-3-yl]pyridin-1-ium-1-yl]methyl 2-methylpropanoate;iodide 376906 NSC658088 sensitive
hsa-miR-181a-5p [3-[1,2-bis(propan-2-ylcarbamoyloxymethyl)-6,7-dihydro-5h-pyrrolizin-3-yl]pyridin-1-ium-1-yl]methyl cyclopropanecarboxylate;iodide 376916 NSC658093 sensitive
hsa-miR-181a-5p [3-[4-[3-(fluoromethylsulfonyloxy)propanoyl]piperazin-1-yl]-3-oxopropyl] fluoromethanesulfonate 383018 NSC671002 sensitive
hsa-miR-181a-5p [3,4,5-triacetyloxy-6-[3-phenyl-2,4-bis(sulfanylidene)quinazolin-1-yl]oxan-2-yl]methyl acetate 368629 NSC639741 sensitive
hsa-miR-181a-5p [5-(4-bromophenyl)-3-(1,3-diphenylpyrazol-4-yl)-3,4-dihydropyrazol-2-yl]-(4-methoxyphenyl)methanone 155808132 NSC759216 sensitive
hsa-miR-181a-5p 1-(2-chloroethyl)-3-[4-[[4-[[2-chloroethyl(nitroso)carbamoyl]amino]cyclohexyl]methyl]cyclohexyl]-1-nitrosourea 285728 NSC143147 sensitive
hsa-miR-181a-5p 1-[(2r,6r)-6-methylpiperidin-2-yl]nonan-3-ol 370503 NSC643724 resistant
hsa-miR-181a-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 sensitive
hsa-miR-181a-5p 1-[(e)-benzylideneamino]-3-(2-phenylchroman-4-yl)thiourea 9569902 NSC623626 sensitive
hsa-miR-181a-5p 2'-(4-chlorobenzoyl)-1'-(4-chlorophenyl)-1'-hydroxyspiro[1,3-dihydro-1-benzazepine-4,4'-cyclohexane]-2,5-dione 388188 NSC682756 sensitive
hsa-miR-181a-5p 2'-bromo-4'-epi-daunorubicin 6711997 NSC650931 sensitive
hsa-miR-181a-5p 2-(4-bromophenyl)-3h-pyrrolo[2,3-c]isoquinolin-5-ol 386858 NSC679600 sensitive
hsa-miR-181a-5p 2-(4-methylphenyl)-5-(2-naphthyl)-1,3,4-oxadiazole 260000 NSC90810 sensitive
hsa-miR-181a-5p 2-[[1-[2-[5-acetamido-3-hydroxy-2-(hydroxymethyl)-6-phenylmethoxyoxan-4-yl]oxyacetyl]pyrrolidine-2-carbonyl]amino]-N'-[5-[(1-nitroacridin-9-yl)amino]pentyl]pentanediamide 386035 NSC677598 resistant
hsa-miR-181a-5p 2-[2-(dimethylamino)ethyl]-5-nitrobenzo[de]isoquinoline-1,3-dione 327044 NSC300288 sensitive
hsa-miR-181a-5p 2-[4-(acridin-9-ylmethylamino)phenyl]sulfonylguanidine 335981 NSC348894 sensitive
hsa-miR-181a-5p 2-[4-[[1-[3-(3-methoxyanilino)-3-oxopropanoyl]-3-methyl-5-oxo-4H-pyrazol-4-yl]diazenyl]phenyl]sulfonylethyl hydrogen sulfate 385612 NSC676917 sensitive
hsa-miR-181a-5p 2-[4-[[4-(2-benzyl-5-methyl-1,3-thiazol-4-yl)phenyl]iminomethyl]-3-methyl-N-(2-methylsulfonyloxyethyl)anilino]ethyl methanesulfonate 322935 NSC281617 sensitive
hsa-miR-181a-5p 2-[N-(2-methylsulfonyloxyethyl)-4-[[4-[2-(phenoxymethyl)-1,3-thiazol-4-yl]phenyl]iminomethyl]anilino]ethyl methanesulfonate 322463 NSC280074 sensitive
hsa-miR-181a-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-181a-5p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 resistant
hsa-miR-181a-5p 2-methoxy-5h-pyrido[3,2:4,5]pyrrolo[3,2-c]cinnoline 54613488 NSC749296 sensitive
hsa-miR-181a-5p 2-tert-butyl-9-(4-fluorophenyl)iminobenzo[f][1,3]benzoxazol-4-one 362345 NSC626030 resistant
hsa-miR-181a-5p 2,2-dibutyl-1,3,4,2-benzodioxazastannepine 16683165 NSC633498 sensitive
hsa-miR-181a-5p 2,2-dibutyl-7-methyl-1,3,2-benzodioxastannin-4-one 16683125 NSC628560 sensitive
hsa-miR-181a-5p 2,3,10,11-tetramethoxy-5,6-dihydroisoquinolino[2,1-b]isoquinolin-8-one 392605 NSC693145 sensitive
hsa-miR-181a-5p 3-acetoxymethyl-1-methyl-5-methoxyindole-4,7-dione 404937 NSC721515 resistant
hsa-miR-181a-5p 3-phenyl-6-(trifluoromethyl)-n~2~-(3,4,5-trimethoxybenzyl)-2,8-quinoxalinediamine 371581 NSC645931 resistant
hsa-miR-181a-5p 3,4-dihydroxy-2-methyl-3,4-bis(p-tolyl)isoquinolin-1-one 387986 NSC682352 sensitive
hsa-miR-181a-5p 4-(4-methoxyphenyl)-16-methyl-9-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390919 NSC689140 sensitive
hsa-miR-181a-5p 4-(4-methoxyphenyl)-9,16-dimethyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 381740 NSC668600 sensitive
hsa-miR-181a-5p 4-[(5s,8ar)-5-(4-fluoroanilino)-5,5a,6,8,8a,9-hexahydro-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-2,6-dimethoxyphenol 378224 NSC660027 sensitive
hsa-miR-181a-5p 4-[[(4S,9aR)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-1-oxo-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-4-yl]amino]benzonitrile 369961 NSC642328 sensitive
hsa-miR-181a-5p 4-amino-3-chloro-4,5-dihydrocyclopenta[c]thiophen-6-one;hydrochloride 396931 NSC704115 sensitive
hsa-miR-181a-5p 4-appt 5995211 NSC195327 sensitive
hsa-miR-181a-5p 4-aza-2'-phenyl-5.alpha.-cholestano[3,2-c]pyrazole 363170 NSC627771 sensitive
hsa-miR-181a-5p 4-methyl-3-[4-[2-[4-(4-methyl-5-sulfanylidene-1h-1,2,4-triazol-3-yl)phenyl]iminohydrazinyl]phenyl]-1h-1,2,4-triazole-5-thione 5472009 NSC715974 sensitive
hsa-miR-181a-5p 4,10-bis(3-ethynylphenyl)-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-ene-3,5,9,11-tetrone 365547 NSC633253 sensitive
hsa-miR-181a-5p 5-amino-7-[3-(dibutylamino)propylimino]-1,3,6-triphenylpyrimido[4,5-d]pyrimidine-2,4-dithione 45029398 NSC746684 sensitive
hsa-miR-181a-5p 5-bromo-3h-triazolo[4,5-d]pyrimidin-7-ol 135440019 NSC680827 sensitive
hsa-miR-181a-5p 5,6-dimethoxy-9-(methylthio)furo[3',4':4,5]cyclopenta[1,2,3-ij]isoquinoline 363754 NSC628946 sensitive
hsa-miR-181a-5p 6-(2-(4-bromophenyl)hydrazino)-3-methyl-2,4(1h,3h)-pyrimidinedione 385869 NSC677268 sensitive
hsa-miR-181a-5p 6-(3-bromopropyl)-8,9-dimethoxy-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 16098803 NSC734296 sensitive
hsa-miR-181a-5p 6-(3-bromopropyl)-9-methylsulfanyl-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17755847 NSC736200 sensitive
hsa-miR-181a-5p 6-(3-chloropropyl)-9-methoxy-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 16098804 NSC733654 sensitive
hsa-miR-181a-5p 6,7-diacetoxyisoflavan 353129 NSC600289 sensitive
hsa-miR-181a-5p 7-phenyl-5h-pyrazolo[3,4-e][1,2,4]triazin-3-ylamine 6399307 NSC629487 sensitive
hsa-miR-181a-5p 8-[bis(2-chloroethyl)aminomethyl]-7-hydroxy-4-methylchromen-2-one;hydrochloride 24188551 NSC77039 sensitive
hsa-miR-181a-5p 8455ab 1549990 NSC24189 sensitive
hsa-miR-181a-5p 9H-fluoren-9-ylmethyl N-[3-(15,16-dimethoxy-11,19-dioxo-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-20-yl)propyl]carbamate 11215802 NSC729352 sensitive
hsa-miR-181a-5p Acridomide 364442 NSC630703 sensitive
hsa-miR-181a-5p Active compound from cephalodiscus gilchristi 5458859 NSC363979 sensitive
hsa-miR-181a-5p Ametantrone acetate 6917684 NSC287513 sensitive
hsa-miR-181a-5p Antineoplastic-d648114 372647 NSC648114 sensitive
hsa-miR-181a-5p Aquatris(1,3-diphenylpropane-1,3-dionato)neodymium(iii) 24202395 NSC647040 sensitive
hsa-miR-181a-5p Auranofin 6333901 NSC321521 sensitive
hsa-miR-181a-5p Azane;2-chloroacetate;pentane-1,5-diamine;platinum(4+) 24202354 NSC641461 sensitive
hsa-miR-181a-5p Azane;hexane-1,6-diamine;platinum(4+);propanedioate 24202350 NSC641457 sensitive
hsa-miR-181a-5p Azq 42616 NSC182986 sensitive
hsa-miR-181a-5p B723735k022 6399893 NSC614495 sensitive
hsa-miR-181a-5p Bioxiran 11254 NSC629 sensitive
hsa-miR-181a-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-181a-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-181a-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-181a-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-181a-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-181a-5p Chlorazin 9048 NSC3074 resistant
hsa-miR-181a-5p Chlorozotocin 301389 NSC178248 sensitive
hsa-miR-181a-5p Cysteine, s-[(4-aminocarbonyl-1h-imidazol-5-yl)azo]- 135493928 NSC684043 sensitive
hsa-miR-181a-5p Dacarbazine 5351166 NSC45388 approved sensitive
hsa-miR-181a-5p Deoxycamptothecin 266552 NSC105132 sensitive
hsa-miR-181a-5p Echinomycin 3197 NSC526417 sensitive
hsa-miR-181a-5p Epidoxoform 395188 NSC699491 sensitive
hsa-miR-181a-5p Ethyl 2-((4-(6-bromo-2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494008 NSC691085 sensitive
hsa-miR-181a-5p From cephalodiscus gilchristi 6711246 NSC378734 sensitive
hsa-miR-181a-5p Hymenialdisine 135413546 NSC607173 sensitive
hsa-miR-181a-5p Hymenialdisine 135413546 NSC607173 sensitive
hsa-miR-181a-5p Indenoisoquinoline derivative 329826 NSC314622 sensitive
hsa-miR-181a-5p Ls-28225 16683189 NSC643845 sensitive
hsa-miR-181a-5p Methyl 3-[5-[bis(2-chloroethyl)amino]-1H-indol-3-yl]propanoate 257269 NSC85230 sensitive
hsa-miR-181a-5p Mitomycin 281834 NSC134727 sensitive
hsa-miR-181a-5p Mitoxantrone hydrochloride (usan) 5458171 NSC758450 sensitive
hsa-miR-181a-5p N-(2,4-dichlorophenyl)-9-methyl-11-oxo-8-oxa-10-azatricyclo[7.3.1.02,7]trideca-2,4,6-triene-12-carboxamide 399143 NSC709562 sensitive
hsa-miR-181a-5p N-(4-chlorobenzyl)-n'-(2,5-dimethylphenyl)urea 307746 NSC205862 sensitive
hsa-miR-181a-5p N-(4-chlorophenyl)-3-[4-[(3,4-dimethylphenyl)diazenyl]-3,5-dimethylpyrazol-1-yl]-3-oxopropanamide 386801 NSC679509 sensitive
hsa-miR-181a-5p N-[(e)-(2,4-dihydroxyphenyl)methylideneamino]-4-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968275 NSC747461 sensitive
hsa-miR-181a-5p N-[2-(dimethylamino)ethyl]-9-hydroxy-5,6-dimethylpyrido[4,3-b]carbazole-1-carboxamide;hydrochloride 378011 NSC659687 sensitive
hsa-miR-181a-5p N-[2-(hydrazinecarbonyl)-4-nitrophenyl]adamantane-1-carboxamide 5472393 NSC718359 sensitive
hsa-miR-181a-5p N-[bis(aziridin-1-yl)phosphoryl]adamantan-1-amine 64376 NSC166199 sensitive
hsa-miR-181a-5p N,N'-bis[5-[[5-[(3-amino-3-iminopropyl)carbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]butanediamide;hydrochloride 367397 NSC637124 resistant
hsa-miR-181a-5p Naphthalene-1,2-dione, 1,2-dihydro-4-[(3-pyridinyl)amino]- 367787 NSC637729 resistant
hsa-miR-181a-5p Neuro_000310 368991 NSC640500 sensitive
hsa-miR-181a-5p Neuro_000320 370171 NSC642915 sensitive
hsa-miR-181a-5p NSC85701 NSC85701 sensitive
hsa-miR-181a-5p Ovb3-pe NSC623433 resistant
hsa-miR-181a-5p Oxanthrazole 59916 NSC349174 sensitive
hsa-miR-181a-5p P-n,n-di(2-chloroethyl)toluidine 100400 NSC294980 sensitive
hsa-miR-181a-5p Pentamidine isethionate 359323 NSC757400 resistant
hsa-miR-181a-5p Perillol NSC641066 sensitive
hsa-miR-181a-5p Questiomycin a 72725 NSC94945 resistant
hsa-miR-181a-5p S-(3,5-dioxo-2h-1,2,4-triazin-6-yl) phenazine-1-carbothioate 403975 NSC719923 resistant
hsa-miR-181a-5p Salarin c 24867082 NSC750154 resistant
hsa-miR-181a-5p Stl523755 334956 NSC342610 sensitive
hsa-miR-181a-5p Tert-butyl N-[10-(5,11-dioxoindeno[1,2-c]isoquinolin-6-yl)decyl]carbamate 16221318 NSC740270 sensitive
hsa-miR-181a-5p Triethylenemelamine 5799 NSC9706 sensitive
hsa-miR-181a-5p Tris(1,3-diphenylpropane-1,3-dionata)gallium(iii) 11979319 NSC632573 sensitive
hsa-miR-181a-5p Doxorubicin 31703 NSC123127 approved sensitive High Ovarian Cancer cell line (OV19, TOV21G, TOV112D, FUOV1, C13, OV2008, A2780CP, A2780S, IGROV1, T8, OVCAR5, IMCC3, A2008, OVCAR3, SKOV3, IOSER)
hsa-miR-181a-5p Doxorubicin 31703 NSC123127 approved resistant High Ovarian Cancer cell line (OV19, TOV21G, TOV112D, FUOV1, C13, OV2008, A2780CP, A2780S, IGROV1, T8, OVCAR5, IMCC3, A2008, OVCAR3, SKOV3, IOSER)
hsa-miR-181a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-181a-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-181a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, Hep-394, Hep-SWX, Huh-7)
hsa-miR-181a-5p Fludarabine 657237 NSC118218 approved resistant Low Chronic Lymphocytic Leukemia tissue
hsa-miR-181a-5p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-181a-5p Doxorubicin 31703 NSC123127 approved sensitive High Leukemia cell line (K562)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-181a-5p Cytarabine 6253 NSC287459 approved sensitive Low Leukemia cell line (HL60)
hsa-miR-181a-5p Dexamethasone 5743 NSC34521 approved sensitive Low Multiple Myeloma cell line (MM.1S)
hsa-miR-181a-5p Daunorubicin 30323 NSC82151 approved sensitive Low Leukemia cell line (K562)
hsa-miR-181a-5p Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (KM12C)
hsa-miR-181a-5p Fludarabine 657237 NSC118218 approved sensitive Low Chronic Lymphocytic Leukemia tissue
hsa-miR-181a-5p Trichostatin A 444732 sensitive Low Prostate Cancer cell line (C24B)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant Low Adenocarcinoma cell line (KB-3-1, KB-CP.5, KB-CP20)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (PC-9, PC14)
hsa-miR-181a-5p Carboplatin 38904 NSC241240 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-181a-5p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-181a-5p Vincristine 5978 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-181a-5p Mitomycin C 5746 NSC26980 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-181a-5p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-181a-5p Intensive Induction Chemotherapy Based On Cytarabine And Idarubicine resistant High Acute Myeloid Leukemia tissue
hsa-miR-181a-5p Mitoxantrone 4212 NSC279836 approved sensitive Low Breast Cancer tissue and cell line (MCF-7)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant Low Squamous Cell Carcinoma cell line (SCC-11)
hsa-miR-181a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Tongue Squamous Cell Carcinoma cell line (CAL-27)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant Low Cervical Squamous Cell Carcinoma tissue and cell line (SiHa, Me180)
hsa-miR-181a-5p Carboplatin 38904 NSC241240 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-181a-5p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-181a-5p Mitomycin C 5746 NSC26980 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-181a-5p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant Low Ovarian Cancer tissue
hsa-miR-181a-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-181a-5p Chemotherapy resistant High Osteosarcoma tissue
hsa-miR-181a-5p Doxorubicin 31703 NSC123127 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-miR-181a-5p Vincristine 5978 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-181a-5p Docetaxel 148124 NSC628503 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-181a-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-181a-5p Camptothecin 24360 NSC94600 resistant Low Pediatric Acute Lymphoblastic Leukemia cell line (CEM-C1)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-181a-5p Taxane 9548828 resistant High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-181a-5p Taxane 9548828 resistant High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-181a-5p Taxane 9548828 resistant High Prostate Cancer cell line (PC-3, PR200)
hsa-miR-181a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant Low Lung Adenocarcinoma cell line (A549)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant Low Lung Adenocarcinoma cell line (A549)
hsa-miR-181a-5p Paclitaxel 36314 NSC125973 approved resistant Low Lung Adenocarcinoma cell line (A549)
hsa-miR-181a-5p Paclitaxel 36314 NSC125973 approved resistant Low Lung Adenocarcinoma cell line (A549)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-181a-5p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-miR-181a-5p Daunorubicin 30323 NSC82151 approved sensitive Low Acute Myeloid Leukemia cell line (U-937, KG-1)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-miR-181a-5p Vincristine 5978 approved resistant High Colon Cancer cell line (HCT-8)
hsa-miR-181a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-181a-5p Epirubicin/Oxaliplatin/Capecitabine (Eox) sensitive Low Gastric Cancer tissue
hsa-miR-181a-5p Paclitaxel 36314 NSC125973 approved resistant Low Ovarian Cancer tissue and cell line (SKOV3)
hsa-miR-181a-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (HepG2, Hep3B)
hsa-miR-181a-5p Fluorouracil 3385 NSC19893 approved resistant High Esophageal Squamous Cell Carcinoma cell line (EC109, EC9706, TE-1, KYSE-150)
hsa-miR-181a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Esophageal Squamous Cell Carcinoma cell line (EC109, EC9706, TE-1, KYSE-150)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC-7901)
hsa-miR-181a-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-116, SW480)
hsa-miR-181a-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HCT-116, SW480)
hsa-miR-181a-5p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U251, U373, SNB19, U118, LN229)
hsa-miR-181a-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-miR-181a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Nasopharyngeal Cancer tissue
hsa-miR-181a-5p Docetaxel 148124 NSC628503 approved resistant Low Prostate Cancer cell line (C4-2B, DU-145)
hsa-miR-181a-5p Gemcitabine 60750 NSC613327 approved sensitive High Cholangiocarcinoma cell line (CCLP-1, MzChA-1)
hsa-miR-181a-5p Gefitinib 123631 NSC715055 approved resistant Low Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-181a-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-116, LoVo, HT-29, Caco2)
hsa-miR-181a-5p Amg51 11858109 NSC794646 sensitive Low Breast Cancer cell line (MDA-MB-468)
hsa-miR-181a-5p Gsk1070916 46885626 NSC777445 sensitive Low Breast Cancer cell line (MDA-MB-468)
hsa-miR-181a-5p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MDA-MB-468)
hsa-miR-181a-5p Xl765 49867926 sensitive Low Breast Cancer cell line (MDA-MB-468)
hsa-miR-181a-5p Fluorouracil + Oxaliplatin + Irinotecan + Leucovorin resistant Low Pancreatic Ductal Adenocarcinoma tissue
hsa-miR-181a-5p Radioactivity Iodine resistant High Papillary Thyroid Cancer tissue
hsa-miR-181a-5p Palbociclib 5330286 NSC758247 approved resistant High Breast Cancer cell line (T47D)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC-7901, BGC-823)
hsa-miR-181a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-181a-5p Topotecan 60699 NSC609699 approved sensitive High Ovarian Cancer cell line (W1)
hsa-miR-181a-5p Paclitaxel 36314 NSC125973 approved sensitive High Breast Cancer cell line (BCap37)
hsa-miR-181a-5p Carmustine 2578 NSC409962 approved sensitive Low Glioblastoma cell line (U373, U87MG)
hsa-miR-181a-5p Sirolimus 5284616 NSC226080 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-181a-5p Metformin 4091 NSC813213 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-181a-5p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma tissue
hsa-miR-181a-5p Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U251)
hsa-miR-181a-5p Daunorubicin 30323 NSC82151 approved sensitive Low Acute Myeloid Leukemia cell line (SHI-1)
hsa-miR-181a-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer tissue
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant Low Epithelial Ovarian Cancer cell line (HEYA8, OV81.2 CP10, OCI-P5X)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (HS578T, HCC70, MDA-MB-231, MDA-MB-468, BT549)
hsa-miR-181a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (GES1, HGC-27, AGS, HSC-39, FU97)
hsa-miR-181a-5p Vinorelbine 44424639 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-181a-5p Doxorubicin 31703 NSC123127 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-181a-5p Paclitaxel 36314 NSC125973 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-181a-5p Etoposide 36462 NSC141540 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-181a-5p Vincristine 5978 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-181a-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-181a-5p Gemcitabine 60750 NSC613327 approved sensitive Low Pancreatic Cancer cell line (PANC-1, BXPC-3)
hsa-miR-181a-5p Prednisone 5865 NSC10023 approved resistant Low Nephrotic Syndrome tissue
hsa-miR-181a-5p Antiepileptic Drug sensitive High Pediatric Epilepsy tissue
hsa-miR-181a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-181a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-181a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-181a-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (HCT116)
hsa-miR-181a-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-181a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-181a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-181a-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-181a-5p Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-miR-181a-5p Testosterone 6013 NSC9700 approved sensitive cell line (MCF-7)
hsa-miR-181a-5p Testosterone+Anastrozole sensitive cell line (MCF-7)
hsa-miR-181a-5p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-181a-5p Testosterone+Tamoxifen sensitive cell line (MCF-7)
hsa-miR-181a-5p Testosterone+Letrozole sensitive cell line (MCF-7)
hsa-miR-181a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-181a-5p Fluorouracil 3385 NSC19893 approved resistant cell line (HCT15)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-181a-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-181a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-181a-5p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-181a-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-181a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-181a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-miR-181a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR20)
hsa-miR-181a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR200)
hsa-miR-181a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-181a-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-181a-5p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (200 nM)
hsa-miR-181a-5p Bortezomib 387447 NSC681239 approved resistant cell line (CCRF-CEM) (100 nM)
hsa-miR-181a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-181a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (SGC-7901)
hsa-miR-181a-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine sensitive cell line (Bats-72)
hsa-miR-181a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission