miRTarBase - #MIRT025595


—
pre-miRNA Information
pre-miRNA hsa-mir-10a   
Genomic Coordinates chr17: 48579838 - 48579947
Synonyms MIRN10A, hsa-mir-10a, miRNA10A, mir-10a, MIR10A
Description Homo sapiens miR-10a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-10a-5p
Sequence 22| UACCCUGUAGAUCCGAAUUUGUG |44
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30152819 13 COSMIC
COSN30458892 14 COSMIC
COSN23023008 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1333990950 2 dbSNP
rs770328167 3 dbSNP
rs1453440972 5 dbSNP
rs1391955925 7 dbSNP
rs1157653116 8 dbSNP
rs760091682 10 dbSNP
rs1161287321 12 dbSNP
rs369632753 13 dbSNP
rs985848773 14 dbSNP
rs772649724 18 dbSNP
rs529115879 22 dbSNP
rs375865628 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B6HZE2 miR-10a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Muscle Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol NR1D2   
Synonyms BD73, EAR-1R, RVR
Description nuclear receptor subfamily 1 group D member 2
Transcript NM_001145425   
Other Transcripts NM_005126   
Expression
Putative miRNA Targets on NR1D2
3'UTR of NR1D2
(miRNA target sites are highlighted)		 
>NR1D2|NM_001145425|3'UTR
   1 GGCCTTTGTTTATTTAAACATGAACTGATGGTAACTGTACATTTTGTGCTAAAATGCATATTTATATGTGTATACCATAT
  81 GTGGAGATAGAAAAGACCTTTAAGACAATAAAAGATTGTAGGCTATCTCTGTAATCATGCAATAGCTGTTCGGATTGAGA
 161 ACTCTTCAGCCATGATTAGACGTTGACTGCATCTCCCTGATAGACCAATCAGCTGTGTCGCACTTAAACTGGAGAAGTTA
 241 CACTGAAGTATAATCACACTGAATGTTAGACTTTTTCATCTGCCAAAACCAAAAACCATTTTGATCTCCCTGTGGTTATC
 321 AATATAACGCACAATCACAAGTGTATGAGGACTTAGAAATTAATCCTTTGTGGTAGGAGTTCTGTTGAATGATGGAAATC
 401 TTATTACTACCACAAGACTATTTGATCTGGTAATTGGAGACTTCGGGATTTAGGAGATCTCCATGTCTGTATTTACTCTA
 481 CCACTGCTAAAGTGTGTGGTCCTGGGTAGTTTACTTGCTTGCGGAAAATGAGAATTGATGGTGTCCCCAATGCCCCACCT
 561 CACAGAGTTACTAAAAAATGTCTGTAAAGCATATTTACCTCTTGGGAGATAGGCACTATGTAAATAAGGTAAAATTTCTG
 641 TTATTACAATTATTCATAATAATATTCTTTTCTTATTTCTAAGCCTTTCTGGGAAATCATTTCAGTCCACACCAACCATA
 721 TTATTCAGGGTTCCTGCCATATGTGTGGGGTATCCTACTGATACACACGTATTCAAAGTTTATGGGTACAACAAAGACAT
 801 AGTACATGTACATAATATGTATGTGAATATAGTTAAATATATTTCTTCACAATATTTTAAACTGTGAAGAACTTTATCAT
 881 ACAGGAAACTTAAAACAAGAGGTGTCAAAAGACCCAAATTAGGTGCATTTTACTTGTTTATGATGGCATAACCATTGCTT
 961 TAAAATGTTTAGACAGTAGAATATTGAATTTATGCTCTATTTTTGTTTATTTAAGCAACACTTAATGTAAAAGTGCAACA
1041 GGCAATTGAATCCAAATTTCAACGACAAAAAAAAAAAACATGTATTTTAGAGTTCATCTTTGGCAAAATCTTTGGTTCAG
1121 GGTACTAGTTGTTTAAAAGTTGATTCATATTCTTACCTTGTGCTGAGAAAGGTTGCATTGCTGCCCCTTATACACATGCT
1201 GCAGCTTGATGTTAAAGAATTTTTATTCTTTCTGAAGAACTAATTAATGTTTAAAGCAACTGTTTAATATGATGGCATGT
1281 GTGTGTGTGCGTGCGTGTGTATGTTCTGAGTCCACTTCTTTTTTCCTAAATAACACTACAGGGATTTTGTCATATTAGAT
1361 TTAATTTATAATTTGAAAAATCATCTAGTGTGTGACCTACAGGCTTAGAAATGGTATAGTCAAAGACATTTTATCCACAT
1441 TTCTAATAGTGGACTTGATTAAGTAGATAAGATCAGCATCTGTTTATGGTAGTAGGAGAAATAGCCAAAGTTGAGGATTT
1521 TATGTATGTTTTCCTGTTTACCTGGAAAATAGCAATTAATTGGATTTTTTGGTAAAGATTGCCTTCTGTATAATGTTTGG
1601 ATTATATAAAATTGCAAAAATGATAACAGCCCGCTTTACTGTACTAAGCCTGTTACTTTCATGACGTGTGAGCAGAATGC
1681 CTTATTTTGTAATCTTGTTTAACTTGTTGCTACTGGGACTTGATTTACTGTGGCACTAGTTAAGTAAGTTAAAAAAAAGT
1761 TAAACCCTCTCATTATTAAAGAGGAAAGGCGATGGTGATGTCTGTAGTACAATATAAACCATAATTGTGATTTACCTTAA
1841 GTAGGTATAACTCTTATGGGATATACAGTATAGTTTTTGTGAATCTTTACATGATAGCATTATCTTTTTATAATTTTTTT
1921 TCCTAAGATAAACAAATGCATAGTTTTCTTCTATGGGTGATAGAAACAGCTTTTTGAAGTAATGAAAACCTCAAAAGATC
2001 ATGTTGATTCTTAATTTTTGCCTTTTGCATAAGCCTCTTTATAACATGTATCTTTAAAACAATTAAGTCTTTAGGAATGT
2081 GTAACCAGAACTATGTTAGTATTGCTTATAAAACTTTAGTTAGGTTCAATATATACATATATACATCTCTATATAGGTAT
2161 ATAGATTTGCATTTTGTCTTGTAAAATTTTATTTGAATAAATTCTTCCTGTAGGTAATGGGAAACAAAATTAATAGTTCA
2241 TATGTCACTCATAGCATTTCTATATTTGAAAGTAGCCCAATATAAAACTTTTGATTCTAAAATTAAACCAGCAGCCTATT
2321 ACAAGCACATTCTTTGATTGAGTCATTGGTTATAAACTTACTAAATGCAGAGAAAGCAGCCAATTTAGGAAACTTCTGAG
2401 TTGGTGGGACACTGTTGATTAATAATGTACTGTATGAATTAAGTGATGCTTTAACTTTGATTTTACATTTTAAAGTTAAA
2481 ATGTGGGCATTATGTCAGCAAACTTAAGGGCATTATGTCAGCAAGCTAAAACATTTTTTTTCCTGTGCTTTTAATGTATC
2561 TCTTTACATGATCTGAGAGAGGATTCAAGTTGATAGAAATAGCTGAGGGGAAAAGGGGGAACATCTTGGGATGAAGCTTG
2641 TCCTTATGGTGATGGTTTAATTACAGATTAAAAAATTAGAAGGAAATTTCAGTGGATTAAGTGTATAGCTTTCATATCTA
2721 CATTTCAAGAAATTACCATTGTAACTTGATAAGAGATGATTTATTTTATGTAAACATCTTTGCAAAGCAAGGTGTAGCAG
2801 CTCAGCTAGATTTATTACTGTGCACGAAAGTAAATACCTATCTCAATTATTCTTTTTCTTTTCCAATATAAAGTTTGCTG
2881 AATGTACAAGAAGAGTTTATCACTTAGGATATAGAATTTTTTTAGGGGTTGGGGGAGGGGATCTGTTAGGAAACTGTTAC
2961 CTATAAACAAAGATTGACTGGATTCGATCCAAAAGATAAAACTTGAAGCTATTCTGGAACTAACATGGAAAAATGAAATG
3041 GCTATTGTTTAAAAAAATGATAGAAATACATTGTTGATGGGATATGAGTTAAGTTTATTTTCTACAAACTGTAATTGATG
3121 AGGACATGGATAATATCTTCATGTTTCTGAGAAGTAATCTGTATGTGGGGGGAGGGGATAATAAATATTTCTAACCAACA
3201 AAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guGUUU---AAGCCUAGAUGUCCCAu 5'
            ||||   ||:|| |   |||||| 
Target 5' ggCAAAATCTTTGGTT---CAGGGTa 3'
 1102 - 1124 133.00 -15.90
2 
miRNA  3' guGUUUAAGC-CUAGAUGUCCCAu 5'
            | |:| :| || ||||||| | 
Target 5' atCTAGTGTGTGACCTACAGGCTt 3'
 1383 - 1406 133.00 -11.52
3 
miRNA  3' guGUUUAAGCCUAGAUGUCCCau 5'
            | || |   | ||||||||  
Target 5' tcCTAAATAACA-CTACAGGGat 3'
 1324 - 1345 132.00 -13.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30115913 87 COSMIC
COSN30153843 87 COSMIC
COSN26438691 97 COSMIC
COSN31605610 106 COSMIC
COSN6573859 166 COSMIC
COSN17132072 221 COSMIC
COSN21974472 233 COSMIC
COSN30526630 249 COSMIC
COSN16396033 253 COSMIC
COSN5533145 399 COSMIC
COSN31962036 559 COSMIC
COSN18998961 645 COSMIC
COSN21055921 711 COSMIC
COSN17470517 992 COSMIC
COSN20098218 1079 COSMIC
COSN27367124 1079 COSMIC
COSN25145773 1164 COSMIC
COSN25523426 1279 COSMIC
COSN20090777 1291 COSMIC
COSN5043105 2053 COSMIC
COSN20252983 2073 COSMIC
COSN8924092 2205 COSMIC
COSN23414892 2894 COSMIC
COSN21364647 3090 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1428255250 2 dbSNP
rs761991177 3 dbSNP
rs370800749 4 dbSNP
rs199724685 5 dbSNP
rs1424242842 9 dbSNP
rs780967231 10 dbSNP
rs752600291 12 dbSNP
rs755844630 20 dbSNP
rs1483138022 21 dbSNP
rs1408758752 23 dbSNP
rs777810436 26 dbSNP
rs201841751 28 dbSNP
rs1202067287 32 dbSNP
rs1336956042 36 dbSNP
rs770590148 39 dbSNP
rs778509259 46 dbSNP
rs1010288339 48 dbSNP
rs116793159 52 dbSNP
rs1013945636 57 dbSNP
rs1225117014 58 dbSNP
rs1417569013 59 dbSNP
rs1343496655 69 dbSNP
rs968854408 70 dbSNP
rs1023050586 73 dbSNP
rs921422233 77 dbSNP
rs970033906 79 dbSNP
rs979094365 82 dbSNP
rs1311048854 89 dbSNP
rs1178614289 93 dbSNP
rs1358061732 103 dbSNP
rs34096691 105 dbSNP
rs925832101 109 dbSNP
rs1448209734 111 dbSNP
rs986967058 118 dbSNP
rs955889782 126 dbSNP
rs988573561 128 dbSNP
rs546255893 135 dbSNP
rs539336507 138 dbSNP
rs534456639 139 dbSNP
rs760768533 139 dbSNP
rs554176425 143 dbSNP
rs1239006012 144 dbSNP
rs879601752 144 dbSNP
rs1308935029 148 dbSNP
rs572331871 152 dbSNP
rs1172916108 164 dbSNP
rs183715156 165 dbSNP
rs1262398759 166 dbSNP
rs1228981019 175 dbSNP
rs186941880 182 dbSNP
rs1390908544 185 dbSNP
rs1380146527 186 dbSNP
rs191415159 190 dbSNP
rs1278895375 192 dbSNP
rs1405876815 194 dbSNP
rs941333627 201 dbSNP
rs1442353883 204 dbSNP
rs776514555 209 dbSNP
rs182635303 211 dbSNP
rs897383365 220 dbSNP
rs1239305599 221 dbSNP
rs1037424045 224 dbSNP
rs1256411275 236 dbSNP
rs919969230 237 dbSNP
rs1479755861 242 dbSNP
rs994367640 244 dbSNP
rs1209154988 248 dbSNP
rs1352682359 254 dbSNP
rs140874702 260 dbSNP
rs576775984 264 dbSNP
rs1218311371 277 dbSNP
rs1044498957 278 dbSNP
rs540958582 281 dbSNP
rs1441380083 286 dbSNP
rs1322451167 293 dbSNP
rs1317404067 298 dbSNP
rs559335670 299 dbSNP
rs1056628911 308 dbSNP
rs895606050 312 dbSNP
rs1424298444 316 dbSNP
rs905959985 323 dbSNP
rs1177546807 325 dbSNP
rs1352293837 327 dbSNP
rs558308043 329 dbSNP
rs1288861342 330 dbSNP
rs1452390940 335 dbSNP
rs1022677999 338 dbSNP
rs970129735 342 dbSNP
rs999792813 352 dbSNP
rs1384241093 353 dbSNP
rs1056909034 354 dbSNP
rs568745561 356 dbSNP
rs1032902851 371 dbSNP
rs529636162 376 dbSNP
rs1331691464 389 dbSNP
rs1259537504 390 dbSNP
rs1204541239 395 dbSNP
rs891682881 405 dbSNP
rs1293995827 407 dbSNP
rs1010176581 408 dbSNP
rs1358920357 411 dbSNP
rs4602333 418 dbSNP
rs1230060397 420 dbSNP
rs375755717 421 dbSNP
rs1449372960 428 dbSNP
rs1387807877 431 dbSNP
rs563380720 434 dbSNP
rs922435158 445 dbSNP
rs774882048 446 dbSNP
rs985953430 449 dbSNP
rs995921589 452 dbSNP
rs911288659 461 dbSNP
rs941372612 464 dbSNP
rs530572713 472 dbSNP
rs367956899 474 dbSNP
rs554053409 474 dbSNP
rs1480685827 476 dbSNP
rs954450604 477 dbSNP
rs1198242092 479 dbSNP
rs1239093135 483 dbSNP
rs1038367258 496 dbSNP
rs751481985 497 dbSNP
rs1191456016 500 dbSNP
rs1275579471 504 dbSNP
rs961918337 505 dbSNP
rs1245936178 509 dbSNP
rs930209256 513 dbSNP
rs550442662 518 dbSNP
rs571857635 519 dbSNP
rs746323705 523 dbSNP
rs1234425016 524 dbSNP
rs1174288296 525 dbSNP
rs1347927227 530 dbSNP
rs1282008109 536 dbSNP
rs896654731 540 dbSNP
rs865906684 548 dbSNP
rs1464708121 551 dbSNP
rs1328976417 555 dbSNP
rs1044555705 557 dbSNP
rs144793932 559 dbSNP
rs1167051032 560 dbSNP
rs547747747 562 dbSNP
rs1470174847 564 dbSNP
rs1431340455 565 dbSNP
rs1044384127 568 dbSNP
rs1480136261 578 dbSNP
rs905582059 583 dbSNP
rs1459565498 597 dbSNP
rs1436226107 599 dbSNP
rs927353600 607 dbSNP
rs1204707056 608 dbSNP
rs938786185 630 dbSNP
rs1261793235 632 dbSNP
rs999845244 633 dbSNP
rs1321939933 635 dbSNP
rs1330924333 638 dbSNP
rs566332560 641 dbSNP
rs891749864 644 dbSNP
rs1443761015 645 dbSNP
rs1333604427 648 dbSNP
rs1327844504 650 dbSNP
rs1453056743 653 dbSNP
rs1408086553 656 dbSNP
rs1277180512 657 dbSNP
rs138639511 658 dbSNP
rs945946589 659 dbSNP
rs1218023381 660 dbSNP
rs1303682796 662 dbSNP
rs1160314622 663 dbSNP
rs1468730514 663 dbSNP
rs1232487216 664 dbSNP
rs1258813208 665 dbSNP
rs1184494783 666 dbSNP
rs1043016155 667 dbSNP
rs772714123 668 dbSNP
rs1203441440 673 dbSNP
rs1029543846 684 dbSNP
rs1287031936 686 dbSNP
rs767265395 704 dbSNP
rs1288843591 705 dbSNP
rs1278565607 716 dbSNP
rs985284144 719 dbSNP
rs554505097 732 dbSNP
rs1185093580 733 dbSNP
rs576133114 737 dbSNP
rs1384582296 739 dbSNP
rs962809022 740 dbSNP
rs1451664088 741 dbSNP
rs1345700297 749 dbSNP
rs1320253719 750 dbSNP
rs974109564 755 dbSNP
rs1407289459 758 dbSNP
rs1200909349 765 dbSNP
rs752571968 769 dbSNP
rs566116119 770 dbSNP
rs186612418 771 dbSNP
rs576614238 772 dbSNP
rs1214336725 776 dbSNP
rs1446950400 779 dbSNP
rs992412397 782 dbSNP
rs1020195442 784 dbSNP
rs918151093 786 dbSNP
rs948232213 787 dbSNP
rs1474002367 789 dbSNP
rs1361079687 791 dbSNP
rs559764503 794 dbSNP
rs1045221168 795 dbSNP
rs973314570 799 dbSNP
rs1362457549 800 dbSNP
rs1271740670 806 dbSNP
rs1428506454 807 dbSNP
rs905630463 809 dbSNP
rs559411058 810 dbSNP
rs1303778802 813 dbSNP
rs1426693314 824 dbSNP
rs1363943960 828 dbSNP
rs1163218748 829 dbSNP
rs574634547 830 dbSNP
rs1422031894 838 dbSNP
rs1325951763 839 dbSNP
rs541462660 840 dbSNP
rs1475334780 841 dbSNP
rs1027204815 842 dbSNP
rs1199491881 846 dbSNP
rs1490716393 848 dbSNP
rs952979856 862 dbSNP
rs980050551 865 dbSNP
rs1399957893 870 dbSNP
rs956383803 871 dbSNP
rs1274776256 875 dbSNP
rs1212605316 887 dbSNP
rs927319392 892 dbSNP
rs1054101153 897 dbSNP
rs938754711 897 dbSNP
rs992961082 897 dbSNP
rs1293036731 899 dbSNP
rs753223211 901 dbSNP
rs1242854372 902 dbSNP
rs1283892836 903 dbSNP
rs1409810506 910 dbSNP
rs1430603355 910 dbSNP
rs1009836061 915 dbSNP
rs1479755635 916 dbSNP
rs1357325196 919 dbSNP
rs756824887 926 dbSNP
rs1030007766 927 dbSNP
rs904410645 943 dbSNP
rs1480723039 954 dbSNP
rs1234314522 955 dbSNP
rs891033540 962 dbSNP
rs1211352058 968 dbSNP
rs1202181978 971 dbSNP
rs931902624 972 dbSNP
rs1225211805 973 dbSNP
rs1050076951 975 dbSNP
rs1300594436 980 dbSNP
rs890162038 984 dbSNP
rs1392048010 987 dbSNP
rs1375782337 998 dbSNP
rs1007160181 999 dbSNP
rs191349086 1000 dbSNP
rs1264674856 1002 dbSNP
rs1179073486 1005 dbSNP
rs1468639862 1005 dbSNP
rs1009062490 1006 dbSNP
rs778625538 1019 dbSNP
rs1419226150 1022 dbSNP
rs1409670037 1028 dbSNP
rs760659372 1029 dbSNP
rs1457056003 1034 dbSNP
rs1205333524 1038 dbSNP
rs962821702 1038 dbSNP
rs1473584130 1040 dbSNP
rs994319493 1043 dbSNP
rs1239854413 1046 dbSNP
rs1318854701 1051 dbSNP
rs149325067 1053 dbSNP
rs1378889252 1061 dbSNP
rs1419596982 1064 dbSNP
rs1299395085 1065 dbSNP
rs1362524976 1066 dbSNP
rs1290014642 1067 dbSNP
rs1385485889 1067 dbSNP
rs1402117344 1067 dbSNP
rs397789593 1067 dbSNP
rs535843216 1067 dbSNP
rs574035079 1067 dbSNP
rs66705087 1067 dbSNP
rs1025694117 1071 dbSNP
rs1185183466 1077 dbSNP
rs951377568 1078 dbSNP
rs992143092 1079 dbSNP
rs1205695618 1080 dbSNP
rs980349636 1081 dbSNP
rs772746873 1082 dbSNP
rs948310360 1096 dbSNP
rs1247297046 1099 dbSNP
rs981384859 1104 dbSNP
rs1317519603 1107 dbSNP
rs1244202846 1111 dbSNP
rs1340302501 1119 dbSNP
rs1352773914 1120 dbSNP
rs1240762862 1125 dbSNP
rs1288153450 1142 dbSNP
rs11547595 1147 dbSNP
rs1383439216 1148 dbSNP
rs925464386 1150 dbSNP
rs780232557 1151 dbSNP
rs1418623662 1152 dbSNP
rs1365804298 1153 dbSNP
rs1165126485 1158 dbSNP
rs1456177644 1159 dbSNP
rs530664039 1161 dbSNP
rs552283294 1180 dbSNP
rs747412362 1192 dbSNP
rs1430176627 1194 dbSNP
rs534075564 1194 dbSNP
rs1054152968 1195 dbSNP
rs1256275214 1197 dbSNP
rs1490546554 1198 dbSNP
rs993237036 1200 dbSNP
rs1355946007 1208 dbSNP
rs1443748761 1214 dbSNP
rs565503861 1216 dbSNP
rs912957057 1217 dbSNP
rs945746137 1218 dbSNP
rs946133751 1234 dbSNP
rs1278191569 1238 dbSNP
rs1398815039 1239 dbSNP
rs978594101 1241 dbSNP
rs1304452000 1242 dbSNP
rs1384648885 1242 dbSNP
rs925806695 1245 dbSNP
rs1439532695 1247 dbSNP
rs76656162 1250 dbSNP
rs891077260 1260 dbSNP
rs1421355628 1269 dbSNP
rs1169944196 1270 dbSNP
rs1491425264 1277 dbSNP
rs1050375450 1278 dbSNP
rs944354138 1278 dbSNP
rs1172029902 1284 dbSNP
rs1006801270 1286 dbSNP
rs897550301 1289 dbSNP
rs554109552 1291 dbSNP
rs898334509 1292 dbSNP
rs72628110 1295 dbSNP
rs1326286045 1296 dbSNP
rs1025746307 1298 dbSNP
rs951428309 1306 dbSNP
rs567426732 1313 dbSNP
rs1375866616 1316 dbSNP
rs1024970085 1317 dbSNP
rs1392893460 1318 dbSNP
rs183154117 1319 dbSNP
rs970075854 1331 dbSNP
rs148098215 1342 dbSNP
rs1431376405 1345 dbSNP
rs540627942 1350 dbSNP
rs1477780351 1355 dbSNP
rs1364571154 1356 dbSNP
rs1014227070 1361 dbSNP
rs1456629425 1362 dbSNP
rs958213954 1368 dbSNP
rs189078126 1384 dbSNP
rs1232486051 1385 dbSNP
rs1297126002 1397 dbSNP
rs1463038336 1400 dbSNP
rs913007812 1404 dbSNP
rs1277199907 1406 dbSNP
rs1216937774 1409 dbSNP
rs1256044498 1422 dbSNP
rs746923690 1422 dbSNP
rs558604401 1447 dbSNP
rs1240688992 1448 dbSNP
rs1196350915 1450 dbSNP
rs1308190232 1453 dbSNP
rs1453181794 1455 dbSNP
rs73038538 1466 dbSNP
rs1332161657 1470 dbSNP
rs1413957904 1472 dbSNP
rs1385700002 1474 dbSNP
rs1457944047 1475 dbSNP
rs912237839 1491 dbSNP
rs773315843 1492 dbSNP
rs1160401464 1502 dbSNP
rs1179598577 1503 dbSNP
rs1438000785 1509 dbSNP
rs925774102 1512 dbSNP
rs534527181 1513 dbSNP
rs553083938 1516 dbSNP
rs1446863159 1518 dbSNP
rs185259942 1519 dbSNP
rs759433384 1524 dbSNP
rs911785138 1537 dbSNP
rs542097029 1543 dbSNP
rs898385379 1549 dbSNP
rs1378261132 1550 dbSNP
rs1036012435 1560 dbSNP
rs557028209 1562 dbSNP
rs1471033053 1587 dbSNP
rs1168626858 1590 dbSNP
rs918945049 1591 dbSNP
rs1384787325 1593 dbSNP
rs1399762839 1601 dbSNP
rs1282235516 1607 dbSNP
rs995367401 1609 dbSNP
rs1048834994 1613 dbSNP
rs536461560 1615 dbSNP
rs374591479 1618 dbSNP
rs1466360983 1621 dbSNP
rs1333074578 1622 dbSNP
rs944979533 1623 dbSNP
rs555957647 1624 dbSNP
rs1164500995 1630 dbSNP
rs190092330 1633 dbSNP
rs969436306 1634 dbSNP
rs1181640605 1642 dbSNP
rs752379202 1650 dbSNP
rs1244394557 1651 dbSNP
rs1386123475 1655 dbSNP
rs868299660 1655 dbSNP
rs1014942966 1658 dbSNP
rs564183522 1661 dbSNP
rs1332316155 1663 dbSNP
rs1216188380 1664 dbSNP
rs1323178635 1666 dbSNP
rs1256894607 1667 dbSNP
rs1227590219 1670 dbSNP
rs988309293 1675 dbSNP
rs1280059876 1698 dbSNP
rs1318118721 1713 dbSNP
rs914065066 1714 dbSNP
rs1406920638 1726 dbSNP
rs955010057 1734 dbSNP
rs1164509006 1737 dbSNP
rs1000199906 1739 dbSNP
rs1169227920 1741 dbSNP
rs1422236282 1741 dbSNP
rs760525533 1745 dbSNP
rs1253420513 1749 dbSNP
rs1261787410 1749 dbSNP
rs754840807 1751 dbSNP
rs550047278 1754 dbSNP
rs1487741359 1756 dbSNP
rs763864167 1758 dbSNP
rs953457660 1759 dbSNP
rs985940065 1760 dbSNP
rs1481715163 1765 dbSNP
rs1018814673 1772 dbSNP
rs1317224152 1777 dbSNP
rs1283938624 1783 dbSNP
rs1423049629 1783 dbSNP
rs1221068179 1788 dbSNP
rs912274319 1791 dbSNP
rs1293205062 1792 dbSNP
rs528151436 1807 dbSNP
rs368085703 1813 dbSNP
rs541270558 1825 dbSNP
rs965978534 1826 dbSNP
rs975061149 1832 dbSNP
rs919862791 1837 dbSNP
rs1356594081 1838 dbSNP
rs1329769246 1839 dbSNP
rs559897917 1840 dbSNP
rs1172872770 1848 dbSNP
rs972423040 1851 dbSNP
rs530370703 1857 dbSNP
rs1347890494 1864 dbSNP
rs1434439368 1888 dbSNP
rs1422591357 1893 dbSNP
rs1046963103 1898 dbSNP
rs918924672 1905 dbSNP
rs1457277715 1914 dbSNP
rs1480770846 1914 dbSNP
rs372277608 1918 dbSNP
rs949220348 1922 dbSNP
rs1293902066 1926 dbSNP
rs1392731516 1930 dbSNP
rs1046490541 1933 dbSNP
rs1310571377 1934 dbSNP
rs1224504295 1940 dbSNP
rs984427287 1940 dbSNP
rs1379403470 1943 dbSNP
rs1307455586 1945 dbSNP
rs569744290 1954 dbSNP
rs1002235959 1958 dbSNP
rs926346400 1967 dbSNP
rs1305161148 1968 dbSNP
rs530836926 1969 dbSNP
rs1465001806 1974 dbSNP
rs552120393 1983 dbSNP
rs1032303368 1984 dbSNP
rs1356891367 1986 dbSNP
rs1174746200 1987 dbSNP
rs528646308 1995 dbSNP
rs1276982327 2001 dbSNP
rs1419239080 2002 dbSNP
rs937780204 2004 dbSNP
rs112317436 2005 dbSNP
rs1176536435 2008 dbSNP
rs1438900106 2010 dbSNP
rs570859781 2011 dbSNP
rs1243657973 2015 dbSNP
rs141833564 2016 dbSNP
rs1220069491 2022 dbSNP
rs1310218412 2023 dbSNP
rs1482255441 2025 dbSNP
rs896000108 2030 dbSNP
rs1356107883 2035 dbSNP
rs375847872 2038 dbSNP
rs1383925435 2041 dbSNP
rs1021124188 2042 dbSNP
rs1244443023 2046 dbSNP
rs1394729250 2046 dbSNP
rs1379096353 2056 dbSNP
rs1266430944 2057 dbSNP
rs138839200 2061 dbSNP
rs903443815 2063 dbSNP
rs954919667 2069 dbSNP
rs1215139701 2070 dbSNP
rs753516295 2073 dbSNP
rs568229830 2075 dbSNP
rs1368791341 2078 dbSNP
rs191716619 2078 dbSNP
rs184229082 2080 dbSNP
rs1188501526 2082 dbSNP
rs757020814 2092 dbSNP
rs1255457942 2098 dbSNP
rs1187181946 2110 dbSNP
rs1489340275 2115 dbSNP
rs1261152393 2116 dbSNP
rs554132569 2118 dbSNP
rs1488912799 2120 dbSNP
rs576074248 2129 dbSNP
rs1243142564 2130 dbSNP
rs1195882303 2134 dbSNP
rs1386904162 2136 dbSNP
rs575573541 2138 dbSNP
rs188168460 2141 dbSNP
rs752735189 2143 dbSNP
rs964115947 2144 dbSNP
rs1341787616 2146 dbSNP
rs975113307 2148 dbSNP
rs557691118 2150 dbSNP
rs150649077 2151 dbSNP
rs1360595641 2166 dbSNP
rs572900857 2178 dbSNP
rs930930097 2182 dbSNP
rs1456260518 2185 dbSNP
rs1432203233 2190 dbSNP
rs982696275 2191 dbSNP
rs966309923 2192 dbSNP
rs971923828 2194 dbSNP
rs1228566172 2198 dbSNP
rs908428088 2199 dbSNP
rs1208396721 2202 dbSNP
rs778535565 2213 dbSNP
rs1362105309 2218 dbSNP
rs1046642737 2225 dbSNP
rs749974523 2227 dbSNP
rs1275695852 2228 dbSNP
rs758917158 2228 dbSNP
rs1217546404 2231 dbSNP
rs926314000 2234 dbSNP
rs1325163925 2243 dbSNP
rs1384737745 2245 dbSNP
rs780613527 2251 dbSNP
rs1331793482 2261 dbSNP
rs540316186 2263 dbSNP
rs893810820 2264 dbSNP
rs937747613 2265 dbSNP
rs1170051477 2271 dbSNP
rs180892880 2281 dbSNP
rs1379562798 2283 dbSNP
rs1196969864 2286 dbSNP
rs1021175028 2294 dbSNP
rs1244732320 2296 dbSNP
rs558127868 2298 dbSNP
rs1200934215 2304 dbSNP
rs1456815599 2310 dbSNP
rs1258054480 2315 dbSNP
rs879172037 2322 dbSNP
rs1437661539 2325 dbSNP
rs1197425892 2328 dbSNP
rs530294131 2336 dbSNP
rs1041902370 2346 dbSNP
rs541991912 2349 dbSNP
rs1157827625 2353 dbSNP
rs1330162572 2360 dbSNP
rs1018185147 2362 dbSNP
rs777377906 2364 dbSNP
rs963860283 2367 dbSNP
rs1448799952 2373 dbSNP
rs936263392 2378 dbSNP
rs1330644680 2390 dbSNP
rs1054448372 2393 dbSNP
rs1358114975 2402 dbSNP
rs1170902706 2413 dbSNP
rs1465684052 2419 dbSNP
rs781455999 2423 dbSNP
rs1007644808 2427 dbSNP
rs1026693588 2428 dbSNP
rs1444945489 2437 dbSNP
rs952373523 2440 dbSNP
rs901932523 2453 dbSNP
rs1444637410 2454 dbSNP
rs1280055040 2455 dbSNP
rs1198287546 2457 dbSNP
rs1346692984 2463 dbSNP
rs1286331335 2467 dbSNP
rs1309006411 2474 dbSNP
rs1374316206 2484 dbSNP
rs1374636394 2490 dbSNP
rs1308305352 2493 dbSNP
rs1226016757 2497 dbSNP
rs1276563546 2510 dbSNP
rs1332262586 2513 dbSNP
rs1311736541 2514 dbSNP
rs982434263 2520 dbSNP
rs1491519409 2533 dbSNP
rs993706009 2533 dbSNP
rs1379999272 2534 dbSNP
rs34772025 2534 dbSNP
rs951945747 2534 dbSNP
rs908480708 2539 dbSNP
rs971050018 2542 dbSNP
rs563656376 2544 dbSNP
rs1456619765 2559 dbSNP
rs1184734705 2566 dbSNP
rs1177722607 2569 dbSNP
rs1238598276 2579 dbSNP
rs982003137 2587 dbSNP
rs1218293863 2595 dbSNP
rs1351062448 2596 dbSNP
rs1283230675 2611 dbSNP
rs1228734510 2614 dbSNP
rs1471103970 2632 dbSNP
rs1358377439 2634 dbSNP
rs571712314 2648 dbSNP
rs748335806 2649 dbSNP
rs1423844322 2650 dbSNP
rs1033297438 2665 dbSNP
rs937806559 2668 dbSNP
rs531070089 2670 dbSNP
rs1360195909 2673 dbSNP
rs1397606489 2674 dbSNP
rs769929491 2678 dbSNP
rs1324611693 2685 dbSNP
rs1407474890 2687 dbSNP
rs1412230620 2691 dbSNP
rs991847553 2693 dbSNP
rs1464800229 2700 dbSNP
rs1331060024 2701 dbSNP
rs1195233960 2710 dbSNP
rs552198349 2723 dbSNP
rs915297008 2729 dbSNP
rs1221990497 2733 dbSNP
rs1444973288 2739 dbSNP
rs1177036342 2741 dbSNP
rs1287498689 2751 dbSNP
rs1273651017 2752 dbSNP
rs770030157 2759 dbSNP
rs1367517749 2760 dbSNP
rs917629678 2760 dbSNP
rs1042762261 2765 dbSNP
rs1275710681 2770 dbSNP
rs1438902273 2771 dbSNP
rs773231470 2774 dbSNP
rs1348456813 2778 dbSNP
rs1323320119 2781 dbSNP
rs577636104 2793 dbSNP
rs1285296920 2796 dbSNP
rs966507411 2802 dbSNP
rs544793408 2808 dbSNP
rs1172191129 2809 dbSNP
rs1476578203 2810 dbSNP
rs1418323100 2821 dbSNP
rs1191367068 2823 dbSNP
rs1478824682 2824 dbSNP
rs564496110 2825 dbSNP
rs140842865 2826 dbSNP
rs547047712 2827 dbSNP
rs187009948 2828 dbSNP
rs1039251356 2832 dbSNP
rs1196798955 2847 dbSNP
rs900668937 2847 dbSNP
rs924834227 2850 dbSNP
rs144676268 2851 dbSNP
rs936232027 2856 dbSNP
rs1478323398 2857 dbSNP
rs1054749056 2860 dbSNP
rs76873718 2867 dbSNP
rs952423443 2868 dbSNP
rs771841872 2878 dbSNP
rs910807839 2885 dbSNP
rs1015669143 2888 dbSNP
rs1477277403 2888 dbSNP
rs1379725908 2891 dbSNP
rs1171020862 2903 dbSNP
rs970385647 2910 dbSNP
rs982441992 2912 dbSNP
rs926537987 2913 dbSNP
rs1411934889 2915 dbSNP
rs1176163476 2917 dbSNP
rs569178741 2918 dbSNP
rs1192741225 2919 dbSNP
rs1440129501 2922 dbSNP
rs1349758985 2929 dbSNP
rs1406122682 2931 dbSNP
rs1305003270 2933 dbSNP
rs376491767 2935 dbSNP
rs1480269989 2937 dbSNP
rs989260053 2938 dbSNP
rs796433330 2940 dbSNP
rs369052461 2942 dbSNP
rs71324123 2955 dbSNP
rs1341743105 2956 dbSNP
rs1226342702 2959 dbSNP
rs1310665406 2961 dbSNP
rs572784355 2962 dbSNP
rs1241298461 2963 dbSNP
rs371453829 2966 dbSNP
rs1490482056 2970 dbSNP
rs1356239389 2971 dbSNP
rs1224691908 2973 dbSNP
rs1391256716 2978 dbSNP
rs945461110 2986 dbSNP
rs147510446 2987 dbSNP
rs1172572671 2995 dbSNP
rs1419959998 2997 dbSNP
rs1381861039 2998 dbSNP
rs140078810 3000 dbSNP
rs1193758917 3014 dbSNP
rs1374375454 3016 dbSNP
rs1471616455 3018 dbSNP
rs1013646818 3021 dbSNP
rs1413572314 3025 dbSNP
rs79977932 3027 dbSNP
rs1256928347 3034 dbSNP
rs753616183 3039 dbSNP
rs1358701671 3045 dbSNP
rs1284252139 3048 dbSNP
rs1238865066 3051 dbSNP
rs900744685 3066 dbSNP
rs1359229052 3067 dbSNP
rs565065022 3068 dbSNP
rs1227124596 3077 dbSNP
rs924772686 3079 dbSNP
rs1311746774 3082 dbSNP
rs563059585 3083 dbSNP
rs1286900595 3085 dbSNP
rs957485127 3087 dbSNP
rs990323458 3087 dbSNP
rs543976036 3091 dbSNP
rs1417173061 3095 dbSNP
rs1474203662 3095 dbSNP
rs1194497420 3100 dbSNP
rs910776609 3102 dbSNP
rs1261351655 3106 dbSNP
rs563767605 3109 dbSNP
rs943650884 3110 dbSNP
rs1267635279 3116 dbSNP
rs1049258169 3119 dbSNP
rs923325074 3120 dbSNP
rs1292116661 3126 dbSNP
rs1218784523 3127 dbSNP
rs888233315 3128 dbSNP
rs1341958653 3134 dbSNP
rs764994101 3137 dbSNP
rs1359959758 3154 dbSNP
rs1381328142 3159 dbSNP
rs1301541941 3160 dbSNP
rs1248074038 3162 dbSNP
rs150071854 3166 dbSNP
rs1459758792 3167 dbSNP
rs542028859 3168 dbSNP
rs532626166 3169 dbSNP
rs1478871009 3174 dbSNP
rs1263257432 3176 dbSNP
rs970819213 3178 dbSNP
rs1440306688 3179 dbSNP
rs772626278 3180 dbSNP
rs1433983379 3181 dbSNP
rs1269837798 3186 dbSNP
rs1208486190 3189 dbSNP
rs887871768 3197 dbSNP
rs1003182795 3199 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors 0.362 1.6e-3 0.220 4.0e-2 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.448 2.4e-2 0.671 6.0e-4 20 Click to see details
GSE28544 Breast cancer -0.353 4.5e-2 -0.535 3.5e-3 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.354 6.3e-2 -0.266 1.3e-1 20 Click to see details
GSE21849 B cell lymphoma 0.265 8.2e-2 0.303 5.5e-2 29 Click to see details
GSE42095 Differentiated embryonic stem cells -0.273 1.0e-1 -0.358 4.7e-2 23 Click to see details
GSE14794 Lymphoblastoid cells -0.13 1.1e-1 -0.159 6.7e-2 90 Click to see details
GSE32688 Pancreatic cancer -0.198 1.4e-1 -0.137 2.3e-1 32 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.225 1.4e-1 0.380 3.0e-2 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.219 1.5e-1 0.022 4.6e-1 24 Click to see details
GSE21032 Prostate cancer 0.111 1.6e-1 0.113 1.5e-1 83 Click to see details
GSE27834 Pluripotent stem cells 0.237 1.9e-1 0.318 1.2e-1 16 Click to see details
GSE17306 Multiple myeloma -0.122 2.0e-1 -0.100 2.5e-1 49 Click to see details
GSE38226 Liver fibrosis -0.183 2.1e-1 -0.055 4.1e-1 21 Click to see details
GSE19350 CNS germ cell tumors 0.24 2.3e-1 0.168 3.0e-1 12 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.303 2.3e-1 -0.024 4.8e-1 8 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.133 2.6e-1 0.064 3.8e-1 25 Click to see details
GSE19536 Breast cancer -0.064 2.6e-1 -0.107 1.4e-1 100 Click to see details
GSE28260 Renal cortex and medulla 0.096 3.8e-1 0.154 3.1e-1 13 Click to see details
GSE19783 ER- ER- breast cancer 0.028 4.0e-1 0.001 5.0e-1 79 Click to see details
GSE17498 Multiple myeloma -0.008 4.8e-1 0.252 5.8e-2 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
ESCA -0.936 0 -0.900 0 11 Click to see details
KIRC 0.379 0 0.363 0 68 Click to see details
PRAD 0.409 0 0.203 0.08 50 Click to see details
PAAD 0.972 0.01 1.000 0.5 4 Click to see details
KICH 0.409 0.02 0.412 0.02 25 Click to see details
CHOL 0.582 0.05 0.683 0.02 9 Click to see details
KIRP 0.276 0.06 0.291 0.05 32 Click to see details
STAD 0.231 0.1 0.230 0.1 32 Click to see details
BRCA -0.138 0.11 -0.092 0.2 84 Click to see details
CESC -0.914 0.13 -1.000 0.5 3 Click to see details
LUSC 0.184 0.13 0.209 0.1 38 Click to see details
BLCA 0.274 0.14 0.298 0.11 18 Click to see details
LUAD -0.274 0.19 -0.497 0.05 12 Click to see details
LIHC -0.098 0.25 -0.119 0.21 49 Click to see details
HNSC 0.101 0.26 0.158 0.16 42 Click to see details
COAD 0.231 0.29 0.310 0.23 8 Click to see details
UCEC -0.129 0.3 -0.082 0.37 19 Click to see details
THCA -0.033 0.4 -0.062 0.32 59 Click to see details
PCPG -0.282 0.41 -0.500 0.33 3 Click to see details
PCPG -0.282 0.41 -0.500 0.33 3 Click to see details
PCPG -0.282 0.41 -0.500 0.33 3 Click to see details
449 hsa-miR-10a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001140 HOXA1 homeobox A1 4 3
MIRT003896 USF2 upstream transcription factor 2, c-fos interacting 4 1
MIRT005454 NCOR2 nuclear receptor corepressor 2 3 1
MIRT005509 MAP3K7 mitogen-activated protein kinase kinase kinase 7 5 1
MIRT005510 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 7 2
MIRT006536 SRSF1 serine and arginine rich splicing factor 1 1 1
MIRT006537 TRA2B transformer 2 beta homolog 3 3
MIRT006972 EPHA4 EPH receptor A4 4 2
MIRT007021 CHL1 cell adhesion molecule L1 like 1 1
MIRT025588 GPR63 G protein-coupled receptor 63 1 1
MIRT025589 BCL2L13 BCL2 like 13 1 1
MIRT025590 CREB5 cAMP responsive element binding protein 5 1 1
MIRT025591 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT025592 OMA1 OMA1 zinc metallopeptidase 1 1
MIRT025593 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT025594 RBM17 RNA binding motif protein 17 1 1
MIRT025595 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT025596 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT025597 SNX4 sorting nexin 4 2 4
MIRT025598 SERBP1 SERPINE1 mRNA binding protein 1 1 2
MIRT025599 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT025600 NOP16 NOP16 nucleolar protein 1 1
MIRT025601 AJUBA ajuba LIM protein 1 1
MIRT025602 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT025603 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT025604 TMEM101 transmembrane protein 101 2 4
MIRT025605 YES1 YES proto-oncogene 1, Src family tyrosine kinase 1 1
MIRT025606 DUSP3 dual specificity phosphatase 3 1 1
MIRT025607 PANX1 pannexin 1 1 1
MIRT025608 WEE1 WEE1 G2 checkpoint kinase 1 1
MIRT025609 TLE3 transducin like enhancer of split 3 1 1
MIRT025610 PDPK1 3-phosphoinositide dependent protein kinase 1 1 1
MIRT025611 CMPK1 cytidine/uridine monophosphate kinase 1 2 6
MIRT025612 NDUFB6 NADH:ubiquinone oxidoreductase subunit B6 1 1
MIRT025613 ARPC5 actin related protein 2/3 complex subunit 5 1 1
MIRT025614 PUM2 pumilio RNA binding family member 2 1 1
MIRT025615 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT025616 ACVR2A activin A receptor type 2A 2 2
MIRT025617 RBM12B RNA binding motif protein 12B 2 5
MIRT025618 THUMPD1 THUMP domain containing 1 1 2
MIRT025619 BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 1 1
MIRT025620 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT025621 XRN1 5'-3' exoribonuclease 1 1 1
MIRT025622 E2F7 E2F transcription factor 7 1 1
MIRT025623 LCA5 LCA5, lebercilin 1 1
MIRT025624 ELOVL2 ELOVL fatty acid elongase 2 1 1
MIRT025625 TFAP2C transcription factor AP-2 gamma 2 3
MIRT025626 TRIM2 tripartite motif containing 2 2 4
MIRT025627 HOXB3 homeobox B3 2 5
MIRT047505 FUS FUS RNA binding protein 1 1
MIRT047506 LMBR1L limb development membrane protein 1 like 1 1
MIRT047507 HSP90AA1 heat shock protein 90 alpha family class A member 1 1 1
MIRT047508 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT047509 EXTL3 exostosin like glycosyltransferase 3 1 1
MIRT047510 POLR2A RNA polymerase II subunit A 1 1
MIRT047511 RIOK2 RIO kinase 2 1 1
MIRT047512 C12orf76 chromosome 12 open reading frame 76 1 1
MIRT047513 CCDC151 coiled-coil domain containing 151 1 1
MIRT047514 FAT2 FAT atypical cadherin 2 1 1
MIRT047515 TPI1 triosephosphate isomerase 1 1 1
MIRT047516 BTAF1 B-TFIID TATA-box binding protein associated factor 1 1 1
MIRT047517 MSANTD1 Myb/SANT DNA binding domain containing 1 1 1
MIRT047518 PLA2G4A phospholipase A2 group IVA 1 1
MIRT047519 IGSF1 immunoglobulin superfamily member 1 1 1
MIRT047520 LEMD3 LEM domain containing 3 1 1
MIRT047521 E2F1 E2F transcription factor 1 1 1
MIRT047522 KIF3B kinesin family member 3B 1 1
MIRT047523 GBAS nipsnap homolog 2 1 1
MIRT047524 LIMA1 LIM domain and actin binding 1 1 1
MIRT047525 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT047526 MRC2 mannose receptor C type 2 1 1
MIRT047527 TMEM106B transmembrane protein 106B 1 1
MIRT047528 ZFP30 ZFP30 zinc finger protein 1 1
MIRT047529 AMPD1 adenosine monophosphate deaminase 1 1 1
MIRT047530 SLC2A3 solute carrier family 2 member 3 1 1
MIRT047531 RPL15 ribosomal protein L15 1 1
MIRT047532 AGER advanced glycosylation end-product specific receptor 1 1
MIRT047533 CNTLN centlein 1 1
MIRT047534 C21orf59 chromosome 21 open reading frame 59 1 1
MIRT047535 SEPT9 septin 9 1 1
MIRT047536 COL6A2 collagen type VI alpha 2 chain 1 1
MIRT047537 MLNR motilin receptor 1 1
MIRT047538 RTKN2 rhotekin 2 1 1
MIRT047539 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT047540 CSNK2A1 casein kinase 2 alpha 1 2 3
MIRT047541 AQP12B aquaporin 12B 1 1
MIRT047542 AGBL2 ATP/GTP binding protein like 2 1 1
MIRT047543 GOLGA8A golgin A8 family member A 1 1
MIRT047544 CPED1 cadherin like and PC-esterase domain containing 1 1 1
MIRT047545 HSPA8 heat shock protein family A (Hsp70) member 8 1 1
MIRT047546 SLC41A3 solute carrier family 41 member 3 1 1
MIRT047547 KXD1 KxDL motif containing 1 1 1
MIRT047548 RELN reelin 1 1
MIRT047549 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT047550 PTPRT protein tyrosine phosphatase, receptor type T 1 1
MIRT047551 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT047552 CYP8B1 cytochrome P450 family 8 subfamily B member 1 1 1
MIRT047553 COL4A3 collagen type IV alpha 3 chain 1 1
MIRT047554 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT047555 MSL3 MSL complex subunit 3 1 1
MIRT047556 TTC7A tetratricopeptide repeat domain 7A 1 1
MIRT047557 COX7B cytochrome c oxidase subunit 7B 1 1
MIRT047558 ZNF318 zinc finger protein 318 1 1
MIRT047559 ACAA1 acetyl-CoA acyltransferase 1 1 1
MIRT047560 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT047561 SCAP SREBF chaperone 1 1
MIRT047562 KCTD11 potassium channel tetramerization domain containing 11 2 11
MIRT047563 RIOK3 RIO kinase 3 1 1
MIRT047564 C5 complement C5 1 1
MIRT047565 GLB1L3 galactosidase beta 1 like 3 1 1
MIRT047566 PAPD5 poly(A) RNA polymerase D5, non-canonical 1 1
MIRT047567 RNF123 ring finger protein 123 1 1
MIRT047568 ZNF629 zinc finger protein 629 1 1
MIRT047569 AMMECR1L AMMECR1 like 1 1
MIRT047570 KLHL6 kelch like family member 6 1 1
MIRT047571 SYMPK symplekin 1 1
MIRT047572 NCSTN nicastrin 1 1
MIRT047573 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 1
MIRT047574 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT047575 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 1
MIRT047576 RAB18 RAB18, member RAS oncogene family 1 1
MIRT047577 CUL3 cullin 3 1 1
MIRT047578 MTF2 metal response element binding transcription factor 2 1 1
MIRT047579 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT047580 NUP37 nucleoporin 37 1 1
MIRT047581 GPR98 adhesion G protein-coupled receptor V1 1 1
MIRT047582 RUNDC3B RUN domain containing 3B 1 1
MIRT047583 KIF21A kinesin family member 21A 1 1
MIRT047584 FEM1B fem-1 homolog B 1 1
MIRT047585 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT047586 PLA2G4F phospholipase A2 group IVF 1 1
MIRT047587 SNTB2 syntrophin beta 2 1 1
MIRT047588 NUB1 negative regulator of ubiquitin like proteins 1 1 1
MIRT047589 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT047590 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT047591 C11orf63 chromosome 11 open reading frame 63 1 1
MIRT047592 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT047593 CHRNA5 cholinergic receptor nicotinic alpha 5 subunit 1 1
MIRT047594 RPS9 ribosomal protein S9 1 1
MIRT047595 DDX42 DEAD-box helicase 42 1 1
MIRT047596 XPO7 exportin 7 1 1
MIRT047597 PYGL glycogen phosphorylase L 1 1
MIRT047598 TGFB3 transforming growth factor beta 3 1 1
MIRT047599 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT047600 PHB2 prohibitin 2 1 1
MIRT047601 ALDH1A2 aldehyde dehydrogenase 1 family member A2 1 1
MIRT047602 SLC3A2 solute carrier family 3 member 2 1 1
MIRT047603 POLR2H RNA polymerase II subunit H 1 1
MIRT047604 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT047605 MOB3C MOB kinase activator 3C 1 1
MIRT047606 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT047607 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT047608 INTS2 integrator complex subunit 2 1 1
MIRT047609 MYEF2 myelin expression factor 2 1 1
MIRT047610 PANK2 pantothenate kinase 2 1 1
MIRT047611 EMB embigin 1 1
MIRT047612 HK1 hexokinase 1 1 1
MIRT047613 UBE2Z ubiquitin conjugating enzyme E2 Z 1 1
MIRT047614 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT047615 HOXA3 homeobox A3 1 1
MIRT047616 NT5DC1 5'-nucleotidase domain containing 1 1 1
MIRT047617 YOD1 YOD1 deubiquitinase 1 1
MIRT047618 APRT adenine phosphoribosyltransferase 1 1
MIRT047619 C2CD2 C2 calcium dependent domain containing 2 1 1
MIRT047620 SHBG sex hormone binding globulin 1 1
MIRT047621 PPP1R12A protein phosphatase 1 regulatory subunit 12A 1 1
MIRT047622 SCD stearoyl-CoA desaturase 1 1
MIRT047623 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT047624 ETS1 ETS proto-oncogene 1, transcription factor 1 1
MIRT047625 GTF3C2 general transcription factor IIIC subunit 2 1 1
MIRT047626 NOP2 NOP2 nucleolar protein 1 1
MIRT047627 RPS29 ribosomal protein S29 1 1
MIRT047628 LAMC1 laminin subunit gamma 1 1 1
MIRT047629 GNAL G protein subunit alpha L 1 1
MIRT047630 KIAA1147 KIAA1147 1 1
MIRT047631 NACC2 NACC family member 2 1 1
MIRT047632 TMEM179B transmembrane protein 179B 1 1
MIRT047633 ARF3 ADP ribosylation factor 3 1 1
MIRT047634 MCPH1 microcephalin 1 1 1
MIRT047635 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT047636 UBN2 ubinuclein 2 1 1
MIRT047637 ANO6 anoctamin 6 1 1
MIRT047638 NEK7 NIMA related kinase 7 1 1
MIRT047639 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT047640 MED1 mediator complex subunit 1 1 1
MIRT047641 PTPRG protein tyrosine phosphatase, receptor type G 1 1
MIRT047642 ERMN ermin 1 1
MIRT047643 LYPD6 LY6/PLAUR domain containing 6 1 1
MIRT047644 SLC25A5 solute carrier family 25 member 5 1 1
MIRT047645 EPB41L2 erythrocyte membrane protein band 4.1 like 2 1 1
MIRT047646 ARFGEF1 ADP ribosylation factor guanine nucleotide exchange factor 1 1 1
MIRT047647 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT047648 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 1 1
MIRT047649 KLHL23 kelch like family member 23 1 1
MIRT047650 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT047651 HOXD13 homeobox D13 1 1
MIRT047652 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT047653 ZNF592 zinc finger protein 592 1 1
MIRT047654 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT047655 RRP1B ribosomal RNA processing 1B 1 1
MIRT047656 UHRF1 ubiquitin like with PHD and ring finger domains 1 1 1
MIRT047657 SORD sorbitol dehydrogenase 1 1
MIRT047658 PPM1G protein phosphatase, Mg2+/Mn2+ dependent 1G 1 1
MIRT047659 SF3B3 splicing factor 3b subunit 3 1 1
MIRT047660 PRPF8 pre-mRNA processing factor 8 1 1
MIRT047661 PRDX2 peroxiredoxin 2 1 1
MIRT047662 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT047663 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT047664 CAB39L calcium binding protein 39 like 1 1
MIRT047665 ATP5F1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1 1 1
MIRT047666 PARL presenilin associated rhomboid like 1 1
MIRT047667 ERLIN1 ER lipid raft associated 1 1 1
MIRT047668 MARS methionyl-tRNA synthetase 1 1
MIRT047669 TRPM7 transient receptor potential cation channel subfamily M member 7 1 1
MIRT047670 DLG4 discs large MAGUK scaffold protein 4 1 1
MIRT047671 WDR74 WD repeat domain 74 1 1
MIRT047672 PWP1 PWP1 homolog, endonuclein 1 1
MIRT047673 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT047674 NAP1L1 nucleosome assembly protein 1 like 1 1 1
MIRT047675 CTNND1 catenin delta 1 1 1
MIRT047676 IQCB1 IQ motif containing B1 1 1
MIRT047677 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT047678 CDK19 cyclin dependent kinase 19 1 1
MIRT047679 LRP3 LDL receptor related protein 3 1 1
MIRT047680 UBE2D2 ubiquitin conjugating enzyme E2 D2 1 1
MIRT047681 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT047682 GORASP2 golgi reassembly stacking protein 2 1 1
MIRT047683 DDX54 DEAD-box helicase 54 1 1
MIRT047684 CARHSP1 calcium regulated heat stable protein 1 1 1
MIRT047685 FAM168A family with sequence similarity 168 member A 1 1
MIRT047686 SF3B4 splicing factor 3b subunit 4 1 1
MIRT047687 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 1 1
MIRT047688 PLEKHB2 pleckstrin homology domain containing B2 1 1
MIRT047689 LRFN1 leucine rich repeat and fibronectin type III domain containing 1 1 1
MIRT047690 KIAA0100 KIAA0100 1 1
MIRT047691 DVL1 dishevelled segment polarity protein 1 1 1
MIRT047692 NOMO1 NODAL modulator 1 1 1
MIRT047693 MIS12 MIS12, kinetochore complex component 1 1
MIRT047694 GLOD4 glyoxalase domain containing 4 1 1
MIRT047695 USP11 ubiquitin specific peptidase 11 1 1
MIRT047696 UBE3C ubiquitin protein ligase E3C 1 1
MIRT047697 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT047698 SPARC secreted protein acidic and cysteine rich 1 1
MIRT047699 SLC26A2 solute carrier family 26 member 2 1 1
MIRT047700 MED12 mediator complex subunit 12 1 1
MIRT047701 FAM219B family with sequence similarity 219 member B 1 1
MIRT047702 GOSR2 golgi SNAP receptor complex member 2 1 1
MIRT047703 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT047704 PIAS3 protein inhibitor of activated STAT 3 1 1
MIRT047705 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT047706 COL4A2 collagen type IV alpha 2 chain 1 1
MIRT047707 NUP205 nucleoporin 205 1 1
MIRT047708 POLR3A RNA polymerase III subunit A 1 1
MIRT047709 ATG3 autophagy related 3 1 1
MIRT047710 COPA coatomer protein complex subunit alpha 1 1
MIRT047711 CD59 CD59 molecule (CD59 blood group) 1 1
MIRT047712 TENM3 teneurin transmembrane protein 3 1 1
MIRT047713 TUBA1A tubulin alpha 1a 1 1
MIRT047714 LSS lanosterol synthase 1 1
MIRT047715 FASN fatty acid synthase 4 1
MIRT047716 PSMD13 proteasome 26S subunit, non-ATPase 13 1 1
MIRT047717 ZNF618 zinc finger protein 618 1 1
MIRT047718 TSPAN33 tetraspanin 33 1 1
MIRT047719 KANK1 KN motif and ankyrin repeat domains 1 1 1
MIRT047720 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT047721 DPYSL2 dihydropyrimidinase like 2 1 1
MIRT047722 SUPT6H SPT6 homolog, histone chaperone 1 1
MIRT047723 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT047724 ACTG1 actin gamma 1 3 2
MIRT047725 PLSCR1 phospholipid scramblase 1 1 1
MIRT047726 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT047727 SFPQ splicing factor proline and glutamine rich 1 1
MIRT047728 VDAC1 voltage dependent anion channel 1 1 1
MIRT047729 ADCY9 adenylate cyclase 9 1 1
MIRT047730 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT047731 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 1 1
MIRT047732 SLC25A13 solute carrier family 25 member 13 1 1
MIRT047733 IGSF9B immunoglobulin superfamily member 9B 1 1
MIRT047734 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047735 MCU mitochondrial calcium uniporter 1 1
MIRT047736 CDK8 cyclin dependent kinase 8 1 1
MIRT047737 CEP128 centrosomal protein 128 1 1
MIRT047738 TRAPPC12 trafficking protein particle complex 12 1 1
MIRT047739 SYNJ1 synaptojanin 1 1 1
MIRT047740 NOB1 NIN1/PSMD8 binding protein 1 homolog 1 1
MIRT047741 AP5S1 adaptor related protein complex 5 sigma 1 subunit 1 1
MIRT047742 RNF213 ring finger protein 213 1 1
MIRT047743 PSMB1 proteasome subunit beta 1 1 1
MIRT047744 BCR BCR, RhoGEF and GTPase activating protein 1 1
MIRT047745 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT047746 NPTX1 neuronal pentraxin 1 1 1
MIRT047747 PRRC2C proline rich coiled-coil 2C 1 1
MIRT047748 PABPC3 poly(A) binding protein cytoplasmic 3 1 1
MIRT047749 NF2 neurofibromin 2 1 1
MIRT047750 RALBP1 ralA binding protein 1 1 1
MIRT047751 EHD4 EH domain containing 4 1 1
MIRT047752 RLIM ring finger protein, LIM domain interacting 1 1
MIRT076413 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT084600 BCL2L11 BCL2 like 11 3 5
MIRT093335 RAPGEF2 Rap guanine nucleotide exchange factor 2 2 2
MIRT097757 ARSK arylsulfatase family member K 2 2
MIRT099597 ID4 inhibitor of DNA binding 4, HLH protein 2 6
MIRT249192 RAP2A RAP2A, member of RAS oncogene family 2 1
MIRT299201 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT437577 ZFAND5 zinc finger AN1-type containing 5 2 1
MIRT437578 CNST consortin, connexin sorting protein 2 1
MIRT437579 TIAM1 T-cell lymphoma invasion and metastasis 1 2 1
MIRT438258 PTEN phosphatase and tensin homolog 2 2
MIRT438408 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT448051 SFRP1 secreted frizzled related protein 1 2 2
MIRT459965 POC1A POC1 centriolar protein A 2 2
MIRT466175 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT470412 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT475883 H3F3C H3 histone family member 3C 2 10
MIRT475919 H3F3B H3 histone family member 3B 2 8
MIRT493173 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT497272 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT507101 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508100 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT508628 PLA2G2C phospholipase A2 group IIC 2 2
MIRT510735 SON SON DNA binding protein 2 6
MIRT513973 CNOT6 CCR4-NOT transcription complex subunit 6 2 2
MIRT514262 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT514577 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 4
MIRT515044 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515692 TFPI tissue factor pathway inhibitor 2 2
MIRT515752 ONECUT3 one cut homeobox 3 2 2
MIRT517389 METTL7A methyltransferase like 7A 2 2
MIRT519732 ZNF460 zinc finger protein 460 2 2
MIRT520247 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT520270 URGCP upregulator of cell proliferation 2 2
MIRT522213 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT523700 FHL2 four and a half LIM domains 2 2 4
MIRT523978 DVL3 dishevelled segment polarity protein 3 2 2
MIRT525569 MTRNR2L7 MT-RNR2-like 7 2 6
MIRT525619 MTRNR2L3 MT-RNR2-like 3 2 4
MIRT530223 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT530549 SYNPO synaptopodin 2 2
MIRT531041 ZNF502 zinc finger protein 502 2 2
MIRT532579 GSS glutathione synthetase 2 2
MIRT534840 RAB15 RAB15, member RAS oncogene family 2 2
MIRT535793 MTRNR2L11 MT-RNR2-like 11 2 6
MIRT535811 MTRNR2L10 MT-RNR2-like 10 2 4
MIRT536818 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT539894 IRGQ immunity related GTPase Q 2 2
MIRT540209 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT540951 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541937 ORC1 origin recognition complex subunit 1 2 4
MIRT542195 FUT1 fucosyltransferase 1 (H blood group) 2 6
MIRT542374 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542508 WDR13 WD repeat domain 13 2 2
MIRT542575 ZNF280B zinc finger protein 280B 2 2
MIRT542714 RPS15A ribosomal protein S15a 2 2
MIRT546705 RORA RAR related orphan receptor A 5 4
MIRT549929 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550162 ZNF223 zinc finger protein 223 2 4
MIRT558566 CRLF3 cytokine receptor like factor 3 2 4
MIRT560945 TPM4 tropomyosin 4 2 4
MIRT574848 CADM1 cell adhesion molecule 1 2 2
MIRT575176 Atg9a autophagy related 9A 2 2
MIRT576664 Fam216a family with sequence similarity 216, member A 2 2
MIRT609434 MTX3 metaxin 3 2 2
MIRT612162 TCF15 transcription factor 15 2 2
MIRT617414 API5 apoptosis inhibitor 5 2 2
MIRT617469 CCS copper chaperone for superoxide dismutase 2 2
MIRT618780 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618835 PHF20 PHD finger protein 20 2 2
MIRT619339 RNF2 ring finger protein 2 2 2
MIRT625244 C6orf89 chromosome 6 open reading frame 89 2 2
MIRT626439 CHDH choline dehydrogenase 2 2
MIRT634929 CHMP1B charged multivesicular body protein 1B 2 2
MIRT635875 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636235 SLC24A4 solute carrier family 24 member 4 2 2
MIRT636641 CHAF1B chromatin assembly factor 1 subunit B 2 2
MIRT640545 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT648661 ALKBH4 alkB homolog 4, lysine demethylase 2 2
MIRT650186 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT650790 GSR glutathione-disulfide reductase 2 2
MIRT652027 TTYH3 tweety family member 3 2 2
MIRT652517 TMEM109 transmembrane protein 109 2 2
MIRT661940 MAVS mitochondrial antiviral signaling protein 2 2
MIRT661951 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT662020 ZNF445 zinc finger protein 445 2 2
MIRT664015 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT664059 KIAA1551 KIAA1551 2 2
MIRT666872 POU2F2 POU class 2 homeobox 2 2 2
MIRT669168 CCNG1 cyclin G1 2 2
MIRT673243 KLHDC8A kelch domain containing 8A 2 2
MIRT680410 SFT2D2 SFT2 domain containing 2 2 2
MIRT680484 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT683577 CARD8 caspase recruitment domain family member 8 2 2
MIRT684398 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT684558 ZNF708 zinc finger protein 708 2 2
MIRT685421 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT686050 SLC5A5 solute carrier family 5 member 5 2 2
MIRT687955 HHIP hedgehog interacting protein 2 2
MIRT688181 FRRS1 ferric chelate reductase 1 2 2
MIRT688303 FAM208A family with sequence similarity 208 member A 2 2
MIRT688900 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT689205 ZNF574 zinc finger protein 574 2 2
MIRT689917 ACOT13 acyl-CoA thioesterase 13 2 2
MIRT692931 EXOSC2 exosome component 2 2 2
MIRT693632 CENPL centromere protein L 2 2
MIRT694762 FZD2 frizzled class receptor 2 2 2
MIRT695373 PHAX phosphorylated adaptor for RNA export 2 2
MIRT696630 WDR77 WD repeat domain 77 2 2
MIRT696690 APOC3 apolipoprotein C3 2 2
MIRT697367 ZNF394 zinc finger protein 394 2 2
MIRT697611 XIAP X-linked inhibitor of apoptosis 2 2
MIRT697737 USP6NL USP6 N-terminal like 2 2
MIRT697788 UBXN7 UBX domain protein 7 2 2
MIRT698361 TMEM127 transmembrane protein 127 2 2
MIRT704519 CNKSR3 CNKSR family member 3 2 2
MIRT704600 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT705849 AHCY adenosylhomocysteinase 2 2
MIRT707093 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT707154 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT707243 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT707356 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT707459 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707503 AXL AXL receptor tyrosine kinase 2 2
MIRT707647 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT707703 FAM118A family with sequence similarity 118 member A 2 2
MIRT707714 CDC6 cell division cycle 6 2 2
MIRT707825 TMEM170A transmembrane protein 170A 2 2
MIRT707966 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT708006 NUDT4 nudix hydrolase 4 2 2
MIRT708035 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT708073 LIX1L limb and CNS expressed 1 like 2 2
MIRT708131 GK5 glycerol kinase 5 (putative) 2 2
MIRT708200 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT708210 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT708940 CRY2 cryptochrome circadian clock 2 2 2
MIRT709199 SAPCD2 suppressor APC domain containing 2 2 2
MIRT714403 FBXO31 F-box protein 31 2 2
MIRT714629 KIAA1143 KIAA1143 2 2
MIRT720741 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT720894 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT723335 DGAT1 diacylglycerol O-acyltransferase 1 2 2
MIRT724452 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT731180 SERPINE1 serpin family E member 1 3 1
MIRT732377 GP1BA glycoprotein Ib platelet alpha subunit 2 1
MIRT733585 SDC1 syndecan 1 3 0
MIRT734393 ARNTL aryl hydrocarbon receptor nuclear translocator like 3 0
MIRT735361 BDNF brain derived neurotrophic factor 4 0
MIRT735799 MAP2K6 mitogen-activated protein kinase kinase 6 3 0
MIRT735868 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736834 SKA1 spindle and kinetochore associated complex subunit 1 3 0
MIRT737248 LEF1-AS1 LEF1 antisense RNA 1 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-10a RAR-alpha antagonist Ro-41-5253 NULL NULL Northern blot pancreatic cancer 19747919 2009 down-regulated
miR-10a 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-10a Oxaliplatin (L-OHP) approved 5310940 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-10a Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells HT-29 cells 20955366 2011 down-regulated
miR-10a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Microarray acute myeloid leukemia (AML) cell line HL-60 21518431 2011 down-regulated
miR-10a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Quantitative real-time PCR regulatory T cells (T(reg) cells) 22544395 2012 up-regulated
miR-10a Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-10a Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Northern blot fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Quantitative real-time PCR fetal mouse brains 19091803 2009 up-regulated
miR-10a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 up-regualted
miR-10a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-10a-5p Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-10a-5p Comfrey NULL 6440495 Microarray rat liver 21370286 2011 down-regulated
miR-10a-5p Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-10a-5p Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-10a-5p Acarbose Approved 444254 Microarray diabetic rats cells 24260283 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-10a Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-10a Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-10a Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-10a Tamoxifen 2733525 NSC180973 approved sensitive tissue (ER-positive breast cancer)
hsa-mir-10a Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-10a-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 resistant
hsa-miR-10a-5p (3aR)-7-[3-[4-[3-[[(3aR)-8-methoxy-10-oxo-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-7-yl]oxy]propyl]piperazin-1-yl]propoxy]-8-methoxy-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-10-one 24202913 NSC726262 resistant
hsa-miR-10a-5p (4z,6z)-4,6-dibenzylidene-2,2-dimethyl-1,3-dioxan-5-one 5387558 NSC624512 resistant
hsa-miR-10a-5p (5e)-5-benzylidene-3-(2,4,5-trichlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470506 NSC702355 resistant
hsa-miR-10a-5p (6e,7r,8r,8as)-8-methyl-6-[(2r)-2-methylhexylidene]-8-phenylmethoxy-1,2,3,5,7,8a-hexahydroindolizin-7-ol 5470307 NSC699382 resistant
hsa-miR-10a-5p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 resistant
hsa-miR-10a-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-[4-(diethylamino)phenyl]prop-2-en-1-one 5471159 NSC709103 resistant
hsa-miR-10a-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 resistant
hsa-miR-10a-5p (e)-2-methyl-1-[2-(2-methyl-1h-indol-3-yl)indolin-1-yl]but-2-en-1-one 5388204 NSC633484 resistant
hsa-miR-10a-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-(cyclohexanecarbonylamino)-3-cyclohexyl-2-hydroxypropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10 383477 NSC671869 resistant
hsa-miR-10a-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-10a-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-10a-5p [(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-26-[(E)-[(2,4-dinitrophenyl)hydrazinylidene]methyl]-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12,14,16,18,22-heptamethyl-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta-1(29),2,4,9,19,21, 135483937 NSC144126 resistant
hsa-miR-10a-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-2-oxo-6-phenylpyridin-1-yl]oxan-2-yl]methyl acetate 368873 NSC640212 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-phenyl-2,4-bis(sulfanylidene)quinazolin-1-yl]oxan-2-yl]methyl acetate 368629 NSC639741 resistant
hsa-miR-10a-5p [4-[[dimethyl(octadecyl)azaniumyl]methyl]phenyl]methyl-dimethyl-octadecylazanium;bromide 361976 NSC625458 resistant
hsa-miR-10a-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] acetate 9555726 NSC144055 resistant
hsa-miR-10a-5p 1-(dimethylamino)-4-methyl-4H-pyrido[3,4-g]quinoline-5,10-dione 388892 NSC684118 sensitive
hsa-miR-10a-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 resistant
hsa-miR-10a-5p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 resistant
hsa-miR-10a-5p 1-[7-methyl-8-(3,4,5-trimethoxyphenyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]piperazine 384846 NSC675364 resistant
hsa-miR-10a-5p 10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2,4,6,8,11(19),12,14(18)-heptaene-15,17-dione 399629 NSC710546 sensitive
hsa-miR-10a-5p 1h-pyrimido[4,5-b]quinoline-2,4-dithione 5472868 NSC722222 resistant
hsa-miR-10a-5p 2-(11h-indolo[3,2-c]quinolin-6-ylamino)ethanol NSC736606 sensitive
hsa-miR-10a-5p 2-(2-chlorophenyl)-5,7-dihydroxy-8-(3-hydroxy-1-methylpiperidin-4-yl)chromen-4-one 5466794 NSC642740 resistant
hsa-miR-10a-5p 2-trans-n-buten-1-yl-estradiol 5468334 NSC669229 resistant
hsa-miR-10a-5p 2,5-diphenyl-1h-[1,2,4]triazino[4,3-a]quinoxaline 399102 NSC709518 resistant
hsa-miR-10a-5p 3-(((cyclohexylamino)carbonyl)oxy)-4-methyl-1,3-thiazole-2(3h)-thione 372703 NSC648263 resistant
hsa-miR-10a-5p 3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-phenyl-3,4-dihydropyrazole-2-carbaldehyde 155810020 NSC762559 resistant
hsa-miR-10a-5p 3,3,4,4,4-pentachloro-1-phenylbutan-1-one 405828 NSC723515 sensitive
hsa-miR-10a-5p 4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 374328 NSC651852 resistant
hsa-miR-10a-5p 4-appt 5995211 NSC195327 resistant
hsa-miR-10a-5p 4-methyl-3-[4-[2-[4-(4-methyl-5-sulfanylidene-1h-1,2,4-triazol-3-yl)phenyl]iminohydrazinyl]phenyl]-1h-1,2,4-triazole-5-thione 5472009 NSC715974 resistant
hsa-miR-10a-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 resistant
hsa-miR-10a-5p 5'-chloro-2'-methoxy-3-nitrosalicylanilide 186169 NSC79459 resistant
hsa-miR-10a-5p 5,6-dimethoxy-9-(methylthio)furo[3',4':4,5]cyclopenta[1,2,3-ij]isoquinoline 363754 NSC628946 resistant
hsa-miR-10a-5p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-10a-5p 6-(chloromethyl)-2-oxo-N-pentylchromene-3-carboxamide 402500 NSC716526 sensitive
hsa-miR-10a-5p 6-methoxy-1h-pyrazolo[3,4-b]quinoxalin-3-amine 395806 NSC700694 resistant
hsa-miR-10a-5p 6,7-diacetoxyisoflavan 353129 NSC600289 resistant
hsa-miR-10a-5p 8-[(4-tert-butylphenoxy)methyl]-1,3-dimethyl-7H-purine-2,6-dione 235292 NSC36525 resistant
hsa-miR-10a-5p 8455ab 1549990 NSC24189 resistant
hsa-miR-10a-5p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 resistant
hsa-miR-10a-5p Antibiotic p 168 5477807 NSC356885 resistant
hsa-miR-10a-5p Antineoplastic-656904 376224 NSC656904 resistant
hsa-miR-10a-5p Aquatris(1,3-diphenylpropane-1,3-dionato)neodymium(iii) 24202395 NSC647040 resistant
hsa-miR-10a-5p Bas100 monohydrate 45028404 NSC742554 resistant
hsa-miR-10a-5p Berberine iodide 72350 NSC150446 resistant
hsa-miR-10a-5p Bindschedler's green 73516 NSC7811 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p C4, carbonyl, ethyl prodigiosine 135540855 NSC742416 resistant
hsa-miR-10a-5p Cgp 57380 11644425 NSC741567 sensitive
hsa-miR-10a-5p Cinerubin a hcl 5458466 NSC243022 sensitive
hsa-miR-10a-5p Cis-dichlorobis(4-methoxyphenethylamine)platinum(ii) 498558 NSC631305 resistant
hsa-miR-10a-5p Cis-difluorobis(1-phenylhexane-1,3-dionato)titanium(iv) NSC637220 resistant
hsa-miR-10a-5p Cyano-[4-[[[3-(trifluoromethyl)phenyl]methylamino]carbamoyl]pyridin-1-ium-1-yl]boron 6334922 NSC698276 resistant
hsa-miR-10a-5p Cytembena 23663958 NSC104801 resistant
hsa-miR-10a-5p Cytovaricin 5477715 NSC349622 resistant
hsa-miR-10a-5p Diethyl 2-[[4-[[[3-ethoxycarbonyl-7-(trifluoromethyl)quinoxalin-2-yl]amino]methyl]benzoyl]amino]pentanedioate 390810 NSC688812 resistant
hsa-miR-10a-5p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-10a-5p Echinomycin 3197 NSC526417 resistant
hsa-miR-10a-5p Ethyl 2-((4-(2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494007 NSC691084 resistant
hsa-miR-10a-5p Ethyl 2-((4-(6-bromo-2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494008 NSC691085 resistant
hsa-miR-10a-5p Ethyl 5-amino-4-(3,4-dihydro-2h-1,5-benzodioxepin-7-ylamino)-2-methylsulfanylthieno[2,3-d]pyrimidine-6-carboxylate 399955 NSC711107 resistant
hsa-miR-10a-5p From combretum caffrum plant 5386397 NSC609397 resistant
hsa-miR-10a-5p Kuc100204 378309 NSC660313 resistant
hsa-miR-10a-5p Lddhtajmmdseme-okkqscsosa-n 6712634 NSC702655 sensitive
hsa-miR-10a-5p Ls-77867 395636 NSC700418 resistant
hsa-miR-10a-5p Methyl (1s,10r)-6-methyl-10-nonyl-7,9,12-triazatricyclo[6.3.1.04,12]dodeca-5,8-diene-5-carboxylate 401693 NSC715423 resistant
hsa-miR-10a-5p Methyl 3-butylsulfanyl-2-[[(e)-3-(6-methyl-2,4-dioxo-1h-pyrimidin-5-yl)prop-2-enoyl]amino]propanoate 5383838 NSC201241 resistant
hsa-miR-10a-5p Mggh 5351153 NSC32946 resistant
hsa-miR-10a-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 resistant
hsa-miR-10a-5p N-[3-bromo-6-oxo-1-(4-phenylpiperidin-1-yl)-4,5-dihydrocyclopenta[c]thiophen-4-yl]-2,2,2-trifluoroacetamide 378804 NSC662123 resistant
hsa-miR-10a-5p NSC657492 NSC657492 sensitive
hsa-miR-10a-5p NSC751830 NSC751830 sensitive
hsa-miR-10a-5p Plumericin 5281545 NSC112152 resistant
hsa-miR-10a-5p Propan-2-yl (1r,9s,12e)-3,4,6-trimethoxy-11-[(4-methoxyphenyl)methyl]-5-methyl-10-oxo-12-[(2,4,5-trimethoxy-3-methylphenyl)methylidene]-11,13-diazatricyclo[7.3.1.02,7]trideca-2(7),3,5-triene-13-carbox 6330789 NSC622075 resistant
hsa-miR-10a-5p Resorufin 69462 NSC12097 resistant
hsa-miR-10a-5p Rhamnazin 5320945 NSC678106 resistant
hsa-miR-10a-5p Roridin a, 8-hydroxy-9b,10b-epoxy- 5458716 NSC327993 resistant
hsa-miR-10a-5p Sb-236687 17892742 NSC756422 sensitive
hsa-miR-10a-5p Sergeolide,desacetyl 125729 NSC364170 resistant
hsa-miR-10a-5p Sodium;4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 54612576 NSC651853 resistant
hsa-miR-10a-5p Tert-butyl n-[6-[2-[(2-amino-2-oxoethyl)carbamoyl]pyrrolidin-1-yl]-5-(9h-fluoren-9-ylmethoxycarbonylamino)-6-oxohexyl]carbamate 383818 NSC672434 sensitive
hsa-miR-10a-5p Tetra(isobutenyl)antimony bromide NSC651199 resistant
hsa-miR-10a-5p Tributylgermyl 2-acetoxy-2-phenyl-acetate 16683233 NSC645575 resistant
hsa-miR-10a-5p Verrucarin a 9,10-epoxide 5358836 NSC283445 sensitive
hsa-miR-10a-5p Z28714792 2671841 NSC746248 resistant
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-10a-5p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Esophageal Squamous Cell Carcinoma tissue and cell line (TE1, TE5, TE8, TE9, TE10, TE11, TE13)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PaCa-2)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Vinorelbine 44424639 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-10a-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-10a-5p Cytarabine 6253 NSC287459 approved sensitive Low Acute Myeloid Leukemia tissue and cell line (KG-1a, Kasumi-1, K562, OCI-AML3)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant Low Acute Myeloid Leukemia tissue and cell line (HL-60)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (HepG2, Huh-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Small Cell Lung Cancer cell line (H446)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-10a-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-10a-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (W1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (TE1, KYSE450)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3ip1, HeyA8)
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (A172)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HS578T)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-10a-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-10a-5p Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-10a-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Methotrexate 126941 NSC740 approved sensitive cell line (HT29)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-10a-5p Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission