miRTarBase - #MIRT025593


—
pre-miRNA Information
pre-miRNA hsa-mir-10a   
Genomic Coordinates chr17: 48579838 - 48579947
Synonyms MIRN10A, hsa-mir-10a, miRNA10A, mir-10a, MIR10A
Description Homo sapiens miR-10a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-10a-5p
Sequence 22| UACCCUGUAGAUCCGAAUUUGUG |44
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30152819 13 COSMIC
COSN30458892 14 COSMIC
COSN23023008 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1333990950 2 dbSNP
rs770328167 3 dbSNP
rs1453440972 5 dbSNP
rs1391955925 7 dbSNP
rs1157653116 8 dbSNP
rs760091682 10 dbSNP
rs1161287321 12 dbSNP
rs369632753 13 dbSNP
rs985848773 14 dbSNP
rs772649724 18 dbSNP
rs529115879 22 dbSNP
rs375865628 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B6HZE2 miR-10a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Muscle Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol IER3IP1   
Synonyms HSPC039, MEDS, PRO2309
Description immediate early response 3 interacting protein 1
Transcript NM_016097   
Expression
Putative miRNA Targets on IER3IP1
3'UTR of IER3IP1
(miRNA target sites are highlighted)		 
>IER3IP1|NM_016097|3'UTR
   1 ATATCAGTGGAGAAAATGGAGACTCAGAAGAGGACATGCCAGTAGAAGTTATTACTTTGGTCATTATTGGAATATTTATA
  81 TCTTAGCTGGCTGACCTTGCACTTGTCAAAAATGTAAAGCTGAAAATAAAACCAGGGTTTCTATTTATCTGTTTTTTTTT
 161 TTAATGTTGCACTTGTAGTTTCATTACAAAAGATCAGATCATGAAAGGCAGTAACTCTCCAGGACTGGAATATCTGATTG
 241 CTCAGTGTTAATAGTAGTTCATGCTGTGGTGAGATTGTTAAAAGGGTGCAAGACTGTTGCTTCTCTTTTTTTAGATATTT
 321 TTCTATCTCTCACTTCTCAGGGATGAAATTCTTTTTCAAAGTTTTGAAGTTCCTTGCAACTTAGCCATGATGTGAGTGGT
 401 TATCCCTAGATAAAATTAAAAGGATTTTTAAAAAGTAATTACTGCACATAAAATGATAAATAGGTAATTTGAATAATTTT
 481 ATTTTAAGCTCCTTGGTTAATTATTTTGTCTATTGTCTCAGCTATAAATTCAAATTTATACATACTATTGAGTATTAATA
 561 TTCTCTGATTTCAGGGAGAATTCTGTCAGTCACATGATGATTATGTTTTTGTTTAACATTCTTTCCATGCACTTGTTATT
 641 TTATTAATTTGCCTGAATGATGAGACCAGACCAGTGTCTACAGATTTTCATTGTCAGAAAAATCTATAAGTCTGCCCTTT
 721 TTACAATGATGATTTAAAAAAAACAACAGCGTAAATATTAGCCCACAAGAGCAGTCCTAAACAATCACAATTACACTGTA
 801 CTACCCAAGAAGACTGTTTATTGTGAAGCATTTACCTTTCAAAAAATCATTACATTTCTATTTCTTGGTGGAGCAGCACA
 881 TTGTGGAGTGTGATTCTTAATTCTTCATTGAGTTTGTCAATAGGACATTGATGCTGGATAGGTTGTCTTTTGTTTTTATG
 961 TCTCAGACCATCTTGTGAGATTGTTTGCCTATCTCATAATACAGTTTTATGCAGAAAGGTTGAAACTATGTAAATGGTTT
1041 TTATGGAAATTATCAGTTACAATATTTTAAAGGTGTAGAATGGCATCTTTGTTTATAGGAGAACATTTGTAAATAAAGTT
1121 AAATTTCTAAGTCAAGCACTTGTTTTTGTACCTTAGTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gugUUUAAGCCUAGAUGUCCCAu 5'
             |:|||   :|: | ||||| 
Target 5' gtgAGATT---GTTAAAAGGGTg 3'
 269 - 288 121.00 -10.30
2 
miRNA  3' guguuuaagccuagauGUCCCAu 5'
                          |||||| 
Target 5' aagctgaaaataaaacCAGGGTt 3'
 117 - 139 120.00 -8.80
3 
miRNA  3' guGUU-UA--AGCCUAGAUGUCCCau 5'
            :|| ||  || ||| | |||||  
Target 5' atTAATATTCTCTGAT-TTCAGGGag 3'
 554 - 578 110.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
433137 58 ClinVar
COSN21649703 12 COSMIC
COSN30474666 76 COSMIC
COSN9335774 96 COSMIC
COSN27310939 151 COSMIC
COSN27430091 152 COSMIC
COSN30528724 156 COSMIC
COSN25751696 166 COSMIC
COSN26713540 169 COSMIC
COSN31532562 262 COSMIC
COSN16029186 317 COSMIC
COSN1744743 717 COSMIC
COSN22624214 930 COSMIC
COSN15216567 1285 COSMIC
COSN9839293 1514 COSMIC
COSN16832680 1961 COSMIC
COSN15123047 1965 COSMIC
COSN8679588 1988 COSMIC
COSN21350562 2303 COSMIC
COSN1744741 3072 COSMIC
COSN15952304 3127 COSMIC
COSN27668568 3204 COSMIC
COSN29594539 3244 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs749007188 1 dbSNP
rs775411047 3 dbSNP
rs1002821141 6 dbSNP
rs916586551 7 dbSNP
rs769564169 8 dbSNP
rs1237026027 10 dbSNP
rs1331889044 11 dbSNP
rs745519452 15 dbSNP
rs1385314520 25 dbSNP
rs780790399 26 dbSNP
rs1298914537 27 dbSNP
rs3087769 31 dbSNP
rs1359876231 32 dbSNP
rs1156596040 33 dbSNP
rs1344963768 34 dbSNP
rs1467451188 35 dbSNP
rs567516352 45 dbSNP
rs778107644 48 dbSNP
rs1375098115 51 dbSNP
rs1435063980 52 dbSNP
rs150586939 58 dbSNP
rs368650486 59 dbSNP
rs1381574211 68 dbSNP
rs948968140 70 dbSNP
rs1296210875 80 dbSNP
rs1259593900 83 dbSNP
rs909333862 84 dbSNP
rs141895318 89 dbSNP
rs1261113222 97 dbSNP
rs571373851 98 dbSNP
rs1212637263 100 dbSNP
rs1282894086 105 dbSNP
rs1485136907 106 dbSNP
rs983524637 113 dbSNP
rs1263064045 114 dbSNP
rs1430333757 116 dbSNP
rs950876202 120 dbSNP
rs1241376295 122 dbSNP
rs759574468 136 dbSNP
rs1394601772 143 dbSNP
rs1454859057 151 dbSNP
rs1030895846 152 dbSNP
rs77002332 152 dbSNP
rs1289322113 163 dbSNP
rs201064144 163 dbSNP
rs1312085649 164 dbSNP
rs1385047558 167 dbSNP
rs1324607573 168 dbSNP
rs1371165844 169 dbSNP
rs565371393 172 dbSNP
rs1236037492 187 dbSNP
rs1415535917 188 dbSNP
rs1306636061 195 dbSNP
rs545480696 198 dbSNP
rs1006552174 211 dbSNP
rs893455661 212 dbSNP
rs1487120923 222 dbSNP
rs1296930771 225 dbSNP
rs939780348 241 dbSNP
rs1252439280 244 dbSNP
rs1468967285 249 dbSNP
rs1195666405 251 dbSNP
rs1399965000 252 dbSNP
rs908280695 253 dbSNP
rs1418244615 260 dbSNP
rs767342552 266 dbSNP
rs955216544 270 dbSNP
rs1459795001 276 dbSNP
rs1164205891 284 dbSNP
rs1394494314 291 dbSNP
rs1442483057 295 dbSNP
rs920904738 297 dbSNP
rs1372198081 301 dbSNP
rs1391658580 303 dbSNP
rs1308134997 315 dbSNP
rs975750548 318 dbSNP
rs761876385 322 dbSNP
rs1319168412 323 dbSNP
rs1160660571 325 dbSNP
rs1335491054 333 dbSNP
rs967970349 337 dbSNP
rs1231292626 341 dbSNP
rs1366413987 343 dbSNP
rs1178052987 353 dbSNP
rs1252399143 358 dbSNP
rs1022109908 359 dbSNP
rs1474106539 363 dbSNP
rs1187068516 364 dbSNP
rs1418516197 376 dbSNP
rs999201038 393 dbSNP
rs1167669796 422 dbSNP
rs902362830 422 dbSNP
rs1259048587 429 dbSNP
rs1046615648 432 dbSNP
rs551870994 433 dbSNP
rs774159168 439 dbSNP
rs1299598213 453 dbSNP
rs1352650050 460 dbSNP
rs956158599 463 dbSNP
rs1293166517 464 dbSNP
rs1356622538 471 dbSNP
rs1235728637 476 dbSNP
rs1270954687 477 dbSNP
rs1205403542 487 dbSNP
rs1307057686 487 dbSNP
rs1253312513 493 dbSNP
rs191595406 494 dbSNP
rs1468019164 496 dbSNP
rs528591728 504 dbSNP
rs1258013670 507 dbSNP
rs1262080519 508 dbSNP
rs1055043415 510 dbSNP
rs1184774088 512 dbSNP
rs1002921901 513 dbSNP
rs907206677 514 dbSNP
rs1428601351 515 dbSNP
rs1172019909 516 dbSNP
rs1487618795 520 dbSNP
rs16949034 525 dbSNP
rs1013609058 547 dbSNP
rs898736483 550 dbSNP
rs1312628554 552 dbSNP
rs1376503846 559 dbSNP
rs1038579934 566 dbSNP
rs35726685 583 dbSNP
rs940166722 586 dbSNP
rs1361292121 587 dbSNP
rs1215265362 590 dbSNP
rs750179892 594 dbSNP
rs764415950 596 dbSNP
rs1233940644 602 dbSNP
rs1336989926 615 dbSNP
rs1345955399 625 dbSNP
rs1276409390 628 dbSNP
rs887232992 630 dbSNP
rs1050838268 632 dbSNP
rs542820094 638 dbSNP
rs929345347 639 dbSNP
rs1213479246 646 dbSNP
rs933727953 646 dbSNP
rs1327599634 652 dbSNP
rs573836137 658 dbSNP
rs775239916 661 dbSNP
rs548996218 663 dbSNP
rs1453408832 664 dbSNP
rs1173951097 666 dbSNP
rs1395998288 670 dbSNP
rs946656404 671 dbSNP
rs1388097720 681 dbSNP
rs1416530537 686 dbSNP
rs976691111 689 dbSNP
rs1461665334 695 dbSNP
rs1432161466 701 dbSNP
rs368065227 703 dbSNP
rs915151422 706 dbSNP
rs1233846318 709 dbSNP
rs200246920 710 dbSNP
rs769608786 716 dbSNP
rs745352280 726 dbSNP
rs200570860 728 dbSNP
rs148825959 734 dbSNP
rs1217936341 736 dbSNP
rs1317418204 736 dbSNP
rs1250591974 743 dbSNP
rs1193812652 744 dbSNP
rs1467642869 744 dbSNP
rs201115046 744 dbSNP
rs1252180284 745 dbSNP
rs1031944995 749 dbSNP
rs529253691 751 dbSNP
rs902225627 755 dbSNP
rs1256232848 759 dbSNP
rs1392300321 771 dbSNP
rs1440284442 774 dbSNP
rs1326777695 782 dbSNP
rs1333015596 788 dbSNP
rs141766622 800 dbSNP
rs1013874799 803 dbSNP
rs187175176 805 dbSNP
rs1230082003 807 dbSNP
rs1055062860 809 dbSNP
rs1333461576 812 dbSNP
rs1272473451 815 dbSNP
rs941904223 821 dbSNP
rs540392061 823 dbSNP
rs1291453373 825 dbSNP
rs1435696379 839 dbSNP
rs1180720129 840 dbSNP
rs1232661614 846 dbSNP
rs1470721190 854 dbSNP
rs887782500 857 dbSNP
rs1231749752 860 dbSNP
rs1165715110 878 dbSNP
rs1393041434 887 dbSNP
rs577928958 889 dbSNP
rs796234358 894 dbSNP
rs1023415511 901 dbSNP
rs564142124 906 dbSNP
rs577258223 913 dbSNP
rs1396303566 914 dbSNP
rs544324119 923 dbSNP
rs148061497 924 dbSNP
rs183382447 926 dbSNP
rs535107293 929 dbSNP
rs976175269 931 dbSNP
rs534373290 939 dbSNP
rs1169536496 941 dbSNP
rs943563117 943 dbSNP
rs1483560652 947 dbSNP
rs1477012191 948 dbSNP
rs1255901651 951 dbSNP
rs779675989 952 dbSNP
rs1017200504 955 dbSNP
rs1189350162 960 dbSNP
rs1394188184 967 dbSNP
rs1194101876 977 dbSNP
rs370755992 981 dbSNP
rs1455736358 983 dbSNP
rs1236633828 989 dbSNP
rs191518284 998 dbSNP
rs14524 1003 dbSNP
rs1051250438 1004 dbSNP
rs1031975679 1018 dbSNP
rs1431906332 1022 dbSNP
rs977759852 1025 dbSNP
rs1199191789 1026 dbSNP
rs966398173 1027 dbSNP
rs933759744 1028 dbSNP
rs1281484450 1030 dbSNP
rs1415319979 1043 dbSNP
rs1314781337 1044 dbSNP
rs1025167120 1050 dbSNP
rs553276861 1062 dbSNP
rs9831 1063 dbSNP
rs1039810735 1075 dbSNP
rs946385183 1077 dbSNP
rs1372694396 1079 dbSNP
rs1278624260 1080 dbSNP
rs1277449320 1085 dbSNP
rs1201466815 1094 dbSNP
rs778156562 1095 dbSNP
rs1441065964 1100 dbSNP
rs1445313327 1104 dbSNP
rs1335783465 1109 dbSNP
rs1390920013 1124 dbSNP
rs571532485 1125 dbSNP
rs935221589 1130 dbSNP
rs887730102 1135 dbSNP
rs866099757 1137 dbSNP
rs1304471253 1151 dbSNP
rs1382742741 1154 dbSNP
rs115994926 1157 dbSNP
rs1174008868 1160 dbSNP
rs1366818044 1168 dbSNP
rs879613514 1169 dbSNP
rs981952550 1170 dbSNP
rs993929957 1179 dbSNP
rs1436402299 1184 dbSNP
rs901831163 1187 dbSNP
rs1040871867 1189 dbSNP
rs2251948 1192 dbSNP
rs569156756 1198 dbSNP
rs1248720682 1199 dbSNP
rs1234610477 1203 dbSNP
rs1466314859 1210 dbSNP
rs991942883 1214 dbSNP
rs1252637980 1216 dbSNP
rs1485621734 1218 dbSNP
rs1258882445 1221 dbSNP
rs962710945 1229 dbSNP
rs1433519815 1238 dbSNP
rs936161868 1239 dbSNP
rs1351910765 1248 dbSNP
rs763445080 1252 dbSNP
rs1159077218 1255 dbSNP
rs1390126259 1258 dbSNP
rs924902521 1261 dbSNP
rs1016915847 1268 dbSNP
rs1284033828 1268 dbSNP
rs1222792219 1269 dbSNP
rs1324755733 1270 dbSNP
rs1388201620 1284 dbSNP
rs977682477 1284 dbSNP
rs1280773546 1285 dbSNP
rs1334428706 1287 dbSNP
rs1412438866 1290 dbSNP
rs1269340266 1302 dbSNP
rs966805981 1307 dbSNP
rs1211940187 1310 dbSNP
rs1313371571 1311 dbSNP
rs1272673794 1314 dbSNP
rs1488919673 1317 dbSNP
rs1193207440 1318 dbSNP
rs368986839 1330 dbSNP
rs1416569696 1333 dbSNP
rs1343160318 1342 dbSNP
rs1182750937 1355 dbSNP
rs1004487452 1364 dbSNP
rs866728647 1370 dbSNP
rs1459846382 1376 dbSNP
rs575630048 1377 dbSNP
rs951592060 1381 dbSNP
rs1030272769 1385 dbSNP
rs998356560 1396 dbSNP
rs899621898 1397 dbSNP
rs1394715181 1401 dbSNP
rs1033423220 1402 dbSNP
rs1289484337 1413 dbSNP
rs1352840817 1417 dbSNP
rs72907280 1418 dbSNP
rs1474942649 1427 dbSNP
rs73954242 1432 dbSNP
rs1026265328 1434 dbSNP
rs1249854085 1442 dbSNP
rs1480163549 1445 dbSNP
rs1190634583 1461 dbSNP
rs1487601382 1465 dbSNP
rs893488196 1470 dbSNP
rs1253769175 1477 dbSNP
rs374334728 1478 dbSNP
rs531243129 1478 dbSNP
rs560457892 1489 dbSNP
rs1187218515 1492 dbSNP
rs138854761 1496 dbSNP
rs1413804468 1504 dbSNP
rs533139559 1507 dbSNP
rs564340849 1513 dbSNP
rs1167822477 1518 dbSNP
rs1217028356 1519 dbSNP
rs1353595658 1520 dbSNP
rs543964145 1521 dbSNP
rs1372861373 1530 dbSNP
rs1285961714 1537 dbSNP
rs927892801 1538 dbSNP
rs901857901 1547 dbSNP
rs1379922063 1551 dbSNP
rs1046696576 1552 dbSNP
rs947914852 1556 dbSNP
rs1230130584 1561 dbSNP
rs1293571360 1562 dbSNP
rs1333467026 1570 dbSNP
rs1293391265 1583 dbSNP
rs916364980 1585 dbSNP
rs187035292 1589 dbSNP
rs1276506785 1592 dbSNP
rs1484570711 1593 dbSNP
rs145080285 1594 dbSNP
rs1040334670 1614 dbSNP
rs183744377 1623 dbSNP
rs1184229597 1624 dbSNP
rs1418235285 1625 dbSNP
rs1359868933 1637 dbSNP
rs755250182 1642 dbSNP
rs1392347370 1648 dbSNP
rs1433268078 1649 dbSNP
rs909908274 1654 dbSNP
rs1175923512 1657 dbSNP
rs1360217767 1662 dbSNP
rs72907278 1662 dbSNP
rs1431261348 1663 dbSNP
rs1364632957 1670 dbSNP
rs1436004800 1681 dbSNP
rs951643954 1685 dbSNP
rs889233376 1691 dbSNP
rs572527492 1693 dbSNP
rs1313863734 1697 dbSNP
rs1213631353 1704 dbSNP
rs1240939786 1706 dbSNP
rs554020327 1708 dbSNP
rs964254068 1711 dbSNP
rs1250783108 1712 dbSNP
rs78989818 1718 dbSNP
rs924768222 1730 dbSNP
rs1395234825 1733 dbSNP
rs1426383470 1752 dbSNP
rs1018831749 1759 dbSNP
rs1010631520 1774 dbSNP
rs1477125454 1775 dbSNP
rs766414280 1783 dbSNP
rs1157562674 1794 dbSNP
rs1387926326 1801 dbSNP
rs1457857339 1810 dbSNP
rs893542113 1813 dbSNP
rs1322764596 1818 dbSNP
rs1369013156 1820 dbSNP
rs1436095717 1821 dbSNP
rs1275209275 1823 dbSNP
rs1369551691 1825 dbSNP
rs1419488004 1829 dbSNP
rs1221941864 1830 dbSNP
rs1267448471 1832 dbSNP
rs1329188678 1836 dbSNP
rs1210020907 1839 dbSNP
rs1052081937 1843 dbSNP
rs1467741356 1847 dbSNP
rs1199210406 1849 dbSNP
rs760683794 1852 dbSNP
rs551818496 1853 dbSNP
rs1479217250 1860 dbSNP
rs999142694 1862 dbSNP
rs534252603 1863 dbSNP
rs1476572066 1867 dbSNP
rs1245368662 1870 dbSNP
rs1473221781 1876 dbSNP
rs1046317453 1886 dbSNP
rs947935338 1891 dbSNP
rs1392387596 1893 dbSNP
rs751461679 1894 dbSNP
rs917583706 1901 dbSNP
rs747708472 1903 dbSNP
rs916434788 1915 dbSNP
rs1351387826 1919 dbSNP
rs764154266 1927 dbSNP
rs959027173 1928 dbSNP
rs141344002 1934 dbSNP
rs1037522239 1937 dbSNP
rs1467754532 1937 dbSNP
rs1290833670 1946 dbSNP
rs776311938 1953 dbSNP
rs373431839 1955 dbSNP
rs1355119538 1957 dbSNP
rs796510801 1957 dbSNP
rs1210049617 1961 dbSNP
rs984526452 1973 dbSNP
rs951873653 1974 dbSNP
rs941455242 1991 dbSNP
rs1273261502 2002 dbSNP
rs1251570638 2003 dbSNP
rs1238409574 2004 dbSNP
rs1483633098 2007 dbSNP
rs909960600 2017 dbSNP
rs1184970389 2021 dbSNP
rs538218517 2023 dbSNP
rs982820228 2023 dbSNP
rs1472540229 2029 dbSNP
rs1305674689 2038 dbSNP
rs1026122973 2039 dbSNP
rs1416182537 2040 dbSNP
rs1408456634 2056 dbSNP
rs1307119480 2065 dbSNP
rs1294823490 2066 dbSNP
rs1215122274 2067 dbSNP
rs993824851 2071 dbSNP
rs1363756861 2074 dbSNP
rs1300999952 2080 dbSNP
rs1440362826 2086 dbSNP
rs75109577 2091 dbSNP
rs1327980701 2092 dbSNP
rs1227226235 2095 dbSNP
rs1274280003 2097 dbSNP
rs775477265 2099 dbSNP
rs1207898602 2100 dbSNP
rs922563255 2103 dbSNP
rs190925575 2107 dbSNP
rs569296287 2116 dbSNP
rs964623587 2119 dbSNP
rs1018471818 2120 dbSNP
rs989597726 2124 dbSNP
rs957820733 2125 dbSNP
rs769559892 2127 dbSNP
rs1390546025 2129 dbSNP
rs999197569 2135 dbSNP
rs1393582390 2139 dbSNP
rs889095032 2145 dbSNP
rs906211235 2149 dbSNP
rs1396557400 2153 dbSNP
rs1335550361 2157 dbSNP
rs1193471207 2167 dbSNP
rs759331952 2168 dbSNP
rs746503639 2171 dbSNP
rs1343287945 2176 dbSNP
rs1231024912 2181 dbSNP
rs1254655910 2182 dbSNP
rs186422169 2192 dbSNP
rs1201536070 2198 dbSNP
rs1194930353 2199 dbSNP
rs950258486 2199 dbSNP
rs1037574164 2210 dbSNP
rs1479350926 2216 dbSNP
rs941840485 2218 dbSNP
rs896111740 2230 dbSNP
rs1451594936 2236 dbSNP
rs1196420184 2240 dbSNP
rs533521317 2241 dbSNP
rs1376867957 2249 dbSNP
rs1466423669 2256 dbSNP
rs1047188790 2257 dbSNP
rs776157204 2258 dbSNP
rs1456290907 2260 dbSNP
rs1320683712 2262 dbSNP
rs1366860386 2273 dbSNP
rs930025107 2274 dbSNP
rs1277920741 2279 dbSNP
rs922648739 2293 dbSNP
rs143296256 2299 dbSNP
rs1234588042 2300 dbSNP
rs1371960878 2306 dbSNP
rs1305850950 2316 dbSNP
rs977141753 2328 dbSNP
rs2635042 2334 dbSNP
rs1372624543 2335 dbSNP
rs746523587 2344 dbSNP
rs1208288967 2348 dbSNP
rs1298821578 2356 dbSNP
rs1433612919 2360 dbSNP
rs180826679 2369 dbSNP
rs546901417 2370 dbSNP
rs1409615622 2383 dbSNP
rs1472239261 2393 dbSNP
rs989650042 2395 dbSNP
rs569954638 2402 dbSNP
rs1374232413 2406 dbSNP
rs188261420 2412 dbSNP
rs1292646681 2420 dbSNP
rs1390437978 2423 dbSNP
rs1387749505 2432 dbSNP
rs1303903568 2435 dbSNP
rs1349117968 2439 dbSNP
rs748497406 2446 dbSNP
rs111626153 2454 dbSNP
rs556222050 2465 dbSNP
rs970864838 2467 dbSNP
rs779315474 2474 dbSNP
rs1242861519 2485 dbSNP
rs1397310329 2492 dbSNP
rs1265131281 2493 dbSNP
rs1177729492 2494 dbSNP
rs1416956870 2495 dbSNP
rs1211367007 2496 dbSNP
rs1249131972 2509 dbSNP
rs1012319113 2511 dbSNP
rs1482651925 2524 dbSNP
rs1177349633 2527 dbSNP
rs1413517943 2529 dbSNP
rs1163595967 2540 dbSNP
rs966268389 2540 dbSNP
rs71162834 2541 dbSNP
rs773079882 2541 dbSNP
rs895102855 2543 dbSNP
rs1459142066 2545 dbSNP
rs1016192122 2551 dbSNP
rs985996273 2552 dbSNP
rs1006109978 2555 dbSNP
rs1255369379 2555 dbSNP
rs866468154 2566 dbSNP
rs150456364 2568 dbSNP
rs1352384672 2575 dbSNP
rs530633438 2576 dbSNP
rs930100957 2578 dbSNP
rs1316620278 2579 dbSNP
rs1322498871 2580 dbSNP
rs1032950247 2587 dbSNP
rs1000245989 2589 dbSNP
rs139408820 2590 dbSNP
rs1205760832 2592 dbSNP
rs1253940922 2610 dbSNP
rs1482254410 2613 dbSNP
rs112101574 2624 dbSNP
rs1020787768 2630 dbSNP
rs1014450221 2638 dbSNP
rs1166398092 2641 dbSNP
rs1388689150 2642 dbSNP
rs1312766996 2645 dbSNP
rs1415965316 2661 dbSNP
rs543272974 2671 dbSNP
rs1429563997 2681 dbSNP
rs1041089166 2684 dbSNP
rs1446484588 2685 dbSNP
rs942696347 2692 dbSNP
rs1056064888 2693 dbSNP
rs911185070 2693 dbSNP
rs937553396 2697 dbSNP
rs541552329 2702 dbSNP
rs1451174391 2704 dbSNP
rs577519249 2707 dbSNP
rs1159168286 2708 dbSNP
rs56090313 2712 dbSNP
rs1415050863 2713 dbSNP
rs919053125 2714 dbSNP
rs1157543530 2722 dbSNP
rs1209337809 2723 dbSNP
rs1256067258 2725 dbSNP
rs1483978788 2733 dbSNP
rs55862199 2734 dbSNP
rs60726022 2735 dbSNP
rs181426566 2736 dbSNP
rs970537953 2740 dbSNP
rs572025981 2744 dbSNP
rs986027547 2745 dbSNP
rs953264421 2747 dbSNP
rs1413265696 2748 dbSNP
rs1176052866 2755 dbSNP
rs1359793448 2756 dbSNP
rs925866488 2758 dbSNP
rs1318656044 2762 dbSNP
rs1364667472 2762 dbSNP
rs1271647578 2763 dbSNP
rs1436102892 2763 dbSNP
rs1203219742 2765 dbSNP
rs75934126 2767 dbSNP
rs1261568315 2769 dbSNP
rs1301952713 2771 dbSNP
rs879765370 2771 dbSNP
rs2635043 2779 dbSNP
rs1292765128 2783 dbSNP
rs1244183759 2784 dbSNP
rs1191093899 2785 dbSNP
rs1234368082 2785 dbSNP
rs1426439492 2786 dbSNP
rs1357988237 2794 dbSNP
rs1293864613 2798 dbSNP
rs1382062450 2799 dbSNP
rs1386171975 2802 dbSNP
rs1015910366 2804 dbSNP
rs1289036811 2806 dbSNP
rs1458500237 2808 dbSNP
rs1320596964 2812 dbSNP
rs1391563867 2812 dbSNP
rs1457960752 2812 dbSNP
rs1435546788 2813 dbSNP
rs1006163643 2815 dbSNP
rs1347265079 2821 dbSNP
rs574246536 2825 dbSNP
rs950596396 2830 dbSNP
rs1026182386 2831 dbSNP
rs1370168310 2834 dbSNP
rs1225094105 2843 dbSNP
rs1287351327 2848 dbSNP
rs1190715302 2864 dbSNP
rs575770477 2865 dbSNP
rs555879418 2868 dbSNP
rs1247671208 2873 dbSNP
rs535990868 2880 dbSNP
rs1210764408 2888 dbSNP
rs1041531691 2891 dbSNP
rs1411314322 2893 dbSNP
rs1467316453 2895 dbSNP
rs1272623962 2899 dbSNP
rs1214461291 2902 dbSNP
rs763349841 2906 dbSNP
rs1472987047 2908 dbSNP
rs1160477887 2909 dbSNP
rs888734781 2913 dbSNP
rs1172189022 2915 dbSNP
rs1048675069 2916 dbSNP
rs1165140340 2924 dbSNP
rs994536525 2925 dbSNP
rs1327332495 2942 dbSNP
rs1006945327 2949 dbSNP
rs72907274 2950 dbSNP
rs1036123614 2951 dbSNP
rs752539844 2960 dbSNP
rs151329464 2963 dbSNP
rs911730297 2964 dbSNP
rs539850250 2970 dbSNP
rs1050256609 2974 dbSNP
rs1362112519 2980 dbSNP
rs1203603650 2985 dbSNP
rs72907271 2986 dbSNP
rs1483683964 3002 dbSNP
rs1184018373 3003 dbSNP
rs1235816716 3007 dbSNP
rs924188957 3009 dbSNP
rs1042601523 3016 dbSNP
rs1386838854 3019 dbSNP
rs1427629872 3021 dbSNP
rs949585727 3033 dbSNP
rs145009093 3035 dbSNP
rs918057998 3036 dbSNP
rs1339434390 3037 dbSNP
rs1448280994 3038 dbSNP
rs990991592 3044 dbSNP
rs201570437 3046 dbSNP
rs959089585 3054 dbSNP
rs1373369361 3059 dbSNP
rs1190351436 3065 dbSNP
rs1340602939 3066 dbSNP
rs1198079416 3069 dbSNP
rs1276576816 3069 dbSNP
rs1441969891 3072 dbSNP
rs1184412221 3076 dbSNP
rs16948987 3080 dbSNP
rs1447914710 3083 dbSNP
rs1187635367 3092 dbSNP
rs776298116 3093 dbSNP
rs1252662590 3099 dbSNP
rs568195879 3104 dbSNP
rs1194306730 3116 dbSNP
rs189869169 3117 dbSNP
rs1400842602 3122 dbSNP
rs1414583872 3122 dbSNP
rs1338165551 3124 dbSNP
rs1385920625 3129 dbSNP
rs913201606 3143 dbSNP
rs1453350834 3144 dbSNP
rs1327450839 3145 dbSNP
rs1230235874 3153 dbSNP
rs984444679 3156 dbSNP
rs528217217 3157 dbSNP
rs1344966583 3162 dbSNP
rs960366759 3164 dbSNP
rs141158432 3171 dbSNP
rs1208420076 3175 dbSNP
rs185304828 3176 dbSNP
rs531521119 3189 dbSNP
rs776365929 3190 dbSNP
rs193025000 3195 dbSNP
rs1480733716 3198 dbSNP
rs189439214 3208 dbSNP
rs185114490 3215 dbSNP
rs551466712 3218 dbSNP
rs544609184 3223 dbSNP
rs1320873975 3238 dbSNP
rs1441212038 3239 dbSNP
rs966282930 3245 dbSNP
rs1017413385 3247 dbSNP
rs1322011853 3250 dbSNP
rs1006953076 3252 dbSNP
rs1330972481 3253 dbSNP
rs889854600 3254 dbSNP
rs1053748332 3256 dbSNP
rs1327232307 3257 dbSNP
rs1227991818 3258 dbSNP
rs140238894 3258 dbSNP
rs890244852 3258 dbSNP
rs1326289878 3264 dbSNP
rs1486989780 3270 dbSNP
rs1390749006 3273 dbSNP
rs1397200252 3279 dbSNP
rs1000820468 3301 dbSNP
rs1266419444 3305 dbSNP
rs191341603 3306 dbSNP
rs931847956 3313 dbSNP
rs147797730 3315 dbSNP
rs1472002959 3318 dbSNP
rs1159239777 3326 dbSNP
rs186928064 3331 dbSNP
rs918099239 3332 dbSNP
rs1055283431 3335 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.669 4.6e-4 -0.677 3.7e-4 21 Click to see details
GSE21687 Ependynoma primary tumors 0.376 1.1e-3 0.292 9.6e-3 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.512 1.1e-2 0.657 8.2e-4 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.308 7.2e-2 0.240 1.3e-1 24 Click to see details
GSE28544 Breast cancer 0.261 1.1e-1 0.372 3.7e-2 24 Click to see details
GSE14794 Lymphoblastoid cells -0.131 1.1e-1 -0.084 2.2e-1 90 Click to see details
GSE19350 CNS germ cell tumors 0.378 1.1e-1 0.357 1.3e-1 12 Click to see details
GSE42095 Differentiated embryonic stem cells 0.202 1.8e-1 0.367 4.2e-2 23 Click to see details
GSE28260 Renal cortex and medulla -0.271 1.9e-1 -0.286 1.7e-1 13 Click to see details
GSE19783 ER+ ER+ breast cancer 0.203 2.0e-1 0.198 2.0e-1 20 Click to see details
GSE21032 Prostate cancer -0.072 2.6e-1 -0.051 3.2e-1 83 Click to see details
GSE17306 Multiple myeloma -0.066 3.3e-1 0.002 4.9e-1 49 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.188 3.3e-1 0.071 4.3e-1 8 Click to see details
GSE21849 B cell lymphoma 0.061 3.8e-1 0.015 4.7e-1 29 Click to see details
GSE27834 Pluripotent stem cells -0.074 3.9e-1 -0.041 4.4e-1 16 Click to see details
GSE32688 Pancreatic cancer -0.042 4.1e-1 0.078 3.4e-1 32 Click to see details
GSE19536 Breast cancer -0.022 4.1e-1 -0.101 1.6e-1 100 Click to see details
GSE19783 ER- ER- breast cancer 0.023 4.2e-1 -0.046 3.4e-1 79 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.014 4.7e-1 0.071 3.7e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.001 5.0e-1 0.005 4.9e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUSC 0.396 0.01 0.446 0 38 Click to see details
THCA -0.296 0.01 -0.310 0.01 59 Click to see details
CESC -0.998 0.02 -1.000 0.5 3 Click to see details
BLCA 0.469 0.02 0.395 0.05 18 Click to see details
UCEC -0.416 0.04 -0.419 0.04 19 Click to see details
KICH -0.359 0.04 -0.398 0.02 25 Click to see details
STAD -0.258 0.08 -0.221 0.11 32 Click to see details
PCPG -0.959 0.09 -1.000 0.5 3 Click to see details
LUAD 0.36 0.13 0.441 0.08 12 Click to see details
KIRC -0.132 0.14 -0.098 0.21 68 Click to see details
ESCA -0.354 0.14 -0.364 0.14 11 Click to see details
BRCA -0.117 0.14 0.029 0.4 84 Click to see details
COAD 0.387 0.17 0.214 0.31 8 Click to see details
KIRP -0.173 0.17 -0.190 0.15 32 Click to see details
CHOL -0.355 0.17 -0.283 0.23 9 Click to see details
HNSC 0.146 0.18 0.192 0.11 42 Click to see details
PAAD -0.368 0.32 0.000 0.5 4 Click to see details
PRAD -0.059 0.34 -0.110 0.22 50 Click to see details
LIHC -0.036 0.4 -0.106 0.23 49 Click to see details
LIHC -0.036 0.4 -0.106 0.23 49 Click to see details
LIHC -0.036 0.4 -0.106 0.23 49 Click to see details
449 hsa-miR-10a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001140 HOXA1 homeobox A1 4 3
MIRT003896 USF2 upstream transcription factor 2, c-fos interacting 4 1
MIRT005454 NCOR2 nuclear receptor corepressor 2 3 1
MIRT005509 MAP3K7 mitogen-activated protein kinase kinase kinase 7 5 1
MIRT005510 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 7 2
MIRT006536 SRSF1 serine and arginine rich splicing factor 1 1 1
MIRT006537 TRA2B transformer 2 beta homolog 3 3
MIRT006972 EPHA4 EPH receptor A4 4 2
MIRT007021 CHL1 cell adhesion molecule L1 like 1 1
MIRT025588 GPR63 G protein-coupled receptor 63 1 1
MIRT025589 BCL2L13 BCL2 like 13 1 1
MIRT025590 CREB5 cAMP responsive element binding protein 5 1 1
MIRT025591 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT025592 OMA1 OMA1 zinc metallopeptidase 1 1
MIRT025593 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT025594 RBM17 RNA binding motif protein 17 1 1
MIRT025595 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT025596 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT025597 SNX4 sorting nexin 4 2 4
MIRT025598 SERBP1 SERPINE1 mRNA binding protein 1 1 2
MIRT025599 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT025600 NOP16 NOP16 nucleolar protein 1 1
MIRT025601 AJUBA ajuba LIM protein 1 1
MIRT025602 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT025603 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT025604 TMEM101 transmembrane protein 101 2 4
MIRT025605 YES1 YES proto-oncogene 1, Src family tyrosine kinase 1 1
MIRT025606 DUSP3 dual specificity phosphatase 3 1 1
MIRT025607 PANX1 pannexin 1 1 1
MIRT025608 WEE1 WEE1 G2 checkpoint kinase 1 1
MIRT025609 TLE3 transducin like enhancer of split 3 1 1
MIRT025610 PDPK1 3-phosphoinositide dependent protein kinase 1 1 1
MIRT025611 CMPK1 cytidine/uridine monophosphate kinase 1 2 6
MIRT025612 NDUFB6 NADH:ubiquinone oxidoreductase subunit B6 1 1
MIRT025613 ARPC5 actin related protein 2/3 complex subunit 5 1 1
MIRT025614 PUM2 pumilio RNA binding family member 2 1 1
MIRT025615 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT025616 ACVR2A activin A receptor type 2A 2 2
MIRT025617 RBM12B RNA binding motif protein 12B 2 5
MIRT025618 THUMPD1 THUMP domain containing 1 1 2
MIRT025619 BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 1 1
MIRT025620 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT025621 XRN1 5'-3' exoribonuclease 1 1 1
MIRT025622 E2F7 E2F transcription factor 7 1 1
MIRT025623 LCA5 LCA5, lebercilin 1 1
MIRT025624 ELOVL2 ELOVL fatty acid elongase 2 1 1
MIRT025625 TFAP2C transcription factor AP-2 gamma 2 3
MIRT025626 TRIM2 tripartite motif containing 2 2 4
MIRT025627 HOXB3 homeobox B3 2 5
MIRT047505 FUS FUS RNA binding protein 1 1
MIRT047506 LMBR1L limb development membrane protein 1 like 1 1
MIRT047507 HSP90AA1 heat shock protein 90 alpha family class A member 1 1 1
MIRT047508 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT047509 EXTL3 exostosin like glycosyltransferase 3 1 1
MIRT047510 POLR2A RNA polymerase II subunit A 1 1
MIRT047511 RIOK2 RIO kinase 2 1 1
MIRT047512 C12orf76 chromosome 12 open reading frame 76 1 1
MIRT047513 CCDC151 coiled-coil domain containing 151 1 1
MIRT047514 FAT2 FAT atypical cadherin 2 1 1
MIRT047515 TPI1 triosephosphate isomerase 1 1 1
MIRT047516 BTAF1 B-TFIID TATA-box binding protein associated factor 1 1 1
MIRT047517 MSANTD1 Myb/SANT DNA binding domain containing 1 1 1
MIRT047518 PLA2G4A phospholipase A2 group IVA 1 1
MIRT047519 IGSF1 immunoglobulin superfamily member 1 1 1
MIRT047520 LEMD3 LEM domain containing 3 1 1
MIRT047521 E2F1 E2F transcription factor 1 1 1
MIRT047522 KIF3B kinesin family member 3B 1 1
MIRT047523 GBAS nipsnap homolog 2 1 1
MIRT047524 LIMA1 LIM domain and actin binding 1 1 1
MIRT047525 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT047526 MRC2 mannose receptor C type 2 1 1
MIRT047527 TMEM106B transmembrane protein 106B 1 1
MIRT047528 ZFP30 ZFP30 zinc finger protein 1 1
MIRT047529 AMPD1 adenosine monophosphate deaminase 1 1 1
MIRT047530 SLC2A3 solute carrier family 2 member 3 1 1
MIRT047531 RPL15 ribosomal protein L15 1 1
MIRT047532 AGER advanced glycosylation end-product specific receptor 1 1
MIRT047533 CNTLN centlein 1 1
MIRT047534 C21orf59 chromosome 21 open reading frame 59 1 1
MIRT047535 SEPT9 septin 9 1 1
MIRT047536 COL6A2 collagen type VI alpha 2 chain 1 1
MIRT047537 MLNR motilin receptor 1 1
MIRT047538 RTKN2 rhotekin 2 1 1
MIRT047539 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT047540 CSNK2A1 casein kinase 2 alpha 1 2 3
MIRT047541 AQP12B aquaporin 12B 1 1
MIRT047542 AGBL2 ATP/GTP binding protein like 2 1 1
MIRT047543 GOLGA8A golgin A8 family member A 1 1
MIRT047544 CPED1 cadherin like and PC-esterase domain containing 1 1 1
MIRT047545 HSPA8 heat shock protein family A (Hsp70) member 8 1 1
MIRT047546 SLC41A3 solute carrier family 41 member 3 1 1
MIRT047547 KXD1 KxDL motif containing 1 1 1
MIRT047548 RELN reelin 1 1
MIRT047549 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT047550 PTPRT protein tyrosine phosphatase, receptor type T 1 1
MIRT047551 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT047552 CYP8B1 cytochrome P450 family 8 subfamily B member 1 1 1
MIRT047553 COL4A3 collagen type IV alpha 3 chain 1 1
MIRT047554 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT047555 MSL3 MSL complex subunit 3 1 1
MIRT047556 TTC7A tetratricopeptide repeat domain 7A 1 1
MIRT047557 COX7B cytochrome c oxidase subunit 7B 1 1
MIRT047558 ZNF318 zinc finger protein 318 1 1
MIRT047559 ACAA1 acetyl-CoA acyltransferase 1 1 1
MIRT047560 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT047561 SCAP SREBF chaperone 1 1
MIRT047562 KCTD11 potassium channel tetramerization domain containing 11 2 11
MIRT047563 RIOK3 RIO kinase 3 1 1
MIRT047564 C5 complement C5 1 1
MIRT047565 GLB1L3 galactosidase beta 1 like 3 1 1
MIRT047566 PAPD5 poly(A) RNA polymerase D5, non-canonical 1 1
MIRT047567 RNF123 ring finger protein 123 1 1
MIRT047568 ZNF629 zinc finger protein 629 1 1
MIRT047569 AMMECR1L AMMECR1 like 1 1
MIRT047570 KLHL6 kelch like family member 6 1 1
MIRT047571 SYMPK symplekin 1 1
MIRT047572 NCSTN nicastrin 1 1
MIRT047573 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 1
MIRT047574 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT047575 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 1
MIRT047576 RAB18 RAB18, member RAS oncogene family 1 1
MIRT047577 CUL3 cullin 3 1 1
MIRT047578 MTF2 metal response element binding transcription factor 2 1 1
MIRT047579 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT047580 NUP37 nucleoporin 37 1 1
MIRT047581 GPR98 adhesion G protein-coupled receptor V1 1 1
MIRT047582 RUNDC3B RUN domain containing 3B 1 1
MIRT047583 KIF21A kinesin family member 21A 1 1
MIRT047584 FEM1B fem-1 homolog B 1 1
MIRT047585 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT047586 PLA2G4F phospholipase A2 group IVF 1 1
MIRT047587 SNTB2 syntrophin beta 2 1 1
MIRT047588 NUB1 negative regulator of ubiquitin like proteins 1 1 1
MIRT047589 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT047590 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT047591 C11orf63 chromosome 11 open reading frame 63 1 1
MIRT047592 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT047593 CHRNA5 cholinergic receptor nicotinic alpha 5 subunit 1 1
MIRT047594 RPS9 ribosomal protein S9 1 1
MIRT047595 DDX42 DEAD-box helicase 42 1 1
MIRT047596 XPO7 exportin 7 1 1
MIRT047597 PYGL glycogen phosphorylase L 1 1
MIRT047598 TGFB3 transforming growth factor beta 3 1 1
MIRT047599 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT047600 PHB2 prohibitin 2 1 1
MIRT047601 ALDH1A2 aldehyde dehydrogenase 1 family member A2 1 1
MIRT047602 SLC3A2 solute carrier family 3 member 2 1 1
MIRT047603 POLR2H RNA polymerase II subunit H 1 1
MIRT047604 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT047605 MOB3C MOB kinase activator 3C 1 1
MIRT047606 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT047607 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT047608 INTS2 integrator complex subunit 2 1 1
MIRT047609 MYEF2 myelin expression factor 2 1 1
MIRT047610 PANK2 pantothenate kinase 2 1 1
MIRT047611 EMB embigin 1 1
MIRT047612 HK1 hexokinase 1 1 1
MIRT047613 UBE2Z ubiquitin conjugating enzyme E2 Z 1 1
MIRT047614 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT047615 HOXA3 homeobox A3 1 1
MIRT047616 NT5DC1 5'-nucleotidase domain containing 1 1 1
MIRT047617 YOD1 YOD1 deubiquitinase 1 1
MIRT047618 APRT adenine phosphoribosyltransferase 1 1
MIRT047619 C2CD2 C2 calcium dependent domain containing 2 1 1
MIRT047620 SHBG sex hormone binding globulin 1 1
MIRT047621 PPP1R12A protein phosphatase 1 regulatory subunit 12A 1 1
MIRT047622 SCD stearoyl-CoA desaturase 1 1
MIRT047623 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT047624 ETS1 ETS proto-oncogene 1, transcription factor 1 1
MIRT047625 GTF3C2 general transcription factor IIIC subunit 2 1 1
MIRT047626 NOP2 NOP2 nucleolar protein 1 1
MIRT047627 RPS29 ribosomal protein S29 1 1
MIRT047628 LAMC1 laminin subunit gamma 1 1 1
MIRT047629 GNAL G protein subunit alpha L 1 1
MIRT047630 KIAA1147 KIAA1147 1 1
MIRT047631 NACC2 NACC family member 2 1 1
MIRT047632 TMEM179B transmembrane protein 179B 1 1
MIRT047633 ARF3 ADP ribosylation factor 3 1 1
MIRT047634 MCPH1 microcephalin 1 1 1
MIRT047635 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT047636 UBN2 ubinuclein 2 1 1
MIRT047637 ANO6 anoctamin 6 1 1
MIRT047638 NEK7 NIMA related kinase 7 1 1
MIRT047639 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT047640 MED1 mediator complex subunit 1 1 1
MIRT047641 PTPRG protein tyrosine phosphatase, receptor type G 1 1
MIRT047642 ERMN ermin 1 1
MIRT047643 LYPD6 LY6/PLAUR domain containing 6 1 1
MIRT047644 SLC25A5 solute carrier family 25 member 5 1 1
MIRT047645 EPB41L2 erythrocyte membrane protein band 4.1 like 2 1 1
MIRT047646 ARFGEF1 ADP ribosylation factor guanine nucleotide exchange factor 1 1 1
MIRT047647 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT047648 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 1 1
MIRT047649 KLHL23 kelch like family member 23 1 1
MIRT047650 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT047651 HOXD13 homeobox D13 1 1
MIRT047652 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT047653 ZNF592 zinc finger protein 592 1 1
MIRT047654 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT047655 RRP1B ribosomal RNA processing 1B 1 1
MIRT047656 UHRF1 ubiquitin like with PHD and ring finger domains 1 1 1
MIRT047657 SORD sorbitol dehydrogenase 1 1
MIRT047658 PPM1G protein phosphatase, Mg2+/Mn2+ dependent 1G 1 1
MIRT047659 SF3B3 splicing factor 3b subunit 3 1 1
MIRT047660 PRPF8 pre-mRNA processing factor 8 1 1
MIRT047661 PRDX2 peroxiredoxin 2 1 1
MIRT047662 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT047663 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT047664 CAB39L calcium binding protein 39 like 1 1
MIRT047665 ATP5F1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1 1 1
MIRT047666 PARL presenilin associated rhomboid like 1 1
MIRT047667 ERLIN1 ER lipid raft associated 1 1 1
MIRT047668 MARS methionyl-tRNA synthetase 1 1
MIRT047669 TRPM7 transient receptor potential cation channel subfamily M member 7 1 1
MIRT047670 DLG4 discs large MAGUK scaffold protein 4 1 1
MIRT047671 WDR74 WD repeat domain 74 1 1
MIRT047672 PWP1 PWP1 homolog, endonuclein 1 1
MIRT047673 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT047674 NAP1L1 nucleosome assembly protein 1 like 1 1 1
MIRT047675 CTNND1 catenin delta 1 1 1
MIRT047676 IQCB1 IQ motif containing B1 1 1
MIRT047677 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT047678 CDK19 cyclin dependent kinase 19 1 1
MIRT047679 LRP3 LDL receptor related protein 3 1 1
MIRT047680 UBE2D2 ubiquitin conjugating enzyme E2 D2 1 1
MIRT047681 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT047682 GORASP2 golgi reassembly stacking protein 2 1 1
MIRT047683 DDX54 DEAD-box helicase 54 1 1
MIRT047684 CARHSP1 calcium regulated heat stable protein 1 1 1
MIRT047685 FAM168A family with sequence similarity 168 member A 1 1
MIRT047686 SF3B4 splicing factor 3b subunit 4 1 1
MIRT047687 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 1 1
MIRT047688 PLEKHB2 pleckstrin homology domain containing B2 1 1
MIRT047689 LRFN1 leucine rich repeat and fibronectin type III domain containing 1 1 1
MIRT047690 KIAA0100 KIAA0100 1 1
MIRT047691 DVL1 dishevelled segment polarity protein 1 1 1
MIRT047692 NOMO1 NODAL modulator 1 1 1
MIRT047693 MIS12 MIS12, kinetochore complex component 1 1
MIRT047694 GLOD4 glyoxalase domain containing 4 1 1
MIRT047695 USP11 ubiquitin specific peptidase 11 1 1
MIRT047696 UBE3C ubiquitin protein ligase E3C 1 1
MIRT047697 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT047698 SPARC secreted protein acidic and cysteine rich 1 1
MIRT047699 SLC26A2 solute carrier family 26 member 2 1 1
MIRT047700 MED12 mediator complex subunit 12 1 1
MIRT047701 FAM219B family with sequence similarity 219 member B 1 1
MIRT047702 GOSR2 golgi SNAP receptor complex member 2 1 1
MIRT047703 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT047704 PIAS3 protein inhibitor of activated STAT 3 1 1
MIRT047705 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT047706 COL4A2 collagen type IV alpha 2 chain 1 1
MIRT047707 NUP205 nucleoporin 205 1 1
MIRT047708 POLR3A RNA polymerase III subunit A 1 1
MIRT047709 ATG3 autophagy related 3 1 1
MIRT047710 COPA coatomer protein complex subunit alpha 1 1
MIRT047711 CD59 CD59 molecule (CD59 blood group) 1 1
MIRT047712 TENM3 teneurin transmembrane protein 3 1 1
MIRT047713 TUBA1A tubulin alpha 1a 1 1
MIRT047714 LSS lanosterol synthase 1 1
MIRT047715 FASN fatty acid synthase 4 1
MIRT047716 PSMD13 proteasome 26S subunit, non-ATPase 13 1 1
MIRT047717 ZNF618 zinc finger protein 618 1 1
MIRT047718 TSPAN33 tetraspanin 33 1 1
MIRT047719 KANK1 KN motif and ankyrin repeat domains 1 1 1
MIRT047720 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT047721 DPYSL2 dihydropyrimidinase like 2 1 1
MIRT047722 SUPT6H SPT6 homolog, histone chaperone 1 1
MIRT047723 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT047724 ACTG1 actin gamma 1 3 2
MIRT047725 PLSCR1 phospholipid scramblase 1 1 1
MIRT047726 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT047727 SFPQ splicing factor proline and glutamine rich 1 1
MIRT047728 VDAC1 voltage dependent anion channel 1 1 1
MIRT047729 ADCY9 adenylate cyclase 9 1 1
MIRT047730 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT047731 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 1 1
MIRT047732 SLC25A13 solute carrier family 25 member 13 1 1
MIRT047733 IGSF9B immunoglobulin superfamily member 9B 1 1
MIRT047734 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047735 MCU mitochondrial calcium uniporter 1 1
MIRT047736 CDK8 cyclin dependent kinase 8 1 1
MIRT047737 CEP128 centrosomal protein 128 1 1
MIRT047738 TRAPPC12 trafficking protein particle complex 12 1 1
MIRT047739 SYNJ1 synaptojanin 1 1 1
MIRT047740 NOB1 NIN1/PSMD8 binding protein 1 homolog 1 1
MIRT047741 AP5S1 adaptor related protein complex 5 sigma 1 subunit 1 1
MIRT047742 RNF213 ring finger protein 213 1 1
MIRT047743 PSMB1 proteasome subunit beta 1 1 1
MIRT047744 BCR BCR, RhoGEF and GTPase activating protein 1 1
MIRT047745 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT047746 NPTX1 neuronal pentraxin 1 1 1
MIRT047747 PRRC2C proline rich coiled-coil 2C 1 1
MIRT047748 PABPC3 poly(A) binding protein cytoplasmic 3 1 1
MIRT047749 NF2 neurofibromin 2 1 1
MIRT047750 RALBP1 ralA binding protein 1 1 1
MIRT047751 EHD4 EH domain containing 4 1 1
MIRT047752 RLIM ring finger protein, LIM domain interacting 1 1
MIRT076413 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT084600 BCL2L11 BCL2 like 11 3 5
MIRT093335 RAPGEF2 Rap guanine nucleotide exchange factor 2 2 2
MIRT097757 ARSK arylsulfatase family member K 2 2
MIRT099597 ID4 inhibitor of DNA binding 4, HLH protein 2 6
MIRT249192 RAP2A RAP2A, member of RAS oncogene family 2 1
MIRT299201 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT437577 ZFAND5 zinc finger AN1-type containing 5 2 1
MIRT437578 CNST consortin, connexin sorting protein 2 1
MIRT437579 TIAM1 T-cell lymphoma invasion and metastasis 1 2 1
MIRT438258 PTEN phosphatase and tensin homolog 2 2
MIRT438408 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT448051 SFRP1 secreted frizzled related protein 1 2 2
MIRT459965 POC1A POC1 centriolar protein A 2 2
MIRT466175 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT470412 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT475883 H3F3C H3 histone family member 3C 2 10
MIRT475919 H3F3B H3 histone family member 3B 2 8
MIRT493173 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT497272 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT507101 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508100 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT508628 PLA2G2C phospholipase A2 group IIC 2 2
MIRT510735 SON SON DNA binding protein 2 6
MIRT513973 CNOT6 CCR4-NOT transcription complex subunit 6 2 2
MIRT514262 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT514577 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 4
MIRT515044 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515692 TFPI tissue factor pathway inhibitor 2 2
MIRT515752 ONECUT3 one cut homeobox 3 2 2
MIRT517389 METTL7A methyltransferase like 7A 2 2
MIRT519732 ZNF460 zinc finger protein 460 2 2
MIRT520247 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT520270 URGCP upregulator of cell proliferation 2 2
MIRT522213 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT523700 FHL2 four and a half LIM domains 2 2 4
MIRT523978 DVL3 dishevelled segment polarity protein 3 2 2
MIRT525569 MTRNR2L7 MT-RNR2-like 7 2 6
MIRT525619 MTRNR2L3 MT-RNR2-like 3 2 4
MIRT530223 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT530549 SYNPO synaptopodin 2 2
MIRT531041 ZNF502 zinc finger protein 502 2 2
MIRT532579 GSS glutathione synthetase 2 2
MIRT534840 RAB15 RAB15, member RAS oncogene family 2 2
MIRT535793 MTRNR2L11 MT-RNR2-like 11 2 6
MIRT535811 MTRNR2L10 MT-RNR2-like 10 2 4
MIRT536818 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT539894 IRGQ immunity related GTPase Q 2 2
MIRT540209 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT540951 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541937 ORC1 origin recognition complex subunit 1 2 4
MIRT542195 FUT1 fucosyltransferase 1 (H blood group) 2 6
MIRT542374 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542508 WDR13 WD repeat domain 13 2 2
MIRT542575 ZNF280B zinc finger protein 280B 2 2
MIRT542714 RPS15A ribosomal protein S15a 2 2
MIRT546705 RORA RAR related orphan receptor A 5 4
MIRT549929 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550162 ZNF223 zinc finger protein 223 2 4
MIRT558566 CRLF3 cytokine receptor like factor 3 2 4
MIRT560945 TPM4 tropomyosin 4 2 4
MIRT574848 CADM1 cell adhesion molecule 1 2 2
MIRT575176 Atg9a autophagy related 9A 2 2
MIRT576664 Fam216a family with sequence similarity 216, member A 2 2
MIRT609434 MTX3 metaxin 3 2 2
MIRT612162 TCF15 transcription factor 15 2 2
MIRT617414 API5 apoptosis inhibitor 5 2 2
MIRT617469 CCS copper chaperone for superoxide dismutase 2 2
MIRT618780 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618835 PHF20 PHD finger protein 20 2 2
MIRT619339 RNF2 ring finger protein 2 2 2
MIRT625244 C6orf89 chromosome 6 open reading frame 89 2 2
MIRT626439 CHDH choline dehydrogenase 2 2
MIRT634929 CHMP1B charged multivesicular body protein 1B 2 2
MIRT635875 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636235 SLC24A4 solute carrier family 24 member 4 2 2
MIRT636641 CHAF1B chromatin assembly factor 1 subunit B 2 2
MIRT640545 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT648661 ALKBH4 alkB homolog 4, lysine demethylase 2 2
MIRT650186 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT650790 GSR glutathione-disulfide reductase 2 2
MIRT652027 TTYH3 tweety family member 3 2 2
MIRT652517 TMEM109 transmembrane protein 109 2 2
MIRT661940 MAVS mitochondrial antiviral signaling protein 2 2
MIRT661951 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT662020 ZNF445 zinc finger protein 445 2 2
MIRT664015 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT664059 KIAA1551 KIAA1551 2 2
MIRT666872 POU2F2 POU class 2 homeobox 2 2 2
MIRT669168 CCNG1 cyclin G1 2 2
MIRT673243 KLHDC8A kelch domain containing 8A 2 2
MIRT680410 SFT2D2 SFT2 domain containing 2 2 2
MIRT680484 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT683577 CARD8 caspase recruitment domain family member 8 2 2
MIRT684398 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT684558 ZNF708 zinc finger protein 708 2 2
MIRT685421 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT686050 SLC5A5 solute carrier family 5 member 5 2 2
MIRT687955 HHIP hedgehog interacting protein 2 2
MIRT688181 FRRS1 ferric chelate reductase 1 2 2
MIRT688303 FAM208A family with sequence similarity 208 member A 2 2
MIRT688900 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT689205 ZNF574 zinc finger protein 574 2 2
MIRT689917 ACOT13 acyl-CoA thioesterase 13 2 2
MIRT692931 EXOSC2 exosome component 2 2 2
MIRT693632 CENPL centromere protein L 2 2
MIRT694762 FZD2 frizzled class receptor 2 2 2
MIRT695373 PHAX phosphorylated adaptor for RNA export 2 2
MIRT696630 WDR77 WD repeat domain 77 2 2
MIRT696690 APOC3 apolipoprotein C3 2 2
MIRT697367 ZNF394 zinc finger protein 394 2 2
MIRT697611 XIAP X-linked inhibitor of apoptosis 2 2
MIRT697737 USP6NL USP6 N-terminal like 2 2
MIRT697788 UBXN7 UBX domain protein 7 2 2
MIRT698361 TMEM127 transmembrane protein 127 2 2
MIRT704519 CNKSR3 CNKSR family member 3 2 2
MIRT704600 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT705849 AHCY adenosylhomocysteinase 2 2
MIRT707093 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT707154 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT707243 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT707356 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT707459 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707503 AXL AXL receptor tyrosine kinase 2 2
MIRT707647 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT707703 FAM118A family with sequence similarity 118 member A 2 2
MIRT707714 CDC6 cell division cycle 6 2 2
MIRT707825 TMEM170A transmembrane protein 170A 2 2
MIRT707966 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT708006 NUDT4 nudix hydrolase 4 2 2
MIRT708035 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT708073 LIX1L limb and CNS expressed 1 like 2 2
MIRT708131 GK5 glycerol kinase 5 (putative) 2 2
MIRT708200 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT708210 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT708940 CRY2 cryptochrome circadian clock 2 2 2
MIRT709199 SAPCD2 suppressor APC domain containing 2 2 2
MIRT714403 FBXO31 F-box protein 31 2 2
MIRT714629 KIAA1143 KIAA1143 2 2
MIRT720741 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT720894 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT723335 DGAT1 diacylglycerol O-acyltransferase 1 2 2
MIRT724452 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT731180 SERPINE1 serpin family E member 1 3 1
MIRT732377 GP1BA glycoprotein Ib platelet alpha subunit 2 1
MIRT733585 SDC1 syndecan 1 3 0
MIRT734393 ARNTL aryl hydrocarbon receptor nuclear translocator like 3 0
MIRT735361 BDNF brain derived neurotrophic factor 4 0
MIRT735799 MAP2K6 mitogen-activated protein kinase kinase 6 3 0
MIRT735868 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736834 SKA1 spindle and kinetochore associated complex subunit 1 3 0
MIRT737248 LEF1-AS1 LEF1 antisense RNA 1 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-10a RAR-alpha antagonist Ro-41-5253 NULL NULL Northern blot pancreatic cancer 19747919 2009 down-regulated
miR-10a 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-10a Oxaliplatin (L-OHP) approved 5310940 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-10a Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells HT-29 cells 20955366 2011 down-regulated
miR-10a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Microarray acute myeloid leukemia (AML) cell line HL-60 21518431 2011 down-regulated
miR-10a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Quantitative real-time PCR regulatory T cells (T(reg) cells) 22544395 2012 up-regulated
miR-10a Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-10a Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Northern blot fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Quantitative real-time PCR fetal mouse brains 19091803 2009 up-regulated
miR-10a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 up-regualted
miR-10a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-10a-5p Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-10a-5p Comfrey NULL 6440495 Microarray rat liver 21370286 2011 down-regulated
miR-10a-5p Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-10a-5p Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-10a-5p Acarbose Approved 444254 Microarray diabetic rats cells 24260283 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-10a Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-10a Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-10a Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-10a Tamoxifen 2733525 NSC180973 approved sensitive tissue (ER-positive breast cancer)
hsa-mir-10a Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-10a-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 resistant
hsa-miR-10a-5p (3aR)-7-[3-[4-[3-[[(3aR)-8-methoxy-10-oxo-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-7-yl]oxy]propyl]piperazin-1-yl]propoxy]-8-methoxy-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-10-one 24202913 NSC726262 resistant
hsa-miR-10a-5p (4z,6z)-4,6-dibenzylidene-2,2-dimethyl-1,3-dioxan-5-one 5387558 NSC624512 resistant
hsa-miR-10a-5p (5e)-5-benzylidene-3-(2,4,5-trichlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470506 NSC702355 resistant
hsa-miR-10a-5p (6e,7r,8r,8as)-8-methyl-6-[(2r)-2-methylhexylidene]-8-phenylmethoxy-1,2,3,5,7,8a-hexahydroindolizin-7-ol 5470307 NSC699382 resistant
hsa-miR-10a-5p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 resistant
hsa-miR-10a-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-[4-(diethylamino)phenyl]prop-2-en-1-one 5471159 NSC709103 resistant
hsa-miR-10a-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 resistant
hsa-miR-10a-5p (e)-2-methyl-1-[2-(2-methyl-1h-indol-3-yl)indolin-1-yl]but-2-en-1-one 5388204 NSC633484 resistant
hsa-miR-10a-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-(cyclohexanecarbonylamino)-3-cyclohexyl-2-hydroxypropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10 383477 NSC671869 resistant
hsa-miR-10a-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-10a-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-10a-5p [(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-26-[(E)-[(2,4-dinitrophenyl)hydrazinylidene]methyl]-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12,14,16,18,22-heptamethyl-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta-1(29),2,4,9,19,21, 135483937 NSC144126 resistant
hsa-miR-10a-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-2-oxo-6-phenylpyridin-1-yl]oxan-2-yl]methyl acetate 368873 NSC640212 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-phenyl-2,4-bis(sulfanylidene)quinazolin-1-yl]oxan-2-yl]methyl acetate 368629 NSC639741 resistant
hsa-miR-10a-5p [4-[[dimethyl(octadecyl)azaniumyl]methyl]phenyl]methyl-dimethyl-octadecylazanium;bromide 361976 NSC625458 resistant
hsa-miR-10a-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] acetate 9555726 NSC144055 resistant
hsa-miR-10a-5p 1-(dimethylamino)-4-methyl-4H-pyrido[3,4-g]quinoline-5,10-dione 388892 NSC684118 sensitive
hsa-miR-10a-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 resistant
hsa-miR-10a-5p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 resistant
hsa-miR-10a-5p 1-[7-methyl-8-(3,4,5-trimethoxyphenyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]piperazine 384846 NSC675364 resistant
hsa-miR-10a-5p 10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2,4,6,8,11(19),12,14(18)-heptaene-15,17-dione 399629 NSC710546 sensitive
hsa-miR-10a-5p 1h-pyrimido[4,5-b]quinoline-2,4-dithione 5472868 NSC722222 resistant
hsa-miR-10a-5p 2-(11h-indolo[3,2-c]quinolin-6-ylamino)ethanol NSC736606 sensitive
hsa-miR-10a-5p 2-(2-chlorophenyl)-5,7-dihydroxy-8-(3-hydroxy-1-methylpiperidin-4-yl)chromen-4-one 5466794 NSC642740 resistant
hsa-miR-10a-5p 2-trans-n-buten-1-yl-estradiol 5468334 NSC669229 resistant
hsa-miR-10a-5p 2,5-diphenyl-1h-[1,2,4]triazino[4,3-a]quinoxaline 399102 NSC709518 resistant
hsa-miR-10a-5p 3-(((cyclohexylamino)carbonyl)oxy)-4-methyl-1,3-thiazole-2(3h)-thione 372703 NSC648263 resistant
hsa-miR-10a-5p 3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-phenyl-3,4-dihydropyrazole-2-carbaldehyde 155810020 NSC762559 resistant
hsa-miR-10a-5p 3,3,4,4,4-pentachloro-1-phenylbutan-1-one 405828 NSC723515 sensitive
hsa-miR-10a-5p 4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 374328 NSC651852 resistant
hsa-miR-10a-5p 4-appt 5995211 NSC195327 resistant
hsa-miR-10a-5p 4-methyl-3-[4-[2-[4-(4-methyl-5-sulfanylidene-1h-1,2,4-triazol-3-yl)phenyl]iminohydrazinyl]phenyl]-1h-1,2,4-triazole-5-thione 5472009 NSC715974 resistant
hsa-miR-10a-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 resistant
hsa-miR-10a-5p 5'-chloro-2'-methoxy-3-nitrosalicylanilide 186169 NSC79459 resistant
hsa-miR-10a-5p 5,6-dimethoxy-9-(methylthio)furo[3',4':4,5]cyclopenta[1,2,3-ij]isoquinoline 363754 NSC628946 resistant
hsa-miR-10a-5p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-10a-5p 6-(chloromethyl)-2-oxo-N-pentylchromene-3-carboxamide 402500 NSC716526 sensitive
hsa-miR-10a-5p 6-methoxy-1h-pyrazolo[3,4-b]quinoxalin-3-amine 395806 NSC700694 resistant
hsa-miR-10a-5p 6,7-diacetoxyisoflavan 353129 NSC600289 resistant
hsa-miR-10a-5p 8-[(4-tert-butylphenoxy)methyl]-1,3-dimethyl-7H-purine-2,6-dione 235292 NSC36525 resistant
hsa-miR-10a-5p 8455ab 1549990 NSC24189 resistant
hsa-miR-10a-5p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 resistant
hsa-miR-10a-5p Antibiotic p 168 5477807 NSC356885 resistant
hsa-miR-10a-5p Antineoplastic-656904 376224 NSC656904 resistant
hsa-miR-10a-5p Aquatris(1,3-diphenylpropane-1,3-dionato)neodymium(iii) 24202395 NSC647040 resistant
hsa-miR-10a-5p Bas100 monohydrate 45028404 NSC742554 resistant
hsa-miR-10a-5p Berberine iodide 72350 NSC150446 resistant
hsa-miR-10a-5p Bindschedler's green 73516 NSC7811 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p C4, carbonyl, ethyl prodigiosine 135540855 NSC742416 resistant
hsa-miR-10a-5p Cgp 57380 11644425 NSC741567 sensitive
hsa-miR-10a-5p Cinerubin a hcl 5458466 NSC243022 sensitive
hsa-miR-10a-5p Cis-dichlorobis(4-methoxyphenethylamine)platinum(ii) 498558 NSC631305 resistant
hsa-miR-10a-5p Cis-difluorobis(1-phenylhexane-1,3-dionato)titanium(iv) NSC637220 resistant
hsa-miR-10a-5p Cyano-[4-[[[3-(trifluoromethyl)phenyl]methylamino]carbamoyl]pyridin-1-ium-1-yl]boron 6334922 NSC698276 resistant
hsa-miR-10a-5p Cytembena 23663958 NSC104801 resistant
hsa-miR-10a-5p Cytovaricin 5477715 NSC349622 resistant
hsa-miR-10a-5p Diethyl 2-[[4-[[[3-ethoxycarbonyl-7-(trifluoromethyl)quinoxalin-2-yl]amino]methyl]benzoyl]amino]pentanedioate 390810 NSC688812 resistant
hsa-miR-10a-5p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-10a-5p Echinomycin 3197 NSC526417 resistant
hsa-miR-10a-5p Ethyl 2-((4-(2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494007 NSC691084 resistant
hsa-miR-10a-5p Ethyl 2-((4-(6-bromo-2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494008 NSC691085 resistant
hsa-miR-10a-5p Ethyl 5-amino-4-(3,4-dihydro-2h-1,5-benzodioxepin-7-ylamino)-2-methylsulfanylthieno[2,3-d]pyrimidine-6-carboxylate 399955 NSC711107 resistant
hsa-miR-10a-5p From combretum caffrum plant 5386397 NSC609397 resistant
hsa-miR-10a-5p Kuc100204 378309 NSC660313 resistant
hsa-miR-10a-5p Lddhtajmmdseme-okkqscsosa-n 6712634 NSC702655 sensitive
hsa-miR-10a-5p Ls-77867 395636 NSC700418 resistant
hsa-miR-10a-5p Methyl (1s,10r)-6-methyl-10-nonyl-7,9,12-triazatricyclo[6.3.1.04,12]dodeca-5,8-diene-5-carboxylate 401693 NSC715423 resistant
hsa-miR-10a-5p Methyl 3-butylsulfanyl-2-[[(e)-3-(6-methyl-2,4-dioxo-1h-pyrimidin-5-yl)prop-2-enoyl]amino]propanoate 5383838 NSC201241 resistant
hsa-miR-10a-5p Mggh 5351153 NSC32946 resistant
hsa-miR-10a-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 resistant
hsa-miR-10a-5p N-[3-bromo-6-oxo-1-(4-phenylpiperidin-1-yl)-4,5-dihydrocyclopenta[c]thiophen-4-yl]-2,2,2-trifluoroacetamide 378804 NSC662123 resistant
hsa-miR-10a-5p NSC657492 NSC657492 sensitive
hsa-miR-10a-5p NSC751830 NSC751830 sensitive
hsa-miR-10a-5p Plumericin 5281545 NSC112152 resistant
hsa-miR-10a-5p Propan-2-yl (1r,9s,12e)-3,4,6-trimethoxy-11-[(4-methoxyphenyl)methyl]-5-methyl-10-oxo-12-[(2,4,5-trimethoxy-3-methylphenyl)methylidene]-11,13-diazatricyclo[7.3.1.02,7]trideca-2(7),3,5-triene-13-carbox 6330789 NSC622075 resistant
hsa-miR-10a-5p Resorufin 69462 NSC12097 resistant
hsa-miR-10a-5p Rhamnazin 5320945 NSC678106 resistant
hsa-miR-10a-5p Roridin a, 8-hydroxy-9b,10b-epoxy- 5458716 NSC327993 resistant
hsa-miR-10a-5p Sb-236687 17892742 NSC756422 sensitive
hsa-miR-10a-5p Sergeolide,desacetyl 125729 NSC364170 resistant
hsa-miR-10a-5p Sodium;4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 54612576 NSC651853 resistant
hsa-miR-10a-5p Tert-butyl n-[6-[2-[(2-amino-2-oxoethyl)carbamoyl]pyrrolidin-1-yl]-5-(9h-fluoren-9-ylmethoxycarbonylamino)-6-oxohexyl]carbamate 383818 NSC672434 sensitive
hsa-miR-10a-5p Tetra(isobutenyl)antimony bromide NSC651199 resistant
hsa-miR-10a-5p Tributylgermyl 2-acetoxy-2-phenyl-acetate 16683233 NSC645575 resistant
hsa-miR-10a-5p Verrucarin a 9,10-epoxide 5358836 NSC283445 sensitive
hsa-miR-10a-5p Z28714792 2671841 NSC746248 resistant
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-10a-5p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Esophageal Squamous Cell Carcinoma tissue and cell line (TE1, TE5, TE8, TE9, TE10, TE11, TE13)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PaCa-2)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Vinorelbine 44424639 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-10a-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-10a-5p Cytarabine 6253 NSC287459 approved sensitive Low Acute Myeloid Leukemia tissue and cell line (KG-1a, Kasumi-1, K562, OCI-AML3)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant Low Acute Myeloid Leukemia tissue and cell line (HL-60)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (HepG2, Huh-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Small Cell Lung Cancer cell line (H446)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-10a-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-10a-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (W1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (TE1, KYSE450)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3ip1, HeyA8)
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (A172)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HS578T)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-10a-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-10a-5p Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-10a-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Methotrexate 126941 NSC740 approved sensitive cell line (HT29)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-10a-5p Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission