miRTarBase - #MIRT025599


—
pre-miRNA Information
pre-miRNA hsa-mir-10a   
Genomic Coordinates chr17: 48579838 - 48579947
Synonyms MIRN10A, hsa-mir-10a, miRNA10A, mir-10a, MIR10A
Description Homo sapiens miR-10a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-10a-5p
Sequence 22| UACCCUGUAGAUCCGAAUUUGUG |44
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30152819 13 COSMIC
COSN30458892 14 COSMIC
COSN23023008 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1333990950 2 dbSNP
rs770328167 3 dbSNP
rs1453440972 5 dbSNP
rs1391955925 7 dbSNP
rs1157653116 8 dbSNP
rs760091682 10 dbSNP
rs1161287321 12 dbSNP
rs369632753 13 dbSNP
rs985848773 14 dbSNP
rs772649724 18 dbSNP
rs529115879 22 dbSNP
rs375865628 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B6HZE2 miR-10a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Muscle Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol LHFPL4   
Synonyms -
Description LHFPL tetraspan subfamily member 4
Transcript NM_198560   
Expression
Putative miRNA Targets on LHFPL4
3'UTR of LHFPL4
(miRNA target sites are highlighted)		 
>LHFPL4|NM_198560|3'UTR
   1 AAGGCCAGGATCACAGCCCAGTAATTGGCCTGACCTCAGCTTGTCCTGCCTTCTGCCCTCTCGTCACTCCATTCAAGCTC
  81 TGAGGGAAGACCCTGATCTCAGACTTACTTCTCACCGACTACCCTGCAAGCTCCAGGCTTTGAGGAGAGGAAAGCCTGGA
 161 TGTGGCCTGGGGGAGAGGAGAGGCCCTCCAAACCTTGGGAGGGTCTAATTCTTGCTCCTCCCTCAATTTGACCTAAGGGA
 241 GCCTGCATCTGCGTAGGCCCTTGGGCTTCTCCTCTCCTCTCTAGACTGGCCTGGAGGTCCCTGCAGATCCCCAGGGAGAG
 321 CGGAGCTGTAGTTCCAGCTCCCCAGGCCCCCTCAGTCTGGAGGGCTGCCGCCTGGCTGTATCCGCACCTCTTCTGGTCCC
 401 TGCCTCTTCAAGAAATTTATTCTAGATACTGCTCCAGGGTGGGCTGGACTCTTTCCTACTTTTTTTTTTTTTCTTTTTTG
 481 GCTGATGTTGGTTCCACCACATCTGCCACAAAGCTCCAGGTGCCACCAGTCTCCCCTGGGACCTCCTCTGCTCCATTCCG
 561 GCCTGCTCCCAGCTCACCCTGAGGGAGAGCTGCACCGAGGGATGCACAGGGCCCTGCTGTCAGCTGCAGACCGGGGCCCT
 641 GATCAGCCCAGAGTCAGAAAAGACTTTCAGGCTCTGGAGGTAGCGGGAGGGGGTACGTGGCCTCGGCAGTTGGAGCTTAG
 721 AAGCTGCTCAGCCCGGGCTGGCCTGGCCTCCTCTTCCTCTCTGCTGGAACATCTCACTGATGACTGAGCCCTTGACCTTG
 801 GCCTCTTTTGCCCAGGCCTCCTCTCTGCTGGGATGTCTCACCAATGACTGGACCCTTGACCCTGGCCTGTTTTGTACAGC
 881 ACAGACTTCTTGGCCCTGTTGTCAGGGTTGGGGGTGTGGAGGGGACCCCAGAGGTGGGGAGTTGGGGGATGCATTACCCC
 961 TTCTGCCCCTTTTCATGCCCTCCATACCCCAGGCGTCTACCAAGGGCAGAGACTGTCTTGTCTCTTTGATACTTTTCTGC
1041 ATAACTTGAACTTGCAGGTCATCTCTGAACAGGGTACCCCTGTCCCCCTTCCTAAGCCTTGTTACCCTGTCCCAGCCTCT
1121 TCCTCCTCCTGGCCCACCTCTCGCCTTGCGATATGCCCAGGGTCTGCACCTATGGGCAGTGCTTGGAGCCGAGGCATGAG
1201 TGTATGTGTATGTGGGTGAAATGTGTGTGCGTGTGTGTGCGCGTGTGAGCGTGTGTGTGTGTGTGTGTGTTGGGGGACAG
1281 GTGAGAAGTTTCTCCCCCCTCCACCCACTGTGGGGGCGTCTCCCTTCCCCTTGGCAGGGAGCAGGTGAGGGAGACTCCTG
1361 GTATTTTTTGAACACCCGTCATTCCCCTGTGGGTCTGGCGGCAGAGCCATCTCTCCCGGGGAGCCTCCCTGCCCTGGGGC
1441 CTGGACAGCTCCCTCAGCACTAGTTGCTGGTGCAGACCGGCTTCGTCCAGCGCCCCCTCCTGGCGGCCTGGACCTGCAGG
1521 GAAGGGGCGGTGCCCTGCAGGATGCCAGGGGAAGCCGCCTCGGGCCTCGGCGGAGGGGAGAGGGTCGCTTGAGCGCCATG
1601 TGTTTGCCAACCTTGTGTTCATTTCCACAGGACTTGGACCTGAGAGTTAGGGTTTCCAAGAAAGACCCTAGAAGTCCCCT
1681 GCCTGTCTCCCCACTCTGGACCCTAGCCGGAATCAGATGTTGGGACCTAGTGGGTTCCTGCCACCTGGAACTTACCAAGT
1761 CCCGACTTCACTCCTCCACTTACTCCTCCCGGGCAAAGCCTCCCCGCAGTGCTCTGGTCCCAGCGCTGGGCTCCCCTTCC
1841 CCGCCGGCGCCTTCCCGGACAGTCCAGTCGGCCTGGGGTAGGGGCGCTGCGGGACAGAGGGTCCGAGTTAAATGCGGGAG
1921 GATGCGGGAGCCCCGTGGGAGGGAGTTGGGGTAGGAGGGAGTTCCTCAAAGATGCAAACCAAGCCCAGCGTTGGAGGGGG
2001 AGAGCAGAGTTAGGAGAGAGTGAGGGGAGGGGCGCAGCAAGCGACTGGGAATGGGAGAAGACACTGGGGTGAGGAGAAGA
2081 GGGGTGCAGAGACAGGGAGATGAGAGATGATTGGAGAAGGAGCGAGGGGGACGCACAGGCACAGAGAAACAGCGCGAGGA
2161 GGAGAGATCGAGAGAGACGGGGCAGAGGTGGAGAGAGATGAGAGACCAGCTGAGAGGCTGCCCGAGAGCTTGGGGTGGGG
2241 GAGGGGAAATGGATGAAAAGGCGGAAAAAGGACTCGGGAGCGGGGAAGAGGTAAATGGAGATGTGGGTTGGGGGCAAGAA
2321 TGGGATGCAGAGGAAGGAGAGGAGGATGAAGGAGCCAGGATGCGGGGCAGTGGGGAGGGGGTTGCTATCTGGGCACTGGG
2401 TGAGGGGAGAGCTTGTTCCCCCAAGGACGCCTGCCACCAGGTGTCCTTGCCACACCTTGTTCCCCAAGGACACCCACCAA
2481 ACCTGTGCCCTGGTGCGGGGGATAGAACTGACCTTTCAGAGGCTGGAGGCCCGGGGCACAGGCAGCCAAGGCCGCATCCT
2561 TTTGGGAAGAACTGGAGTGAAGGAAGCCACTTCAGAGGACGTAGTGGGTCCAGCTGACTTAGGAGTGGGTCAGCGCCGGG
2641 TGGAGAGGAGGGAGGCTAGTTCCCTGGTGGGGTAGCCTGGCAACATTCCCATTCCACCGCACCTGGCCAGCTGCCATCTT
2721 GGCAGAGCCAGGGGGAGATGCACCAGGGAGTTTGGAGTCAGGAAGGCAGAGTTGTGTGGGCTGAAGTCTGCGGGAACCCC
2801 AGGGTGACACAGGCAAGGGGTAGAAGTCAGAGTGGGGACCAAACCATAGACTGGGGCCCTGGGTTCTGCAGAGGTGTGGA
2881 TGGGGCAGGTGGCAGGTGCTCCAGTGGGGGCCCCAGGTGAGGCCCTGATGGCCCTCCTGGGGCAATAAAGACATCATGGG
2961 AAGGGGGCTTTGTGGTTTGCCTCTGCTCTCGTCGGGCGATCTGGCTTTAGCCTTCAGGAGGAGGTAAGCAGAGGAGATCA
3041 GTGCCTGTTTCTGACCCCAGGAGGGCCTTGTTGGGCTCCAACCTAGAGCCTTCCGGCTTCAGGTCCCAAGAGAAGTCCCC
3121 CCCTAACTGTGACCCCCCTAACTGTGATCAGGGGTCTGCCATTGCCCGCTTTTCTCTGCCTGATCTGGGGACTCAGGAGA
3201 GGCCACGGCAGCCACAGCCTAGGGGTGGTTCAGTCCCTGGCCCACAGTCTGGTCAGTTGAGTCCTTCTGGGAACCGGGGC
3281 TATGAAAACTTTCGTCTTTGGGGACCGGTACCCATGAAGGAAAACTTTCCTGAGGGGGTGAGGACCAAAGAATCAAGATC
3361 CTTTTCAGGCCTGATAGCCAAGATGATGAGAACTTTTAGATAAGGCTGTGGGGAGAGTCCCTGGCCTTTTGAGCATCCTG
3441 CTTGGGCACACGGGGAATAACCTTTCTCCAGCTTCCAGTGTGAACTGAGAAAGAGAAAGGGAAACCCTGTCTTTGGAGAA
3521 GCTGGGATGTTCCCAGCACCAGAAACTTCTGCAGGCCCCTGCCTGGCCCACGGCTAACCTTTGGGTGGGACTGGAGTTTC
3601 CTGAACAGGGAACAAGGGAGCCTTCCGCAGAGCTCTGATGGGCAGGCCTCCGAGGGCCTGTGCTGTGTGCTGTTAGGATA
3681 GCTTGGTGTTGTCTATACCCCATTAGTAAGTTTTGTCTGAGTGTGTCCTCGCTGTTCATTGTCTAATTTGGTAACATTTA
3761 TTTTGGTCCTGACCCCTTCTGCTGCTGCTGGGTTTAAGCTTCAGTGCAGGTGGAATGACATTCAAATAAAGAAACACTTT
3841 CTATCACCCAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gugUUUAA-G-CC--UAGA----UGUCCCAu 5'
             || || | ||  ||||    ||||||| 
Target 5' ttgAACTTGCAGGTCATCTCTGAACAGGGTa 3'
 1046 - 1076 152.00 -14.70
2 
miRNA  3' guguuuaagCCUAGAUGUCCCau 5'
                   ||||  ||||||  
Target 5' tgcaccgagGGATGCACAGGGcc 3'
 591 - 613 134.00 -16.30
3 
miRNA  3' guGUUUAAGCCUAGAUGUCCCAu 5'
            :|:|| | | ||  |||||| 
Target 5' tcTAGATACTGCTC--CAGGGTg 3'
 421 - 441 132.00 -12.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31482944 19 COSMIC
COSN30161085 32 COSMIC
COSN32054047 37 COSMIC
COSN30459497 38 COSMIC
COSN30459533 39 COSMIC
COSN30105487 43 COSMIC
COSN31612488 56 COSMIC
COSN31571573 62 COSMIC
COSN31558937 89 COSMIC
COSN31582335 98 COSMIC
COSN31518831 161 COSMIC
COSN19767184 196 COSMIC
COSN7718122 383 COSMIC
COSN27234263 460 COSMIC
COSN9579534 1406 COSMIC
COSN8930443 1649 COSMIC
COSN1973013 1738 COSMIC
COSN29102360 1885 COSMIC
COSN1283511 1955 COSMIC
COSN9896234 2126 COSMIC
COSN1283510 2156 COSMIC
COSN25752961 2211 COSMIC
COSN9579528 2454 COSMIC
COSN29576457 2994 COSMIC
COSN31571575 3390 COSMIC
COSN31486862 3415 COSMIC
COSN28681808 3529 COSMIC
COSN26595850 3811 COSMIC
COSN31481102 3823 COSMIC
rs62246343 253 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750647424 3 dbSNP
rs775313565 4 dbSNP
rs771659111 5 dbSNP
rs1461235662 7 dbSNP
rs745416719 13 dbSNP
rs778310347 16 dbSNP
rs770268127 17 dbSNP
rs1176373646 21 dbSNP
rs748529781 25 dbSNP
rs781473798 27 dbSNP
rs546734156 30 dbSNP
rs958171433 32 dbSNP
rs1346521280 34 dbSNP
rs1277495337 37 dbSNP
rs1176199944 43 dbSNP
rs1301956815 44 dbSNP
rs751743950 46 dbSNP
rs1318004730 47 dbSNP
rs1306783923 48 dbSNP
rs1413454741 49 dbSNP
rs1404908745 54 dbSNP
rs1345502465 62 dbSNP
rs147362945 63 dbSNP
rs1464845821 64 dbSNP
rs1298288324 69 dbSNP
rs1306142774 72 dbSNP
rs1000147070 81 dbSNP
rs1292823009 93 dbSNP
rs1361825879 102 dbSNP
rs750875015 104 dbSNP
rs1200158493 107 dbSNP
rs1486189922 108 dbSNP
rs999787907 108 dbSNP
rs1019060724 111 dbSNP
rs1427726059 112 dbSNP
rs1165164954 116 dbSNP
rs1008559419 117 dbSNP
rs1422335525 121 dbSNP
rs1162450573 126 dbSNP
rs904813610 130 dbSNP
rs1360612130 146 dbSNP
rs1428470524 147 dbSNP
rs1291169223 148 dbSNP
rs888890579 150 dbSNP
rs774621389 155 dbSNP
rs1316148254 156 dbSNP
rs1049950334 158 dbSNP
rs1244045510 162 dbSNP
rs1291223118 166 dbSNP
rs1317604474 170 dbSNP
rs997010335 178 dbSNP
rs1217978960 181 dbSNP
rs1258921999 182 dbSNP
rs1485484792 185 dbSNP
rs570816763 194 dbSNP
rs994685001 197 dbSNP
rs1246209484 200 dbSNP
rs1442477954 203 dbSNP
rs898973290 204 dbSNP
rs901330854 217 dbSNP
rs940640269 220 dbSNP
rs1041187121 222 dbSNP
rs1012862112 233 dbSNP
rs551738968 237 dbSNP
rs1156277962 239 dbSNP
rs1344003185 245 dbSNP
rs1453661329 252 dbSNP
rs62246343 253 dbSNP
rs1450832345 255 dbSNP
rs1314657632 257 dbSNP
rs1225576184 261 dbSNP
rs908602570 273 dbSNP
rs1048440661 275 dbSNP
rs763060554 275 dbSNP
rs1316326833 279 dbSNP
rs1204227064 288 dbSNP
rs1046857126 296 dbSNP
rs1262740424 300 dbSNP
rs931282365 302 dbSNP
rs1470948202 312 dbSNP
rs1346826731 316 dbSNP
rs1175036381 320 dbSNP
rs920547955 321 dbSNP
rs1226541171 322 dbSNP
rs1480438032 323 dbSNP
rs1177799426 325 dbSNP
rs1408873489 342 dbSNP
rs1468596725 343 dbSNP
rs980005119 348 dbSNP
rs1324633643 349 dbSNP
rs1299093700 354 dbSNP
rs1355385696 363 dbSNP
rs762015909 364 dbSNP
rs1381477021 365 dbSNP
rs1277933992 367 dbSNP
rs917072095 369 dbSNP
rs1334259895 370 dbSNP
rs1415860084 371 dbSNP
rs1285151920 377 dbSNP
rs1321295104 378 dbSNP
rs112701337 383 dbSNP
rs192317944 384 dbSNP
rs541204943 385 dbSNP
rs955995445 387 dbSNP
rs1031369232 393 dbSNP
rs924071115 399 dbSNP
rs978276308 404 dbSNP
rs572761577 412 dbSNP
rs966054184 417 dbSNP
rs1200914079 429 dbSNP
rs1432137730 435 dbSNP
rs978423185 437 dbSNP
rs1172419891 444 dbSNP
rs1388859594 448 dbSNP
rs1420664797 457 dbSNP
rs1171106296 458 dbSNP
rs1411946156 466 dbSNP
rs1450144503 472 dbSNP
rs1057001525 473 dbSNP
rs1287084616 473 dbSNP
rs1327127635 473 dbSNP
rs1370142840 473 dbSNP
rs373849529 473 dbSNP
rs555632396 473 dbSNP
rs1270625292 474 dbSNP
rs1341231886 480 dbSNP
rs371851877 483 dbSNP
rs1212542371 488 dbSNP
rs1271894147 494 dbSNP
rs1359672538 513 dbSNP
rs968353216 514 dbSNP
rs1266135883 519 dbSNP
rs1490022067 522 dbSNP
rs1198793170 526 dbSNP
rs1243150873 529 dbSNP
rs1476610467 530 dbSNP
rs987570939 535 dbSNP
rs1389832729 537 dbSNP
rs1425517635 538 dbSNP
rs375262030 542 dbSNP
rs1028567052 557 dbSNP
rs529045770 559 dbSNP
rs997516862 560 dbSNP
rs901387968 567 dbSNP
rs1328091586 582 dbSNP
rs571318424 587 dbSNP
rs1020221832 589 dbSNP
rs1444367743 596 dbSNP
rs1256524670 606 dbSNP
rs1004357238 612 dbSNP
rs1028762805 614 dbSNP
rs1339887310 622 dbSNP
rs189071844 632 dbSNP
rs1229113331 637 dbSNP
rs1289055110 637 dbSNP
rs1048506213 641 dbSNP
rs1205162611 643 dbSNP
rs931333285 644 dbSNP
rs775743106 646 dbSNP
rs1247790640 647 dbSNP
rs184198081 651 dbSNP
rs1185666313 660 dbSNP
rs1015213067 664 dbSNP
rs1449698806 672 dbSNP
rs36072504 672 dbSNP
rs35706056 674 dbSNP
rs575643928 680 dbSNP
rs1159191259 683 dbSNP
rs770947602 685 dbSNP
rs371582306 690 dbSNP
rs934493604 692 dbSNP
rs1406548828 693 dbSNP
rs1046283742 696 dbSNP
rs1312502138 698 dbSNP
rs948075669 699 dbSNP
rs1410606860 701 dbSNP
rs1280771093 702 dbSNP
rs924404592 704 dbSNP
rs978474037 705 dbSNP
rs1267985835 709 dbSNP
rs149270132 712 dbSNP
rs1205930291 718 dbSNP
rs1384635132 720 dbSNP
rs1241579109 732 dbSNP
rs1423443499 733 dbSNP
rs546137918 735 dbSNP
rs975085202 737 dbSNP
rs138459321 747 dbSNP
rs1468608486 753 dbSNP
rs966029665 761 dbSNP
rs944206057 763 dbSNP
rs912818065 768 dbSNP
rs775892053 770 dbSNP
rs554132640 783 dbSNP
rs1473861320 785 dbSNP
rs1470856186 787 dbSNP
rs1004825608 794 dbSNP
rs1401125855 799 dbSNP
rs1391605907 802 dbSNP
rs1181429634 807 dbSNP
rs887264174 811 dbSNP
rs550270568 817 dbSNP
rs1227188052 821 dbSNP
rs1288310489 823 dbSNP
rs1324860921 825 dbSNP
rs995591512 827 dbSNP
rs1225790665 831 dbSNP
rs1392560077 833 dbSNP
rs905254328 840 dbSNP
rs1253757704 844 dbSNP
rs759681711 845 dbSNP
rs1196607235 852 dbSNP
rs1252856867 865 dbSNP
rs191650558 866 dbSNP
rs1205735102 873 dbSNP
rs1181508646 874 dbSNP
rs1045483936 880 dbSNP
rs973064755 881 dbSNP
rs1003004710 882 dbSNP
rs568512011 886 dbSNP
rs963149705 890 dbSNP
rs949399635 894 dbSNP
rs1005138729 905 dbSNP
rs895745089 910 dbSNP
rs1057045858 911 dbSNP
rs1025315249 913 dbSNP
rs187653905 914 dbSNP
rs1226236801 920 dbSNP
rs1407293395 927 dbSNP
rs1012085693 934 dbSNP
rs934524845 942 dbSNP
rs538332244 943 dbSNP
rs1228552076 946 dbSNP
rs1042833844 947 dbSNP
rs1253341350 952 dbSNP
rs947157918 952 dbSNP
rs781600171 953 dbSNP
rs920986977 953 dbSNP
rs1490840976 957 dbSNP
rs1197203120 958 dbSNP
rs975515461 960 dbSNP
rs1266522681 961 dbSNP
rs1428927379 966 dbSNP
rs1000804032 967 dbSNP
rs1444376191 969 dbSNP
rs577867980 974 dbSNP
rs1428693234 976 dbSNP
rs570904097 995 dbSNP
rs374593038 997 dbSNP
rs1391602528 1005 dbSNP
rs1292315420 1006 dbSNP
rs1158178718 1008 dbSNP
rs1471750930 1010 dbSNP
rs1413839284 1014 dbSNP
rs1367478074 1016 dbSNP
rs1383176880 1024 dbSNP
rs912690091 1028 dbSNP
rs1050009901 1036 dbSNP
rs1182640755 1051 dbSNP
rs912838810 1070 dbSNP
rs1244902635 1073 dbSNP
rs567687711 1075 dbSNP
rs983061027 1077 dbSNP
rs774840212 1082 dbSNP
rs951567716 1082 dbSNP
rs1486143476 1086 dbSNP
rs1027173302 1105 dbSNP
rs963049526 1109 dbSNP
rs1245962890 1111 dbSNP
rs995643985 1115 dbSNP
rs1183840168 1120 dbSNP
rs969489949 1124 dbSNP
rs1386655242 1133 dbSNP
rs907635765 1137 dbSNP
rs1023701923 1142 dbSNP
rs970976085 1143 dbSNP
rs537904216 1149 dbSNP
rs1012031765 1150 dbSNP
rs533299594 1151 dbSNP
rs1244178348 1158 dbSNP
rs565980627 1160 dbSNP
rs998732225 1162 dbSNP
rs1226733324 1180 dbSNP
rs903086441 1190 dbSNP
rs1317518963 1191 dbSNP
rs770908552 1202 dbSNP
rs547346996 1206 dbSNP
rs1464292984 1214 dbSNP
rs1204017077 1215 dbSNP
rs1439268745 1215 dbSNP
rs1042885071 1221 dbSNP
rs184584422 1228 dbSNP
rs1455784804 1230 dbSNP
rs891195709 1231 dbSNP
rs1408076067 1232 dbSNP
rs1420290800 1238 dbSNP
rs921038650 1240 dbSNP
rs376310852 1241 dbSNP
rs1408655017 1242 dbSNP
rs772982201 1242 dbSNP
rs561692780 1243 dbSNP
rs1225492637 1244 dbSNP
rs1374167000 1244 dbSNP
rs912231125 1247 dbSNP
rs1223951476 1248 dbSNP
rs920189299 1248 dbSNP
rs1192812224 1250 dbSNP
rs982829650 1251 dbSNP
rs771921355 1252 dbSNP
rs941696174 1258 dbSNP
rs907502769 1260 dbSNP
rs983515226 1267 dbSNP
rs1175655927 1271 dbSNP
rs1250307474 1271 dbSNP
rs1472545796 1271 dbSNP
rs398062086 1271 dbSNP
rs751983618 1271 dbSNP
rs758349879 1271 dbSNP
rs75887447 1271 dbSNP
rs920161296 1276 dbSNP
rs1444508155 1277 dbSNP
rs970542842 1287 dbSNP
rs1240958154 1293 dbSNP
rs1349865916 1294 dbSNP
rs543546842 1295 dbSNP
rs969542276 1298 dbSNP
rs959169636 1299 dbSNP
rs1032238950 1301 dbSNP
rs1000749003 1306 dbSNP
rs1024174122 1311 dbSNP
rs1013678931 1312 dbSNP
rs375196876 1315 dbSNP
rs1268357280 1316 dbSNP
rs1202490493 1317 dbSNP
rs533227611 1318 dbSNP
rs961037383 1322 dbSNP
rs1031021562 1329 dbSNP
rs564172108 1337 dbSNP
rs1020986333 1339 dbSNP
rs531304130 1350 dbSNP
rs999456024 1357 dbSNP
rs1311942008 1360 dbSNP
rs1477262959 1368 dbSNP
rs1190948038 1370 dbSNP
rs903138898 1377 dbSNP
rs1276986206 1380 dbSNP
rs1204530062 1387 dbSNP
rs1042937544 1388 dbSNP
rs1346343991 1407 dbSNP
rs1166873152 1412 dbSNP
rs5013979 1414 dbSNP
rs368508407 1415 dbSNP
rs5846640 1418 dbSNP
rs1028385291 1422 dbSNP
rs1329241538 1425 dbSNP
rs899670072 1428 dbSNP
rs1270534241 1431 dbSNP
rs747769209 1439 dbSNP
rs1225736132 1441 dbSNP
rs1273398711 1447 dbSNP
rs943818400 1449 dbSNP
rs1224021970 1450 dbSNP
rs890840109 1456 dbSNP
rs545380275 1461 dbSNP
rs1450372921 1463 dbSNP
rs1221372260 1464 dbSNP
rs1177986665 1470 dbSNP
rs571675754 1480 dbSNP
rs1047413785 1485 dbSNP
rs1389735782 1492 dbSNP
rs192248003 1496 dbSNP
rs1165050864 1497 dbSNP
rs1388560827 1499 dbSNP
rs929610304 1504 dbSNP
rs990506319 1511 dbSNP
rs925080802 1514 dbSNP
rs1383029442 1524 dbSNP
rs979666268 1527 dbSNP
rs548956314 1530 dbSNP
rs1228264477 1531 dbSNP
rs974314779 1536 dbSNP
rs1466553144 1538 dbSNP
rs1207180557 1542 dbSNP
rs948251045 1548 dbSNP
rs916758690 1549 dbSNP
rs1248148562 1556 dbSNP
rs992713752 1557 dbSNP
rs986833737 1558 dbSNP
rs1366806516 1562 dbSNP
rs554605382 1563 dbSNP
rs1182553931 1569 dbSNP
rs1159102198 1578 dbSNP
rs960837869 1581 dbSNP
rs1414045599 1583 dbSNP
rs575015124 1586 dbSNP
rs1455481931 1600 dbSNP
rs1031492392 1602 dbSNP
rs978089947 1609 dbSNP
rs528006193 1610 dbSNP
rs1022216364 1611 dbSNP
rs1331723883 1612 dbSNP
rs1339386250 1615 dbSNP
rs1239088637 1618 dbSNP
rs1011447827 1619 dbSNP
rs1331806803 1620 dbSNP
rs1227002483 1623 dbSNP
rs1267884027 1627 dbSNP
rs1028416206 1631 dbSNP
rs1202413203 1636 dbSNP
rs1236030034 1639 dbSNP
rs1212684439 1640 dbSNP
rs773324698 1647 dbSNP
rs544212908 1648 dbSNP
rs996900120 1650 dbSNP
rs898573563 1652 dbSNP
rs1017144023 1653 dbSNP
rs1004771646 1656 dbSNP
rs1245198902 1661 dbSNP
rs879515406 1680 dbSNP
rs1344361899 1682 dbSNP
rs1298455331 1692 dbSNP
rs1170478911 1693 dbSNP
rs1401012683 1696 dbSNP
rs748834153 1703 dbSNP
rs535966936 1716 dbSNP
rs1391510241 1719 dbSNP
rs1309296560 1729 dbSNP
rs1227902209 1730 dbSNP
rs150658458 1731 dbSNP
rs1408539301 1733 dbSNP
rs577401123 1734 dbSNP
rs1008463717 1735 dbSNP
rs559060802 1742 dbSNP
rs1046375645 1744 dbSNP
rs1235838545 1751 dbSNP
rs189210203 1755 dbSNP
rs1046845293 1756 dbSNP
rs1196517891 1760 dbSNP
rs1276862592 1764 dbSNP
rs1482077570 1776 dbSNP
rs1448468843 1783 dbSNP
rs1269460921 1790 dbSNP
rs1434728647 1791 dbSNP
rs1369777631 1795 dbSNP
rs867483433 1796 dbSNP
rs896115419 1798 dbSNP
rs1054808086 1806 dbSNP
rs569077626 1810 dbSNP
rs1170020923 1821 dbSNP
rs1390200587 1825 dbSNP
rs1163472528 1830 dbSNP
rs1307999162 1831 dbSNP
rs1368884366 1838 dbSNP
rs898172517 1840 dbSNP
rs1316830635 1841 dbSNP
rs925030039 1843 dbSNP
rs1038003211 1846 dbSNP
rs1299629531 1848 dbSNP
rs948349629 1849 dbSNP
rs1330809431 1850 dbSNP
rs566706316 1855 dbSNP
rs1182143367 1856 dbSNP
rs992368777 1857 dbSNP
rs1251593875 1862 dbSNP
rs111824047 1872 dbSNP
rs1204485556 1875 dbSNP
rs1266011994 1885 dbSNP
rs1203571867 1895 dbSNP
rs939498956 1904 dbSNP
rs757769395 1907 dbSNP
rs1484331391 1916 dbSNP
rs1275359054 1923 dbSNP
rs978153653 1924 dbSNP
rs968063298 1925 dbSNP
rs1022270023 1926 dbSNP
rs1220924004 1930 dbSNP
rs1055134761 1931 dbSNP
rs1315085022 1937 dbSNP
rs1448396396 1946 dbSNP
rs1163645078 1950 dbSNP
rs987084788 1952 dbSNP
rs974685307 1954 dbSNP
rs964023080 1955 dbSNP
rs1018589194 1957 dbSNP
rs1349605500 1959 dbSNP
rs1390486001 1961 dbSNP
rs1286247285 1964 dbSNP
rs1008101198 1967 dbSNP
rs368115890 1973 dbSNP
rs1363260603 1974 dbSNP
rs890945378 1984 dbSNP
rs73026978 1990 dbSNP
rs77316388 1996 dbSNP
rs1242529334 1997 dbSNP
rs764518064 1998 dbSNP
rs1351165617 2001 dbSNP
rs568295138 2002 dbSNP
rs549544906 2003 dbSNP
rs1472074251 2010 dbSNP
rs1421485740 2014 dbSNP
rs560753669 2017 dbSNP
rs1368367401 2026 dbSNP
rs1012314419 2027 dbSNP
rs1024562878 2029 dbSNP
rs1014423208 2030 dbSNP
rs758879966 2031 dbSNP
rs1303582174 2032 dbSNP
rs1054756758 2033 dbSNP
rs1394326761 2043 dbSNP
rs1251859110 2044 dbSNP
rs1057118088 2046 dbSNP
rs1209823773 2055 dbSNP
rs1329755788 2067 dbSNP
rs1230069414 2068 dbSNP
rs1487530623 2070 dbSNP
rs939571670 2074 dbSNP
rs1328147958 2077 dbSNP
rs114081939 2081 dbSNP
rs1238799426 2082 dbSNP
rs1482011440 2087 dbSNP
rs551754622 2091 dbSNP
rs946814020 2102 dbSNP
rs765589520 2103 dbSNP
rs1462547729 2108 dbSNP
rs759469540 2111 dbSNP
rs1229993788 2113 dbSNP
rs1410227358 2116 dbSNP
rs1350942946 2120 dbSNP
rs974793741 2122 dbSNP
rs563858127 2123 dbSNP
rs183214749 2126 dbSNP
rs911174468 2127 dbSNP
rs1351102819 2130 dbSNP
rs138438311 2132 dbSNP
rs559882546 2133 dbSNP
rs2625891 2134 dbSNP
rs766427565 2136 dbSNP
rs867225732 2140 dbSNP
rs921165661 2144 dbSNP
rs1310060284 2153 dbSNP
rs1208895966 2155 dbSNP
rs575010121 2164 dbSNP
rs1274731000 2168 dbSNP
rs1483715053 2178 dbSNP
rs1385991242 2179 dbSNP
rs571956127 2180 dbSNP
rs1469985764 2187 dbSNP
rs1192121820 2189 dbSNP
rs975441306 2190 dbSNP
rs1431657974 2195 dbSNP
rs962482883 2198 dbSNP
rs1173177085 2199 dbSNP
rs1371264212 2199 dbSNP
rs1459139672 2199 dbSNP
rs1364782181 2201 dbSNP
rs1016676772 2202 dbSNP
rs1306143241 2202 dbSNP
rs1369847764 2206 dbSNP
rs1011956742 2207 dbSNP
rs190512339 2210 dbSNP
rs1365134866 2214 dbSNP
rs1297810492 2216 dbSNP
rs1343716646 2219 dbSNP
rs962673269 2224 dbSNP
rs1273169912 2226 dbSNP
rs1431967158 2231 dbSNP
rs1269476366 2232 dbSNP
rs562895131 2233 dbSNP
rs1194340459 2236 dbSNP
rs187230134 2237 dbSNP
rs1056092328 2240 dbSNP
rs1246408997 2242 dbSNP
rs1451459023 2242 dbSNP
rs182578598 2243 dbSNP
rs983233108 2245 dbSNP
rs543516471 2250 dbSNP
rs145885788 2254 dbSNP
rs1347922102 2259 dbSNP
rs1435443801 2261 dbSNP
rs1004219126 2263 dbSNP
rs1313887396 2264 dbSNP
rs1301978009 2265 dbSNP
rs1366892218 2267 dbSNP
rs902742874 2272 dbSNP
rs1364602072 2274 dbSNP
rs1042560807 2275 dbSNP
rs1292590670 2276 dbSNP
rs1450275933 2277 dbSNP
rs1213427860 2281 dbSNP
rs958969645 2282 dbSNP
rs1034549690 2285 dbSNP
rs1322105572 2287 dbSNP
rs1473138811 2291 dbSNP
rs534245586 2295 dbSNP
rs1435406487 2296 dbSNP
rs1411491973 2298 dbSNP
rs1460774288 2302 dbSNP
rs1159613210 2307 dbSNP
rs1001845526 2308 dbSNP
rs946866690 2311 dbSNP
rs1340578205 2314 dbSNP
rs573231847 2324 dbSNP
rs554665201 2332 dbSNP
rs1449535843 2336 dbSNP
rs760662160 2337 dbSNP
rs1286509994 2347 dbSNP
rs1354841037 2354 dbSNP
rs1233125686 2361 dbSNP
rs368707031 2362 dbSNP
rs374598826 2363 dbSNP
rs1207083352 2364 dbSNP
rs191307011 2367 dbSNP
rs1009767449 2372 dbSNP
rs1174877674 2376 dbSNP
rs911883690 2378 dbSNP
rs892213096 2379 dbSNP
rs987467811 2381 dbSNP
rs78212035 2393 dbSNP
rs1190708557 2397 dbSNP
rs921195107 2407 dbSNP
rs918495514 2415 dbSNP
rs1157671134 2421 dbSNP
rs1039617117 2423 dbSNP
rs1447820112 2428 dbSNP
rs1255140148 2430 dbSNP
rs1415733403 2431 dbSNP
rs537650230 2434 dbSNP
rs186271132 2439 dbSNP
rs1484146494 2441 dbSNP
rs181032827 2455 dbSNP
rs747962017 2462 dbSNP
rs1289468306 2468 dbSNP
rs1352748562 2475 dbSNP
rs372502576 2480 dbSNP
rs1016720448 2482 dbSNP
rs1227630292 2483 dbSNP
rs982792797 2489 dbSNP
rs527390342 2490 dbSNP
rs1345959876 2492 dbSNP
rs1202319482 2494 dbSNP
rs959126517 2495 dbSNP
rs1485352748 2496 dbSNP
rs371641541 2497 dbSNP
rs1205817983 2502 dbSNP
rs1003195961 2503 dbSNP
rs902795216 2509 dbSNP
rs560120436 2513 dbSNP
rs1180797715 2514 dbSNP
rs1021158648 2517 dbSNP
rs1377908734 2520 dbSNP
rs1478806882 2521 dbSNP
rs1170381741 2522 dbSNP
rs1374341299 2529 dbSNP
rs1339509745 2532 dbSNP
rs1309212319 2533 dbSNP
rs1372924115 2533 dbSNP
rs116761159 2537 dbSNP
rs1390083547 2537 dbSNP
rs1331976181 2538 dbSNP
rs893984006 2553 dbSNP
rs1039163806 2554 dbSNP
rs773924717 2558 dbSNP
rs529657574 2565 dbSNP
rs1429705604 2575 dbSNP
rs978951445 2586 dbSNP
rs1170572913 2590 dbSNP
rs140742306 2600 dbSNP
rs1052228330 2601 dbSNP
rs1453063043 2605 dbSNP
rs929274705 2608 dbSNP
rs779517129 2610 dbSNP
rs918547906 2612 dbSNP
rs972640292 2625 dbSNP
rs941226538 2629 dbSNP
rs768364883 2631 dbSNP
rs748947753 2634 dbSNP
rs1185748699 2635 dbSNP
rs1022419490 2637 dbSNP
rs1298048940 2638 dbSNP
rs1391933624 2645 dbSNP
rs1388851555 2647 dbSNP
rs1324190285 2648 dbSNP
rs190747721 2651 dbSNP
rs545285937 2657 dbSNP
rs1229308964 2664 dbSNP
rs1204294946 2665 dbSNP
rs1299921228 2665 dbSNP
rs892240248 2667 dbSNP
rs1265915016 2670 dbSNP
rs990637448 2672 dbSNP
rs577524249 2676 dbSNP
rs1252051622 2681 dbSNP
rs1276066522 2685 dbSNP
rs565470113 2694 dbSNP
rs1190033513 2697 dbSNP
rs1355103301 2698 dbSNP
rs868158156 2699 dbSNP
rs755618958 2707 dbSNP
rs1459817165 2716 dbSNP
rs1163211030 2721 dbSNP
rs1357713781 2723 dbSNP
rs1394113153 2732 dbSNP
rs1436100954 2734 dbSNP
rs1322748440 2735 dbSNP
rs1294312507 2740 dbSNP
rs111747345 2746 dbSNP
rs1369241666 2752 dbSNP
rs1310453155 2760 dbSNP
rs573237509 2765 dbSNP
rs981780194 2767 dbSNP
rs778445598 2773 dbSNP
rs1329531276 2776 dbSNP
rs1210238100 2781 dbSNP
rs554984819 2791 dbSNP
rs138812258 2792 dbSNP
rs1047527558 2801 dbSNP
rs1257557520 2804 dbSNP
rs1426074554 2805 dbSNP
rs575544464 2806 dbSNP
rs556046599 2808 dbSNP
rs368337613 2809 dbSNP
rs1186351095 2812 dbSNP
rs1410583622 2820 dbSNP
rs929978261 2832 dbSNP
rs1161694038 2837 dbSNP
rs1011115903 2845 dbSNP
rs115659398 2846 dbSNP
rs1418237171 2847 dbSNP
rs1381341533 2861 dbSNP
rs570359009 2863 dbSNP
rs1412874478 2868 dbSNP
rs1292548240 2882 dbSNP
rs758794062 2895 dbSNP
rs1304485997 2898 dbSNP
rs1018203058 2901 dbSNP
rs1210294475 2904 dbSNP
rs1007714550 2909 dbSNP
rs558307693 2911 dbSNP
rs1253863503 2912 dbSNP
rs1257389810 2916 dbSNP
rs927502130 2927 dbSNP
rs1051856651 2932 dbSNP
rs1418725198 2937 dbSNP
rs750923417 2953 dbSNP
rs897839337 2957 dbSNP
rs1037668671 2958 dbSNP
rs1360991332 2958 dbSNP
rs941268909 2972 dbSNP
rs1432902391 2974 dbSNP
rs1312241763 2975 dbSNP
rs186589325 2976 dbSNP
rs181781841 2982 dbSNP
rs956374278 2985 dbSNP
rs189120714 2990 dbSNP
rs937856101 2991 dbSNP
rs529660679 2993 dbSNP
rs899575561 2994 dbSNP
rs568835486 2997 dbSNP
rs1443607756 2998 dbSNP
rs966392749 3004 dbSNP
rs1480483631 3013 dbSNP
rs375786005 3021 dbSNP
rs1330548540 3027 dbSNP
rs1321687798 3037 dbSNP
rs1397087211 3039 dbSNP
rs1407231490 3044 dbSNP
rs1020595750 3055 dbSNP
rs1158777035 3057 dbSNP
rs1411598824 3061 dbSNP
rs1326708343 3063 dbSNP
rs368943053 3064 dbSNP
rs989078428 3065 dbSNP
rs1436888136 3070 dbSNP
rs755215192 3094 dbSNP
rs1017837939 3095 dbSNP
rs888388623 3096 dbSNP
rs1343606057 3100 dbSNP
rs1159034531 3104 dbSNP
rs1046945847 3109 dbSNP
rs1307325474 3112 dbSNP
rs554121776 3116 dbSNP
rs551330379 3117 dbSNP
rs937467895 3120 dbSNP
rs927363329 3121 dbSNP
rs370559493 3122 dbSNP
rs1468580117 3124 dbSNP
rs913494484 3124 dbSNP
rs763656365 3125 dbSNP
rs993586237 3126 dbSNP
rs897881370 3127 dbSNP
rs1037732397 3130 dbSNP
rs750314934 3132 dbSNP
rs1320752414 3133 dbSNP
rs1366779045 3134 dbSNP
rs922296013 3138 dbSNP
rs1268984827 3139 dbSNP
rs1361854303 3140 dbSNP
rs532831469 3142 dbSNP
rs976412958 3144 dbSNP
rs1018022164 3148 dbSNP
rs937985837 3148 dbSNP
rs1268964463 3150 dbSNP
rs1224773823 3151 dbSNP
rs888398535 3159 dbSNP
rs1055042442 3160 dbSNP
rs1241510918 3165 dbSNP
rs184408426 3167 dbSNP
rs927820758 3168 dbSNP
rs540459383 3177 dbSNP
rs1460691507 3182 dbSNP
rs1159497012 3189 dbSNP
rs115755043 3206 dbSNP
rs1398510899 3207 dbSNP
rs1320100469 3225 dbSNP
rs994134918 3229 dbSNP
rs1346693145 3231 dbSNP
rs1415956382 3231 dbSNP
rs1295604965 3246 dbSNP
rs1318740132 3252 dbSNP
rs1353995517 3254 dbSNP
rs1413771334 3257 dbSNP
rs895737320 3258 dbSNP
rs1174298302 3259 dbSNP
rs1454309326 3269 dbSNP
rs143240519 3275 dbSNP
rs989130873 3276 dbSNP
rs530782436 3293 dbSNP
rs577769361 3294 dbSNP
rs866459233 3298 dbSNP
rs1255282040 3303 dbSNP
rs1474786248 3305 dbSNP
rs543077240 3306 dbSNP
rs947543746 3307 dbSNP
rs1442261275 3320 dbSNP
rs986409054 3324 dbSNP
rs149153481 3328 dbSNP
rs913364317 3332 dbSNP
rs1348629047 3334 dbSNP
rs562407476 3335 dbSNP
rs1414620789 3338 dbSNP
rs544148225 3342 dbSNP
rs1337842532 3361 dbSNP
rs1030515860 3381 dbSNP
rs933600113 3382 dbSNP
rs576718192 3390 dbSNP
rs775335713 3391 dbSNP
rs1236561844 3400 dbSNP
rs976441110 3405 dbSNP
rs556043769 3412 dbSNP
rs1485302939 3417 dbSNP
rs558390340 3418 dbSNP
rs963677978 3420 dbSNP
rs962151065 3430 dbSNP
rs1357257252 3431 dbSNP
rs1252424699 3432 dbSNP
rs1435819260 3436 dbSNP
rs1180689380 3439 dbSNP
rs1377817871 3442 dbSNP
rs1455235172 3442 dbSNP
rs1040342048 3446 dbSNP
rs1171193284 3450 dbSNP
rs1016351252 3451 dbSNP
rs1006675651 3452 dbSNP
rs1369343709 3455 dbSNP
rs1168946639 3461 dbSNP
rs1166184416 3471 dbSNP
rs780830979 3476 dbSNP
rs1056166986 3480 dbSNP
rs763290577 3482 dbSNP
rs533750862 3485 dbSNP
rs538376644 3486 dbSNP
rs774730000 3488 dbSNP
rs1371986526 3497 dbSNP
rs1002141106 3501 dbSNP
rs983855517 3502 dbSNP
rs906436736 3504 dbSNP
rs1046238524 3505 dbSNP
rs1450869191 3506 dbSNP
rs761536560 3507 dbSNP
rs913687212 3510 dbSNP
rs1194995360 3518 dbSNP
rs1472655208 3521 dbSNP
rs2648570 3529 dbSNP
rs555376636 3534 dbSNP
rs1213584537 3535 dbSNP
rs1486292585 3552 dbSNP
rs1469536099 3558 dbSNP
rs1191296759 3562 dbSNP
rs3732975 3572 dbSNP
rs1203103646 3584 dbSNP
rs910224763 3585 dbSNP
rs1194568733 3589 dbSNP
rs536328834 3591 dbSNP
rs1375264875 3593 dbSNP
rs986169091 3594 dbSNP
rs1460841446 3600 dbSNP
rs955009472 3600 dbSNP
rs1001508695 3603 dbSNP
rs1309389751 3608 dbSNP
rs1352599831 3609 dbSNP
rs1463226015 3621 dbSNP
rs766216162 3625 dbSNP
rs759759943 3626 dbSNP
rs972261803 3627 dbSNP
rs1382820760 3629 dbSNP
rs1297704615 3631 dbSNP
rs962203320 3633 dbSNP
rs891872329 3636 dbSNP
rs1016403506 3638 dbSNP
rs1053314774 3639 dbSNP
rs1294922568 3641 dbSNP
rs1415251733 3645 dbSNP
rs145255059 3651 dbSNP
rs181525154 3652 dbSNP
rs1264564309 3656 dbSNP
rs1193030747 3671 dbSNP
rs532895227 3681 dbSNP
rs1039278380 3693 dbSNP
rs1463047814 3698 dbSNP
rs1354648209 3708 dbSNP
rs1163106230 3719 dbSNP
rs1394000646 3720 dbSNP
rs1454428923 3721 dbSNP
rs571977528 3723 dbSNP
rs1290710174 3729 dbSNP
rs942345252 3730 dbSNP
rs1381600541 3731 dbSNP
rs1293787171 3736 dbSNP
rs769296982 3741 dbSNP
rs1231202251 3747 dbSNP
rs910925893 3749 dbSNP
rs1403265323 3766 dbSNP
rs1317135853 3771 dbSNP
rs1034373560 3791 dbSNP
rs773190155 3804 dbSNP
rs189973452 3824 dbSNP
rs931103420 3831 dbSNP
rs918320533 3835 dbSNP
rs906489079 3836 dbSNP
rs1024840202 3842 dbSNP
rs1258795569 3845 dbSNP
rs1486888464 3848 dbSNP
rs1009393640 3851 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.488 9.1e-3 -0.539 4.0e-3 23 Click to see details
GSE26953 Aortic valvular endothelial cells 0.33 5.8e-2 0.157 2.3e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.361 5.9e-2 -0.319 8.5e-2 20 Click to see details
GSE21032 Prostate cancer -0.164 6.9e-2 -0.152 8.5e-2 83 Click to see details
GSE19536 Breast cancer -0.141 8.1e-2 -0.074 2.3e-1 100 Click to see details
GSE19783 ER- ER- breast cancer -0.13 1.3e-1 -0.058 3.1e-1 79 Click to see details
GSE28260 Renal cortex and medulla 0.319 1.4e-1 0.330 1.4e-1 13 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.423 1.5e-1 -0.357 1.9e-1 8 Click to see details
GSE28544 Breast cancer -0.207 1.7e-1 -0.168 2.2e-1 24 Click to see details
GSE27834 Pluripotent stem cells -0.259 1.7e-1 -0.326 1.1e-1 16 Click to see details
GSE19350 CNS germ cell tumors -0.193 2.7e-1 -0.441 7.6e-2 12 Click to see details
GSE21687 Ependynoma primary tumors -0.06 3.2e-1 -0.087 2.5e-1 64 Click to see details
GSE17306 Multiple myeloma -0.056 3.5e-1 -0.033 4.1e-1 49 Click to see details
GSE38226 Liver fibrosis -0.071 3.8e-1 0.057 4.0e-1 21 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.046 4.1e-1 -0.219 1.5e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.044 4.2e-1 -0.032 4.4e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.037 4.2e-1 -0.346 2.6e-2 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.016 4.7e-1 -0.128 3.0e-1 20 Click to see details
GSE14794 Lymphoblastoid cells 0.006 4.8e-1 0.038 3.6e-1 90 Click to see details
GSE14794 Lymphoblastoid cells 0.006 4.8e-1 0.038 3.6e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUSC 0.402 0.01 0.286 0.04 38 Click to see details
KICH 0.461 0.01 0.365 0.04 25 Click to see details
LUAD -0.607 0.02 -0.476 0.06 12 Click to see details
KIRC 0.204 0.05 0.291 0.01 68 Click to see details
LIHC 0.223 0.06 0.277 0.03 49 Click to see details
HNSC 0.215 0.09 0.094 0.28 42 Click to see details
STAD -0.233 0.1 -0.259 0.08 32 Click to see details
THCA 0.113 0.2 0.116 0.19 59 Click to see details
BRCA -0.085 0.22 -0.035 0.38 84 Click to see details
PAAD -0.553 0.22 -0.400 0.3 4 Click to see details
UCEC -0.185 0.22 -0.091 0.36 19 Click to see details
PCPG -0.514 0.33 -0.500 0.33 3 Click to see details
ESCA -0.143 0.34 -0.127 0.35 11 Click to see details
COAD 0.157 0.36 0.167 0.35 8 Click to see details
PRAD 0.049 0.37 0.107 0.23 50 Click to see details
CHOL 0.096 0.4 -0.050 0.45 9 Click to see details
BLCA -0.04 0.44 0.061 0.4 18 Click to see details
KIRP 0.027 0.44 0.357 0.02 32 Click to see details
CESC 0.093 0.47 0.500 0.33 3 Click to see details
CESC 0.093 0.47 0.500 0.33 3 Click to see details
CESC 0.093 0.47 0.500 0.33 3 Click to see details
449 hsa-miR-10a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001140 HOXA1 homeobox A1 4 3
MIRT003896 USF2 upstream transcription factor 2, c-fos interacting 4 1
MIRT005454 NCOR2 nuclear receptor corepressor 2 3 1
MIRT005509 MAP3K7 mitogen-activated protein kinase kinase kinase 7 5 1
MIRT005510 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 7 2
MIRT006536 SRSF1 serine and arginine rich splicing factor 1 1 1
MIRT006537 TRA2B transformer 2 beta homolog 3 3
MIRT006972 EPHA4 EPH receptor A4 4 2
MIRT007021 CHL1 cell adhesion molecule L1 like 1 1
MIRT025588 GPR63 G protein-coupled receptor 63 1 1
MIRT025589 BCL2L13 BCL2 like 13 1 1
MIRT025590 CREB5 cAMP responsive element binding protein 5 1 1
MIRT025591 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT025592 OMA1 OMA1 zinc metallopeptidase 1 1
MIRT025593 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT025594 RBM17 RNA binding motif protein 17 1 1
MIRT025595 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT025596 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT025597 SNX4 sorting nexin 4 2 4
MIRT025598 SERBP1 SERPINE1 mRNA binding protein 1 1 2
MIRT025599 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT025600 NOP16 NOP16 nucleolar protein 1 1
MIRT025601 AJUBA ajuba LIM protein 1 1
MIRT025602 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT025603 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT025604 TMEM101 transmembrane protein 101 2 4
MIRT025605 YES1 YES proto-oncogene 1, Src family tyrosine kinase 1 1
MIRT025606 DUSP3 dual specificity phosphatase 3 1 1
MIRT025607 PANX1 pannexin 1 1 1
MIRT025608 WEE1 WEE1 G2 checkpoint kinase 1 1
MIRT025609 TLE3 transducin like enhancer of split 3 1 1
MIRT025610 PDPK1 3-phosphoinositide dependent protein kinase 1 1 1
MIRT025611 CMPK1 cytidine/uridine monophosphate kinase 1 2 6
MIRT025612 NDUFB6 NADH:ubiquinone oxidoreductase subunit B6 1 1
MIRT025613 ARPC5 actin related protein 2/3 complex subunit 5 1 1
MIRT025614 PUM2 pumilio RNA binding family member 2 1 1
MIRT025615 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT025616 ACVR2A activin A receptor type 2A 2 2
MIRT025617 RBM12B RNA binding motif protein 12B 2 5
MIRT025618 THUMPD1 THUMP domain containing 1 1 2
MIRT025619 BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 1 1
MIRT025620 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT025621 XRN1 5'-3' exoribonuclease 1 1 1
MIRT025622 E2F7 E2F transcription factor 7 1 1
MIRT025623 LCA5 LCA5, lebercilin 1 1
MIRT025624 ELOVL2 ELOVL fatty acid elongase 2 1 1
MIRT025625 TFAP2C transcription factor AP-2 gamma 2 3
MIRT025626 TRIM2 tripartite motif containing 2 2 4
MIRT025627 HOXB3 homeobox B3 2 5
MIRT047505 FUS FUS RNA binding protein 1 1
MIRT047506 LMBR1L limb development membrane protein 1 like 1 1
MIRT047507 HSP90AA1 heat shock protein 90 alpha family class A member 1 1 1
MIRT047508 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT047509 EXTL3 exostosin like glycosyltransferase 3 1 1
MIRT047510 POLR2A RNA polymerase II subunit A 1 1
MIRT047511 RIOK2 RIO kinase 2 1 1
MIRT047512 C12orf76 chromosome 12 open reading frame 76 1 1
MIRT047513 CCDC151 coiled-coil domain containing 151 1 1
MIRT047514 FAT2 FAT atypical cadherin 2 1 1
MIRT047515 TPI1 triosephosphate isomerase 1 1 1
MIRT047516 BTAF1 B-TFIID TATA-box binding protein associated factor 1 1 1
MIRT047517 MSANTD1 Myb/SANT DNA binding domain containing 1 1 1
MIRT047518 PLA2G4A phospholipase A2 group IVA 1 1
MIRT047519 IGSF1 immunoglobulin superfamily member 1 1 1
MIRT047520 LEMD3 LEM domain containing 3 1 1
MIRT047521 E2F1 E2F transcription factor 1 1 1
MIRT047522 KIF3B kinesin family member 3B 1 1
MIRT047523 GBAS nipsnap homolog 2 1 1
MIRT047524 LIMA1 LIM domain and actin binding 1 1 1
MIRT047525 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT047526 MRC2 mannose receptor C type 2 1 1
MIRT047527 TMEM106B transmembrane protein 106B 1 1
MIRT047528 ZFP30 ZFP30 zinc finger protein 1 1
MIRT047529 AMPD1 adenosine monophosphate deaminase 1 1 1
MIRT047530 SLC2A3 solute carrier family 2 member 3 1 1
MIRT047531 RPL15 ribosomal protein L15 1 1
MIRT047532 AGER advanced glycosylation end-product specific receptor 1 1
MIRT047533 CNTLN centlein 1 1
MIRT047534 C21orf59 chromosome 21 open reading frame 59 1 1
MIRT047535 SEPT9 septin 9 1 1
MIRT047536 COL6A2 collagen type VI alpha 2 chain 1 1
MIRT047537 MLNR motilin receptor 1 1
MIRT047538 RTKN2 rhotekin 2 1 1
MIRT047539 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT047540 CSNK2A1 casein kinase 2 alpha 1 2 3
MIRT047541 AQP12B aquaporin 12B 1 1
MIRT047542 AGBL2 ATP/GTP binding protein like 2 1 1
MIRT047543 GOLGA8A golgin A8 family member A 1 1
MIRT047544 CPED1 cadherin like and PC-esterase domain containing 1 1 1
MIRT047545 HSPA8 heat shock protein family A (Hsp70) member 8 1 1
MIRT047546 SLC41A3 solute carrier family 41 member 3 1 1
MIRT047547 KXD1 KxDL motif containing 1 1 1
MIRT047548 RELN reelin 1 1
MIRT047549 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT047550 PTPRT protein tyrosine phosphatase, receptor type T 1 1
MIRT047551 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT047552 CYP8B1 cytochrome P450 family 8 subfamily B member 1 1 1
MIRT047553 COL4A3 collagen type IV alpha 3 chain 1 1
MIRT047554 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT047555 MSL3 MSL complex subunit 3 1 1
MIRT047556 TTC7A tetratricopeptide repeat domain 7A 1 1
MIRT047557 COX7B cytochrome c oxidase subunit 7B 1 1
MIRT047558 ZNF318 zinc finger protein 318 1 1
MIRT047559 ACAA1 acetyl-CoA acyltransferase 1 1 1
MIRT047560 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT047561 SCAP SREBF chaperone 1 1
MIRT047562 KCTD11 potassium channel tetramerization domain containing 11 2 11
MIRT047563 RIOK3 RIO kinase 3 1 1
MIRT047564 C5 complement C5 1 1
MIRT047565 GLB1L3 galactosidase beta 1 like 3 1 1
MIRT047566 PAPD5 poly(A) RNA polymerase D5, non-canonical 1 1
MIRT047567 RNF123 ring finger protein 123 1 1
MIRT047568 ZNF629 zinc finger protein 629 1 1
MIRT047569 AMMECR1L AMMECR1 like 1 1
MIRT047570 KLHL6 kelch like family member 6 1 1
MIRT047571 SYMPK symplekin 1 1
MIRT047572 NCSTN nicastrin 1 1
MIRT047573 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 1
MIRT047574 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT047575 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 1
MIRT047576 RAB18 RAB18, member RAS oncogene family 1 1
MIRT047577 CUL3 cullin 3 1 1
MIRT047578 MTF2 metal response element binding transcription factor 2 1 1
MIRT047579 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT047580 NUP37 nucleoporin 37 1 1
MIRT047581 GPR98 adhesion G protein-coupled receptor V1 1 1
MIRT047582 RUNDC3B RUN domain containing 3B 1 1
MIRT047583 KIF21A kinesin family member 21A 1 1
MIRT047584 FEM1B fem-1 homolog B 1 1
MIRT047585 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT047586 PLA2G4F phospholipase A2 group IVF 1 1
MIRT047587 SNTB2 syntrophin beta 2 1 1
MIRT047588 NUB1 negative regulator of ubiquitin like proteins 1 1 1
MIRT047589 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT047590 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT047591 C11orf63 chromosome 11 open reading frame 63 1 1
MIRT047592 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT047593 CHRNA5 cholinergic receptor nicotinic alpha 5 subunit 1 1
MIRT047594 RPS9 ribosomal protein S9 1 1
MIRT047595 DDX42 DEAD-box helicase 42 1 1
MIRT047596 XPO7 exportin 7 1 1
MIRT047597 PYGL glycogen phosphorylase L 1 1
MIRT047598 TGFB3 transforming growth factor beta 3 1 1
MIRT047599 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT047600 PHB2 prohibitin 2 1 1
MIRT047601 ALDH1A2 aldehyde dehydrogenase 1 family member A2 1 1
MIRT047602 SLC3A2 solute carrier family 3 member 2 1 1
MIRT047603 POLR2H RNA polymerase II subunit H 1 1
MIRT047604 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT047605 MOB3C MOB kinase activator 3C 1 1
MIRT047606 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT047607 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT047608 INTS2 integrator complex subunit 2 1 1
MIRT047609 MYEF2 myelin expression factor 2 1 1
MIRT047610 PANK2 pantothenate kinase 2 1 1
MIRT047611 EMB embigin 1 1
MIRT047612 HK1 hexokinase 1 1 1
MIRT047613 UBE2Z ubiquitin conjugating enzyme E2 Z 1 1
MIRT047614 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT047615 HOXA3 homeobox A3 1 1
MIRT047616 NT5DC1 5'-nucleotidase domain containing 1 1 1
MIRT047617 YOD1 YOD1 deubiquitinase 1 1
MIRT047618 APRT adenine phosphoribosyltransferase 1 1
MIRT047619 C2CD2 C2 calcium dependent domain containing 2 1 1
MIRT047620 SHBG sex hormone binding globulin 1 1
MIRT047621 PPP1R12A protein phosphatase 1 regulatory subunit 12A 1 1
MIRT047622 SCD stearoyl-CoA desaturase 1 1
MIRT047623 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT047624 ETS1 ETS proto-oncogene 1, transcription factor 1 1
MIRT047625 GTF3C2 general transcription factor IIIC subunit 2 1 1
MIRT047626 NOP2 NOP2 nucleolar protein 1 1
MIRT047627 RPS29 ribosomal protein S29 1 1
MIRT047628 LAMC1 laminin subunit gamma 1 1 1
MIRT047629 GNAL G protein subunit alpha L 1 1
MIRT047630 KIAA1147 KIAA1147 1 1
MIRT047631 NACC2 NACC family member 2 1 1
MIRT047632 TMEM179B transmembrane protein 179B 1 1
MIRT047633 ARF3 ADP ribosylation factor 3 1 1
MIRT047634 MCPH1 microcephalin 1 1 1
MIRT047635 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT047636 UBN2 ubinuclein 2 1 1
MIRT047637 ANO6 anoctamin 6 1 1
MIRT047638 NEK7 NIMA related kinase 7 1 1
MIRT047639 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT047640 MED1 mediator complex subunit 1 1 1
MIRT047641 PTPRG protein tyrosine phosphatase, receptor type G 1 1
MIRT047642 ERMN ermin 1 1
MIRT047643 LYPD6 LY6/PLAUR domain containing 6 1 1
MIRT047644 SLC25A5 solute carrier family 25 member 5 1 1
MIRT047645 EPB41L2 erythrocyte membrane protein band 4.1 like 2 1 1
MIRT047646 ARFGEF1 ADP ribosylation factor guanine nucleotide exchange factor 1 1 1
MIRT047647 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT047648 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 1 1
MIRT047649 KLHL23 kelch like family member 23 1 1
MIRT047650 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT047651 HOXD13 homeobox D13 1 1
MIRT047652 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT047653 ZNF592 zinc finger protein 592 1 1
MIRT047654 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT047655 RRP1B ribosomal RNA processing 1B 1 1
MIRT047656 UHRF1 ubiquitin like with PHD and ring finger domains 1 1 1
MIRT047657 SORD sorbitol dehydrogenase 1 1
MIRT047658 PPM1G protein phosphatase, Mg2+/Mn2+ dependent 1G 1 1
MIRT047659 SF3B3 splicing factor 3b subunit 3 1 1
MIRT047660 PRPF8 pre-mRNA processing factor 8 1 1
MIRT047661 PRDX2 peroxiredoxin 2 1 1
MIRT047662 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT047663 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT047664 CAB39L calcium binding protein 39 like 1 1
MIRT047665 ATP5F1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1 1 1
MIRT047666 PARL presenilin associated rhomboid like 1 1
MIRT047667 ERLIN1 ER lipid raft associated 1 1 1
MIRT047668 MARS methionyl-tRNA synthetase 1 1
MIRT047669 TRPM7 transient receptor potential cation channel subfamily M member 7 1 1
MIRT047670 DLG4 discs large MAGUK scaffold protein 4 1 1
MIRT047671 WDR74 WD repeat domain 74 1 1
MIRT047672 PWP1 PWP1 homolog, endonuclein 1 1
MIRT047673 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT047674 NAP1L1 nucleosome assembly protein 1 like 1 1 1
MIRT047675 CTNND1 catenin delta 1 1 1
MIRT047676 IQCB1 IQ motif containing B1 1 1
MIRT047677 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT047678 CDK19 cyclin dependent kinase 19 1 1
MIRT047679 LRP3 LDL receptor related protein 3 1 1
MIRT047680 UBE2D2 ubiquitin conjugating enzyme E2 D2 1 1
MIRT047681 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT047682 GORASP2 golgi reassembly stacking protein 2 1 1
MIRT047683 DDX54 DEAD-box helicase 54 1 1
MIRT047684 CARHSP1 calcium regulated heat stable protein 1 1 1
MIRT047685 FAM168A family with sequence similarity 168 member A 1 1
MIRT047686 SF3B4 splicing factor 3b subunit 4 1 1
MIRT047687 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 1 1
MIRT047688 PLEKHB2 pleckstrin homology domain containing B2 1 1
MIRT047689 LRFN1 leucine rich repeat and fibronectin type III domain containing 1 1 1
MIRT047690 KIAA0100 KIAA0100 1 1
MIRT047691 DVL1 dishevelled segment polarity protein 1 1 1
MIRT047692 NOMO1 NODAL modulator 1 1 1
MIRT047693 MIS12 MIS12, kinetochore complex component 1 1
MIRT047694 GLOD4 glyoxalase domain containing 4 1 1
MIRT047695 USP11 ubiquitin specific peptidase 11 1 1
MIRT047696 UBE3C ubiquitin protein ligase E3C 1 1
MIRT047697 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT047698 SPARC secreted protein acidic and cysteine rich 1 1
MIRT047699 SLC26A2 solute carrier family 26 member 2 1 1
MIRT047700 MED12 mediator complex subunit 12 1 1
MIRT047701 FAM219B family with sequence similarity 219 member B 1 1
MIRT047702 GOSR2 golgi SNAP receptor complex member 2 1 1
MIRT047703 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT047704 PIAS3 protein inhibitor of activated STAT 3 1 1
MIRT047705 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT047706 COL4A2 collagen type IV alpha 2 chain 1 1
MIRT047707 NUP205 nucleoporin 205 1 1
MIRT047708 POLR3A RNA polymerase III subunit A 1 1
MIRT047709 ATG3 autophagy related 3 1 1
MIRT047710 COPA coatomer protein complex subunit alpha 1 1
MIRT047711 CD59 CD59 molecule (CD59 blood group) 1 1
MIRT047712 TENM3 teneurin transmembrane protein 3 1 1
MIRT047713 TUBA1A tubulin alpha 1a 1 1
MIRT047714 LSS lanosterol synthase 1 1
MIRT047715 FASN fatty acid synthase 4 1
MIRT047716 PSMD13 proteasome 26S subunit, non-ATPase 13 1 1
MIRT047717 ZNF618 zinc finger protein 618 1 1
MIRT047718 TSPAN33 tetraspanin 33 1 1
MIRT047719 KANK1 KN motif and ankyrin repeat domains 1 1 1
MIRT047720 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT047721 DPYSL2 dihydropyrimidinase like 2 1 1
MIRT047722 SUPT6H SPT6 homolog, histone chaperone 1 1
MIRT047723 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT047724 ACTG1 actin gamma 1 3 2
MIRT047725 PLSCR1 phospholipid scramblase 1 1 1
MIRT047726 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT047727 SFPQ splicing factor proline and glutamine rich 1 1
MIRT047728 VDAC1 voltage dependent anion channel 1 1 1
MIRT047729 ADCY9 adenylate cyclase 9 1 1
MIRT047730 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT047731 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 1 1
MIRT047732 SLC25A13 solute carrier family 25 member 13 1 1
MIRT047733 IGSF9B immunoglobulin superfamily member 9B 1 1
MIRT047734 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047735 MCU mitochondrial calcium uniporter 1 1
MIRT047736 CDK8 cyclin dependent kinase 8 1 1
MIRT047737 CEP128 centrosomal protein 128 1 1
MIRT047738 TRAPPC12 trafficking protein particle complex 12 1 1
MIRT047739 SYNJ1 synaptojanin 1 1 1
MIRT047740 NOB1 NIN1/PSMD8 binding protein 1 homolog 1 1
MIRT047741 AP5S1 adaptor related protein complex 5 sigma 1 subunit 1 1
MIRT047742 RNF213 ring finger protein 213 1 1
MIRT047743 PSMB1 proteasome subunit beta 1 1 1
MIRT047744 BCR BCR, RhoGEF and GTPase activating protein 1 1
MIRT047745 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT047746 NPTX1 neuronal pentraxin 1 1 1
MIRT047747 PRRC2C proline rich coiled-coil 2C 1 1
MIRT047748 PABPC3 poly(A) binding protein cytoplasmic 3 1 1
MIRT047749 NF2 neurofibromin 2 1 1
MIRT047750 RALBP1 ralA binding protein 1 1 1
MIRT047751 EHD4 EH domain containing 4 1 1
MIRT047752 RLIM ring finger protein, LIM domain interacting 1 1
MIRT076413 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT084600 BCL2L11 BCL2 like 11 3 5
MIRT093335 RAPGEF2 Rap guanine nucleotide exchange factor 2 2 2
MIRT097757 ARSK arylsulfatase family member K 2 2
MIRT099597 ID4 inhibitor of DNA binding 4, HLH protein 2 6
MIRT249192 RAP2A RAP2A, member of RAS oncogene family 2 1
MIRT299201 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT437577 ZFAND5 zinc finger AN1-type containing 5 2 1
MIRT437578 CNST consortin, connexin sorting protein 2 1
MIRT437579 TIAM1 T-cell lymphoma invasion and metastasis 1 2 1
MIRT438258 PTEN phosphatase and tensin homolog 2 2
MIRT438408 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT448051 SFRP1 secreted frizzled related protein 1 2 2
MIRT459965 POC1A POC1 centriolar protein A 2 2
MIRT466175 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT470412 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT475883 H3F3C H3 histone family member 3C 2 10
MIRT475919 H3F3B H3 histone family member 3B 2 8
MIRT493173 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT497272 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT507101 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508100 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT508628 PLA2G2C phospholipase A2 group IIC 2 2
MIRT510735 SON SON DNA binding protein 2 6
MIRT513973 CNOT6 CCR4-NOT transcription complex subunit 6 2 2
MIRT514262 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT514577 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 4
MIRT515044 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515692 TFPI tissue factor pathway inhibitor 2 2
MIRT515752 ONECUT3 one cut homeobox 3 2 2
MIRT517389 METTL7A methyltransferase like 7A 2 2
MIRT519732 ZNF460 zinc finger protein 460 2 2
MIRT520247 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT520270 URGCP upregulator of cell proliferation 2 2
MIRT522213 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT523700 FHL2 four and a half LIM domains 2 2 4
MIRT523978 DVL3 dishevelled segment polarity protein 3 2 2
MIRT525569 MTRNR2L7 MT-RNR2-like 7 2 6
MIRT525619 MTRNR2L3 MT-RNR2-like 3 2 4
MIRT530223 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT530549 SYNPO synaptopodin 2 2
MIRT531041 ZNF502 zinc finger protein 502 2 2
MIRT532579 GSS glutathione synthetase 2 2
MIRT534840 RAB15 RAB15, member RAS oncogene family 2 2
MIRT535793 MTRNR2L11 MT-RNR2-like 11 2 6
MIRT535811 MTRNR2L10 MT-RNR2-like 10 2 4
MIRT536818 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT539894 IRGQ immunity related GTPase Q 2 2
MIRT540209 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT540951 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541937 ORC1 origin recognition complex subunit 1 2 4
MIRT542195 FUT1 fucosyltransferase 1 (H blood group) 2 6
MIRT542374 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542508 WDR13 WD repeat domain 13 2 2
MIRT542575 ZNF280B zinc finger protein 280B 2 2
MIRT542714 RPS15A ribosomal protein S15a 2 2
MIRT546705 RORA RAR related orphan receptor A 5 4
MIRT549929 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550162 ZNF223 zinc finger protein 223 2 4
MIRT558566 CRLF3 cytokine receptor like factor 3 2 4
MIRT560945 TPM4 tropomyosin 4 2 4
MIRT574848 CADM1 cell adhesion molecule 1 2 2
MIRT575176 Atg9a autophagy related 9A 2 2
MIRT576664 Fam216a family with sequence similarity 216, member A 2 2
MIRT609434 MTX3 metaxin 3 2 2
MIRT612162 TCF15 transcription factor 15 2 2
MIRT617414 API5 apoptosis inhibitor 5 2 2
MIRT617469 CCS copper chaperone for superoxide dismutase 2 2
MIRT618780 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618835 PHF20 PHD finger protein 20 2 2
MIRT619339 RNF2 ring finger protein 2 2 2
MIRT625244 C6orf89 chromosome 6 open reading frame 89 2 2
MIRT626439 CHDH choline dehydrogenase 2 2
MIRT634929 CHMP1B charged multivesicular body protein 1B 2 2
MIRT635875 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636235 SLC24A4 solute carrier family 24 member 4 2 2
MIRT636641 CHAF1B chromatin assembly factor 1 subunit B 2 2
MIRT640545 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT648661 ALKBH4 alkB homolog 4, lysine demethylase 2 2
MIRT650186 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT650790 GSR glutathione-disulfide reductase 2 2
MIRT652027 TTYH3 tweety family member 3 2 2
MIRT652517 TMEM109 transmembrane protein 109 2 2
MIRT661940 MAVS mitochondrial antiviral signaling protein 2 2
MIRT661951 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT662020 ZNF445 zinc finger protein 445 2 2
MIRT664015 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT664059 KIAA1551 KIAA1551 2 2
MIRT666872 POU2F2 POU class 2 homeobox 2 2 2
MIRT669168 CCNG1 cyclin G1 2 2
MIRT673243 KLHDC8A kelch domain containing 8A 2 2
MIRT680410 SFT2D2 SFT2 domain containing 2 2 2
MIRT680484 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT683577 CARD8 caspase recruitment domain family member 8 2 2
MIRT684398 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT684558 ZNF708 zinc finger protein 708 2 2
MIRT685421 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT686050 SLC5A5 solute carrier family 5 member 5 2 2
MIRT687955 HHIP hedgehog interacting protein 2 2
MIRT688181 FRRS1 ferric chelate reductase 1 2 2
MIRT688303 FAM208A family with sequence similarity 208 member A 2 2
MIRT688900 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT689205 ZNF574 zinc finger protein 574 2 2
MIRT689917 ACOT13 acyl-CoA thioesterase 13 2 2
MIRT692931 EXOSC2 exosome component 2 2 2
MIRT693632 CENPL centromere protein L 2 2
MIRT694762 FZD2 frizzled class receptor 2 2 2
MIRT695373 PHAX phosphorylated adaptor for RNA export 2 2
MIRT696630 WDR77 WD repeat domain 77 2 2
MIRT696690 APOC3 apolipoprotein C3 2 2
MIRT697367 ZNF394 zinc finger protein 394 2 2
MIRT697611 XIAP X-linked inhibitor of apoptosis 2 2
MIRT697737 USP6NL USP6 N-terminal like 2 2
MIRT697788 UBXN7 UBX domain protein 7 2 2
MIRT698361 TMEM127 transmembrane protein 127 2 2
MIRT704519 CNKSR3 CNKSR family member 3 2 2
MIRT704600 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT705849 AHCY adenosylhomocysteinase 2 2
MIRT707093 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT707154 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT707243 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT707356 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT707459 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707503 AXL AXL receptor tyrosine kinase 2 2
MIRT707647 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT707703 FAM118A family with sequence similarity 118 member A 2 2
MIRT707714 CDC6 cell division cycle 6 2 2
MIRT707825 TMEM170A transmembrane protein 170A 2 2
MIRT707966 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT708006 NUDT4 nudix hydrolase 4 2 2
MIRT708035 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT708073 LIX1L limb and CNS expressed 1 like 2 2
MIRT708131 GK5 glycerol kinase 5 (putative) 2 2
MIRT708200 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT708210 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT708940 CRY2 cryptochrome circadian clock 2 2 2
MIRT709199 SAPCD2 suppressor APC domain containing 2 2 2
MIRT714403 FBXO31 F-box protein 31 2 2
MIRT714629 KIAA1143 KIAA1143 2 2
MIRT720741 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT720894 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT723335 DGAT1 diacylglycerol O-acyltransferase 1 2 2
MIRT724452 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT731180 SERPINE1 serpin family E member 1 3 1
MIRT732377 GP1BA glycoprotein Ib platelet alpha subunit 2 1
MIRT733585 SDC1 syndecan 1 3 0
MIRT734393 ARNTL aryl hydrocarbon receptor nuclear translocator like 3 0
MIRT735361 BDNF brain derived neurotrophic factor 4 0
MIRT735799 MAP2K6 mitogen-activated protein kinase kinase 6 3 0
MIRT735868 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736834 SKA1 spindle and kinetochore associated complex subunit 1 3 0
MIRT737248 LEF1-AS1 LEF1 antisense RNA 1 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-10a RAR-alpha antagonist Ro-41-5253 NULL NULL Northern blot pancreatic cancer 19747919 2009 down-regulated
miR-10a 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-10a Oxaliplatin (L-OHP) approved 5310940 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-10a Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells HT-29 cells 20955366 2011 down-regulated
miR-10a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Microarray acute myeloid leukemia (AML) cell line HL-60 21518431 2011 down-regulated
miR-10a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Quantitative real-time PCR regulatory T cells (T(reg) cells) 22544395 2012 up-regulated
miR-10a Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-10a Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Northern blot fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Quantitative real-time PCR fetal mouse brains 19091803 2009 up-regulated
miR-10a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 up-regualted
miR-10a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-10a-5p Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-10a-5p Comfrey NULL 6440495 Microarray rat liver 21370286 2011 down-regulated
miR-10a-5p Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-10a-5p Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-10a-5p Acarbose Approved 444254 Microarray diabetic rats cells 24260283 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-10a Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-10a Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-10a Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-10a Tamoxifen 2733525 NSC180973 approved sensitive tissue (ER-positive breast cancer)
hsa-mir-10a Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-10a-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 resistant
hsa-miR-10a-5p (3aR)-7-[3-[4-[3-[[(3aR)-8-methoxy-10-oxo-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-7-yl]oxy]propyl]piperazin-1-yl]propoxy]-8-methoxy-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-10-one 24202913 NSC726262 resistant
hsa-miR-10a-5p (4z,6z)-4,6-dibenzylidene-2,2-dimethyl-1,3-dioxan-5-one 5387558 NSC624512 resistant
hsa-miR-10a-5p (5e)-5-benzylidene-3-(2,4,5-trichlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470506 NSC702355 resistant
hsa-miR-10a-5p (6e,7r,8r,8as)-8-methyl-6-[(2r)-2-methylhexylidene]-8-phenylmethoxy-1,2,3,5,7,8a-hexahydroindolizin-7-ol 5470307 NSC699382 resistant
hsa-miR-10a-5p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 resistant
hsa-miR-10a-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-[4-(diethylamino)phenyl]prop-2-en-1-one 5471159 NSC709103 resistant
hsa-miR-10a-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 resistant
hsa-miR-10a-5p (e)-2-methyl-1-[2-(2-methyl-1h-indol-3-yl)indolin-1-yl]but-2-en-1-one 5388204 NSC633484 resistant
hsa-miR-10a-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-(cyclohexanecarbonylamino)-3-cyclohexyl-2-hydroxypropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10 383477 NSC671869 resistant
hsa-miR-10a-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-10a-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-10a-5p [(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-26-[(E)-[(2,4-dinitrophenyl)hydrazinylidene]methyl]-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12,14,16,18,22-heptamethyl-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta-1(29),2,4,9,19,21, 135483937 NSC144126 resistant
hsa-miR-10a-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-2-oxo-6-phenylpyridin-1-yl]oxan-2-yl]methyl acetate 368873 NSC640212 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-phenyl-2,4-bis(sulfanylidene)quinazolin-1-yl]oxan-2-yl]methyl acetate 368629 NSC639741 resistant
hsa-miR-10a-5p [4-[[dimethyl(octadecyl)azaniumyl]methyl]phenyl]methyl-dimethyl-octadecylazanium;bromide 361976 NSC625458 resistant
hsa-miR-10a-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] acetate 9555726 NSC144055 resistant
hsa-miR-10a-5p 1-(dimethylamino)-4-methyl-4H-pyrido[3,4-g]quinoline-5,10-dione 388892 NSC684118 sensitive
hsa-miR-10a-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 resistant
hsa-miR-10a-5p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 resistant
hsa-miR-10a-5p 1-[7-methyl-8-(3,4,5-trimethoxyphenyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]piperazine 384846 NSC675364 resistant
hsa-miR-10a-5p 10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2,4,6,8,11(19),12,14(18)-heptaene-15,17-dione 399629 NSC710546 sensitive
hsa-miR-10a-5p 1h-pyrimido[4,5-b]quinoline-2,4-dithione 5472868 NSC722222 resistant
hsa-miR-10a-5p 2-(11h-indolo[3,2-c]quinolin-6-ylamino)ethanol NSC736606 sensitive
hsa-miR-10a-5p 2-(2-chlorophenyl)-5,7-dihydroxy-8-(3-hydroxy-1-methylpiperidin-4-yl)chromen-4-one 5466794 NSC642740 resistant
hsa-miR-10a-5p 2-trans-n-buten-1-yl-estradiol 5468334 NSC669229 resistant
hsa-miR-10a-5p 2,5-diphenyl-1h-[1,2,4]triazino[4,3-a]quinoxaline 399102 NSC709518 resistant
hsa-miR-10a-5p 3-(((cyclohexylamino)carbonyl)oxy)-4-methyl-1,3-thiazole-2(3h)-thione 372703 NSC648263 resistant
hsa-miR-10a-5p 3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-phenyl-3,4-dihydropyrazole-2-carbaldehyde 155810020 NSC762559 resistant
hsa-miR-10a-5p 3,3,4,4,4-pentachloro-1-phenylbutan-1-one 405828 NSC723515 sensitive
hsa-miR-10a-5p 4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 374328 NSC651852 resistant
hsa-miR-10a-5p 4-appt 5995211 NSC195327 resistant
hsa-miR-10a-5p 4-methyl-3-[4-[2-[4-(4-methyl-5-sulfanylidene-1h-1,2,4-triazol-3-yl)phenyl]iminohydrazinyl]phenyl]-1h-1,2,4-triazole-5-thione 5472009 NSC715974 resistant
hsa-miR-10a-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 resistant
hsa-miR-10a-5p 5'-chloro-2'-methoxy-3-nitrosalicylanilide 186169 NSC79459 resistant
hsa-miR-10a-5p 5,6-dimethoxy-9-(methylthio)furo[3',4':4,5]cyclopenta[1,2,3-ij]isoquinoline 363754 NSC628946 resistant
hsa-miR-10a-5p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-10a-5p 6-(chloromethyl)-2-oxo-N-pentylchromene-3-carboxamide 402500 NSC716526 sensitive
hsa-miR-10a-5p 6-methoxy-1h-pyrazolo[3,4-b]quinoxalin-3-amine 395806 NSC700694 resistant
hsa-miR-10a-5p 6,7-diacetoxyisoflavan 353129 NSC600289 resistant
hsa-miR-10a-5p 8-[(4-tert-butylphenoxy)methyl]-1,3-dimethyl-7H-purine-2,6-dione 235292 NSC36525 resistant
hsa-miR-10a-5p 8455ab 1549990 NSC24189 resistant
hsa-miR-10a-5p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 resistant
hsa-miR-10a-5p Antibiotic p 168 5477807 NSC356885 resistant
hsa-miR-10a-5p Antineoplastic-656904 376224 NSC656904 resistant
hsa-miR-10a-5p Aquatris(1,3-diphenylpropane-1,3-dionato)neodymium(iii) 24202395 NSC647040 resistant
hsa-miR-10a-5p Bas100 monohydrate 45028404 NSC742554 resistant
hsa-miR-10a-5p Berberine iodide 72350 NSC150446 resistant
hsa-miR-10a-5p Bindschedler's green 73516 NSC7811 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p C4, carbonyl, ethyl prodigiosine 135540855 NSC742416 resistant
hsa-miR-10a-5p Cgp 57380 11644425 NSC741567 sensitive
hsa-miR-10a-5p Cinerubin a hcl 5458466 NSC243022 sensitive
hsa-miR-10a-5p Cis-dichlorobis(4-methoxyphenethylamine)platinum(ii) 498558 NSC631305 resistant
hsa-miR-10a-5p Cis-difluorobis(1-phenylhexane-1,3-dionato)titanium(iv) NSC637220 resistant
hsa-miR-10a-5p Cyano-[4-[[[3-(trifluoromethyl)phenyl]methylamino]carbamoyl]pyridin-1-ium-1-yl]boron 6334922 NSC698276 resistant
hsa-miR-10a-5p Cytembena 23663958 NSC104801 resistant
hsa-miR-10a-5p Cytovaricin 5477715 NSC349622 resistant
hsa-miR-10a-5p Diethyl 2-[[4-[[[3-ethoxycarbonyl-7-(trifluoromethyl)quinoxalin-2-yl]amino]methyl]benzoyl]amino]pentanedioate 390810 NSC688812 resistant
hsa-miR-10a-5p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-10a-5p Echinomycin 3197 NSC526417 resistant
hsa-miR-10a-5p Ethyl 2-((4-(2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494007 NSC691084 resistant
hsa-miR-10a-5p Ethyl 2-((4-(6-bromo-2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494008 NSC691085 resistant
hsa-miR-10a-5p Ethyl 5-amino-4-(3,4-dihydro-2h-1,5-benzodioxepin-7-ylamino)-2-methylsulfanylthieno[2,3-d]pyrimidine-6-carboxylate 399955 NSC711107 resistant
hsa-miR-10a-5p From combretum caffrum plant 5386397 NSC609397 resistant
hsa-miR-10a-5p Kuc100204 378309 NSC660313 resistant
hsa-miR-10a-5p Lddhtajmmdseme-okkqscsosa-n 6712634 NSC702655 sensitive
hsa-miR-10a-5p Ls-77867 395636 NSC700418 resistant
hsa-miR-10a-5p Methyl (1s,10r)-6-methyl-10-nonyl-7,9,12-triazatricyclo[6.3.1.04,12]dodeca-5,8-diene-5-carboxylate 401693 NSC715423 resistant
hsa-miR-10a-5p Methyl 3-butylsulfanyl-2-[[(e)-3-(6-methyl-2,4-dioxo-1h-pyrimidin-5-yl)prop-2-enoyl]amino]propanoate 5383838 NSC201241 resistant
hsa-miR-10a-5p Mggh 5351153 NSC32946 resistant
hsa-miR-10a-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 resistant
hsa-miR-10a-5p N-[3-bromo-6-oxo-1-(4-phenylpiperidin-1-yl)-4,5-dihydrocyclopenta[c]thiophen-4-yl]-2,2,2-trifluoroacetamide 378804 NSC662123 resistant
hsa-miR-10a-5p NSC657492 NSC657492 sensitive
hsa-miR-10a-5p NSC751830 NSC751830 sensitive
hsa-miR-10a-5p Plumericin 5281545 NSC112152 resistant
hsa-miR-10a-5p Propan-2-yl (1r,9s,12e)-3,4,6-trimethoxy-11-[(4-methoxyphenyl)methyl]-5-methyl-10-oxo-12-[(2,4,5-trimethoxy-3-methylphenyl)methylidene]-11,13-diazatricyclo[7.3.1.02,7]trideca-2(7),3,5-triene-13-carbox 6330789 NSC622075 resistant
hsa-miR-10a-5p Resorufin 69462 NSC12097 resistant
hsa-miR-10a-5p Rhamnazin 5320945 NSC678106 resistant
hsa-miR-10a-5p Roridin a, 8-hydroxy-9b,10b-epoxy- 5458716 NSC327993 resistant
hsa-miR-10a-5p Sb-236687 17892742 NSC756422 sensitive
hsa-miR-10a-5p Sergeolide,desacetyl 125729 NSC364170 resistant
hsa-miR-10a-5p Sodium;4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 54612576 NSC651853 resistant
hsa-miR-10a-5p Tert-butyl n-[6-[2-[(2-amino-2-oxoethyl)carbamoyl]pyrrolidin-1-yl]-5-(9h-fluoren-9-ylmethoxycarbonylamino)-6-oxohexyl]carbamate 383818 NSC672434 sensitive
hsa-miR-10a-5p Tetra(isobutenyl)antimony bromide NSC651199 resistant
hsa-miR-10a-5p Tributylgermyl 2-acetoxy-2-phenyl-acetate 16683233 NSC645575 resistant
hsa-miR-10a-5p Verrucarin a 9,10-epoxide 5358836 NSC283445 sensitive
hsa-miR-10a-5p Z28714792 2671841 NSC746248 resistant
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-10a-5p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Esophageal Squamous Cell Carcinoma tissue and cell line (TE1, TE5, TE8, TE9, TE10, TE11, TE13)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PaCa-2)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Vinorelbine 44424639 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-10a-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-10a-5p Cytarabine 6253 NSC287459 approved sensitive Low Acute Myeloid Leukemia tissue and cell line (KG-1a, Kasumi-1, K562, OCI-AML3)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant Low Acute Myeloid Leukemia tissue and cell line (HL-60)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (HepG2, Huh-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Small Cell Lung Cancer cell line (H446)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-10a-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-10a-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (W1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (TE1, KYSE450)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3ip1, HeyA8)
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (A172)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HS578T)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-10a-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-10a-5p Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-10a-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Methotrexate 126941 NSC740 approved sensitive cell line (HT29)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant <