pre-miRNA Information
pre-miRNA hsa-mir-10a   
Genomic Coordinates chr17: 48579838 - 48579947
Synonyms MIRN10A, hsa-mir-10a, miRNA10A, mir-10a, MIR10A
Description Homo sapiens miR-10a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-10a-5p
Sequence 22| UACCCUGUAGAUCCGAAUUUGUG |44
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30152819 13 COSMIC
COSN30458892 14 COSMIC
COSN23023008 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1333990950 2 dbSNP
rs770328167 3 dbSNP
rs1453440972 5 dbSNP
rs1391955925 7 dbSNP
rs1157653116 8 dbSNP
rs760091682 10 dbSNP
rs1161287321 12 dbSNP
rs369632753 13 dbSNP
rs985848773 14 dbSNP
rs772649724 18 dbSNP
rs529115879 22 dbSNP
rs375865628 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B6HZE2 miR-10a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Muscle Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol TLE3   
Synonyms ESG, ESG3, GRG3, HsT18976
Description transducin like enhancer of split 3
Transcript NM_001105192   
Other Transcripts NM_005078 , NM_020908   
Expression
Putative miRNA Targets on TLE3
3'UTR of TLE3
(miRNA target sites are highlighted)
>TLE3|NM_001105192|3'UTR
   1 ACAAGAACTCCAGCAGGGCTGTCAAACTCTGGGAGAAACCGACTCGGCTCTGACAGGGAGACCCCCAGGCGAGGGGCCCC
  81 GAGGATGGCGGAGGATGGGCCGCAGGCAGCCGAGCGTTCAGGGCTGCGCTCCGGCCGGCTGAGAGGGCACGTGCCCCGTC
 161 ACAGTCTGGACTCCTGGGCCTGGATTGATGTGTCTCACAGACTCGGAAGGGTTCTGCTCCTCCTCCTCCCCCTGAACAAT
 241 GCTGGCAGTTGCTACAAATAGATTTATTGGAGGCTTATGGCTCCGGTTCCCCCACAGACCCGCTCATGAGTCTCTGTTTG
 321 TTCTTCCCTTTTCTTTTGCCCTGTCCCTCACCTTGGGTCGGGGGTGCTGGAGTGGACCACAATGTTGTGCTGGGGGATGG
 401 GGGGGTCTCTCTTTGCCGATTGTGCAGTGCACAAGATTTGTGAAAAATGTAAATAACAGACTCCTATTGCGGACTGATCA
 481 GTGGGAGAGGAGGCCCCTTCCCACCGGAAACTCTGAGTGTGTATTTCGCCTGCTGTATTTGTAATCCACTCGTGGTGGTG
 561 GCTTTTTTTTTTTTTTTTTTTTAAATAAACAGATGCTCTCACCTGGGAAGAGGAGACAGGGAGGGGAACCAATTGAAGAA
 641 AGAGGAGAAAAGTCTTAGAGTGTGGAAAAGGCAACCAGGTTGGCCGTAAGGTGCCTGCTGGAATGCGTGTGCCTCCACAC
 721 GGGTCTGGGCATCCGGACTGATAACCAGCCGGCCAGACTGAGGGATGGAAGGCACTGAGATGGGGGCCCGTCCAGGCGGA
 801 CACCCGCAGAAATGGAGCTTTCTGTGGTCTCTTGCACTCTGGCTGCCTCTTGCCCTCTCTGTGTCTCTCTTTCTTGGTCT
 881 CTCCCTCTCTCCTCCTCAGCCTGGTCTTTCTCTTTGGTGCACACTTAGTTATTGTTGTGAGCAATGGAAGTTCAAAGGAA
 961 CTCCCTCTCCAGCTCTTCTGAATCTTGGGACACAGCCTAAAAAGGACAAAAAGTTAGAAGACAGCATAGCAACTCAGCTC
1041 AGGGAGCTACCAGAGAAAAATAGCAACTGATGTGGGTGCTTTTTTTTTTTTTTTAATTTGAATAAAAAGAATTAGAAGTG
1121 ATGTCCTTTTATAAAATGCCTTCTCCCCCTTCCCGCCTACAGTCTCTTCCTCTCCCCTTAGAGGGGGGAAAGTGTATAAA
1201 CCTACAGGGTTGTGAGTCTGAAAAGAGGATCCCCCTCACCCCCACCCTGGGCAGAGCAGTGGGGGTTGGGGGGTGGGAGA
1281 GGGGGACACAGATCCTGGCACACTGTGGATATTTCTTGCAGATTGCAGTCTCTTGTGGCCCAAACAGGTTAGGTAGACTA
1361 TCGCCTCTGGCAGGTGCCACCTTTTGGTACCAACATGTTCTGAGGTGTTAGGATTTGGGTTGGGTTTTTTTTGTTTGTTT
1441 TTTTTTTCCTTTTGGTCTTTTTTTTTTTCTCCTTTTAAAGAAAAGCTAAAGGCCGCTGTGAGTCCTGGTGGCAGGCTCTC
1521 CATGGATGTAGCATATCGAAGATAATTTTTATACTGCATTTTTATGGATTATTTTGTAATGTGTGATTCCGTCTGCTGAG
1601 GAGGTGGGAGGGGCTCCAGGGAAAGCCACCCACCTTCAGTGAGGTTGCTCCCCAGCTGAGCGCACCGGGCATGGGATGTG
1681 GAGGCTGGCGACACACCCTGTGCCTCTCCAAGGCTGGGCGCGTGGGGCGTCCAGAGTCTCTCTGGGTCTCAGATGTCCAT
1761 CTGCCACCTCTTGTTAAGGCTCTAGCCAGAAGGGAGGGTGAGGGTAGAAGAAAGTTATTCCCGAAGAAAAAAAGAATGAA
1841 AAGTCATTGTACTGAACTGTTTTTATATTTTTAAAAGTTACTATTTAAAGGTTGGTTTGATTGTTGCGTCTTAATTGCCT
1921 CTCCCCCCAGTTTGCCAGTCCCGCCCCCCGCCCCCCGGGAAAACAGCCAGGCCACTGTTGCTGTCACATTCTGGAGCCTG
2001 GGCCAGGGCCATTTCCCATCGATGTGAGCTCTTCTCATCTCACAGCATTCCCTGCGCTGCTTCCACCCCCTTCTCCCCTT
2081 CCAGATACCCAGCATCGCAGCAGGGATTTCACAATCCCATACTGTGTCGCCTCCCATCCAAGCGCCAGGGAGGGTGGGGG
2161 GTAGGAGCTAAGACTTCCTCTGGACAGATGGGCAGGGCAGAGTTCACTGAGGTGAAGGAAGACCACAGGTTAACACCAAA
2241 GTATTGTACAGCTGTCAATGCAAAACTTTTTTGGAAAAAAATTAAACGTAATGAACTTGAAGCGAAAAAAAAAAAAAAAA
2321 AA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gugUUUAAGCCUA----GAUGUCCCAu 5'
             ||| | | ||    ||||||||| 
Target 5' gggAAAGT-GTATAAACCTACAGGGTt 3'
1186 - 1211 157.00 -14.60
2
miRNA  3' guGUUUAAGCCUAGA-UGUCCCau 5'
            | :| |||| ||| ||||||  
Target 5' aaCCGACTCGGCTCTGACAGGGag 3'
37 - 60 149.00 -18.10
3
miRNA  3' gugUUUAAGCCUA--GA--UGU-CCCAu 5'
             :||| || :|  ||  ||| |||| 
Target 5' ctgGAATGCGTGTGCCTCCACACGGGTc 3'
698 - 725 124.00 -12.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN13636277 22 COSMIC
COSN26632933 29 COSMIC
COSN30154673 37 COSMIC
COSN30463301 45 COSMIC
COSN30147744 49 COSMIC
COSN30499115 63 COSMIC
COSN30475963 65 COSMIC
COSN31611747 70 COSMIC
COSN20042247 71 COSMIC
COSN26998664 101 COSMIC
COSN23854953 429 COSMIC
COSN15661867 449 COSMIC
COSN4762957 452 COSMIC
COSN25285926 471 COSMIC
COSN32057975 505 COSMIC
COSN24566973 715 COSMIC
COSN4762956 749 COSMIC
COSN6279099 790 COSMIC
COSN1179580 1244 COSMIC
COSN26694564 1254 COSMIC
COSN32058472 1424 COSMIC
COSN20112220 1437 COSMIC
COSN20112221 1438 COSMIC
COSN7247522 1467 COSMIC
COSN21147881 2031 COSMIC
COSN29572086 2119 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1349563378 1 dbSNP
rs1186298917 2 dbSNP
rs764433029 5 dbSNP
rs1407182317 10 dbSNP
rs562099951 11 dbSNP
rs888595782 13 dbSNP
rs775873346 14 dbSNP
rs1235267561 17 dbSNP
rs765850464 18 dbSNP
rs776882640 23 dbSNP
rs762584296 24 dbSNP
rs1179703118 27 dbSNP
rs1215070553 29 dbSNP
rs1488348117 32 dbSNP
rs772951831 38 dbSNP
rs1261833163 39 dbSNP
rs142391489 40 dbSNP
rs747847827 41 dbSNP
rs371314649 43 dbSNP
rs372260637 45 dbSNP
rs957874257 46 dbSNP
rs746908911 50 dbSNP
rs1378057260 54 dbSNP
rs923794535 57 dbSNP
rs1040986548 62 dbSNP
rs79517073 70 dbSNP
rs766008979 71 dbSNP
rs1030255854 72 dbSNP
rs866753991 77 dbSNP
rs531857400 80 dbSNP
rs1042266465 81 dbSNP
rs1305900938 87 dbSNP
rs1374870779 88 dbSNP
rs945330589 89 dbSNP
rs1450711643 90 dbSNP
rs71393476 95 dbSNP
rs546554296 101 dbSNP
rs1172203752 102 dbSNP
rs1469305572 103 dbSNP
rs34658999 105 dbSNP
rs577289858 107 dbSNP
rs926389574 110 dbSNP
rs750965360 111 dbSNP
rs1395036828 112 dbSNP
rs970369566 115 dbSNP
rs765831865 116 dbSNP
rs1353048804 117 dbSNP
rs1441715135 118 dbSNP
rs1474712007 120 dbSNP
rs561444036 127 dbSNP
rs1194449108 128 dbSNP
rs906757776 130 dbSNP
rs983009747 131 dbSNP
rs554795369 132 dbSNP
rs1027534775 133 dbSNP
rs997029654 136 dbSNP
rs368309998 137 dbSNP
rs1019642218 147 dbSNP
rs1008288355 148 dbSNP
rs555227476 150 dbSNP
rs191028358 151 dbSNP
rs576189698 157 dbSNP
rs893724841 158 dbSNP
rs929407302 163 dbSNP
rs1356431119 164 dbSNP
rs1016370102 170 dbSNP
rs1353188703 188 dbSNP
rs937851359 198 dbSNP
rs1312336652 199 dbSNP
rs547935733 204 dbSNP
rs1417136848 206 dbSNP
rs981839379 213 dbSNP
rs1339171793 214 dbSNP
rs187356764 217 dbSNP
rs950564529 219 dbSNP
rs1209607967 221 dbSNP
rs1257570502 225 dbSNP
rs181901383 227 dbSNP
rs1026068985 229 dbSNP
rs949134605 230 dbSNP
rs994263529 231 dbSNP
rs527888346 232 dbSNP
rs982454087 239 dbSNP
rs1475621974 241 dbSNP
rs1025158318 242 dbSNP
rs1421991320 253 dbSNP
rs1433089211 257 dbSNP
rs80167401 284 dbSNP
rs775635307 285 dbSNP
rs369978895 289 dbSNP
rs1326293811 290 dbSNP
rs1431998105 292 dbSNP
rs190078083 293 dbSNP
rs1368388865 294 dbSNP
rs936688376 295 dbSNP
rs1280542070 300 dbSNP
rs548020928 301 dbSNP
rs902562685 302 dbSNP
rs1447501088 306 dbSNP
rs531918642 314 dbSNP
rs1453519335 316 dbSNP
rs933115296 316 dbSNP
rs1483697354 318 dbSNP
rs373282496 323 dbSNP
rs923121294 323 dbSNP
rs1202123786 333 dbSNP
rs1439526425 334 dbSNP
rs1401759547 345 dbSNP
rs1258562838 346 dbSNP
rs1232168753 356 dbSNP
rs1008236157 359 dbSNP
rs903282867 360 dbSNP
rs562970459 364 dbSNP
rs1303702188 372 dbSNP
rs552876928 382 dbSNP
rs984825971 387 dbSNP
rs1278442174 389 dbSNP
rs1011574147 394 dbSNP
rs1372131947 396 dbSNP
rs1297986291 397 dbSNP
rs893160022 399 dbSNP
rs1053696888 401 dbSNP
rs1467870906 404 dbSNP
rs1214022883 405 dbSNP
rs10692075 406 dbSNP
rs1253929066 406 dbSNP
rs545091144 406 dbSNP
rs1470528056 410 dbSNP
rs1160836006 411 dbSNP
rs1416247226 413 dbSNP
rs1326982931 415 dbSNP
rs981177113 415 dbSNP
rs1002554422 417 dbSNP
rs532874628 418 dbSNP
rs1327709097 419 dbSNP
rs1403091931 431 dbSNP
rs1332561506 439 dbSNP
rs745943266 446 dbSNP
rs905003898 453 dbSNP
rs1025128594 457 dbSNP
rs372614752 458 dbSNP
rs895347734 465 dbSNP
rs1489615005 466 dbSNP
rs1167152025 467 dbSNP
rs1250038968 469 dbSNP
rs560480777 470 dbSNP
rs531726474 471 dbSNP
rs148805988 484 dbSNP
rs1047293607 491 dbSNP
rs879017761 495 dbSNP
rs1001243657 496 dbSNP
rs930988809 501 dbSNP
rs919607766 503 dbSNP
rs7169512 505 dbSNP
rs561416110 506 dbSNP
rs1213066055 512 dbSNP
rs767330483 515 dbSNP
rs1354780563 516 dbSNP
rs1491327095 516 dbSNP
rs1415295415 519 dbSNP
rs1467062150 520 dbSNP
rs1274558531 521 dbSNP
rs1295003033 522 dbSNP
rs1042476007 527 dbSNP
rs867130078 528 dbSNP
rs1250986437 534 dbSNP
rs1340306430 535 dbSNP
rs370225822 551 dbSNP
rs967557536 553 dbSNP
rs1020317702 554 dbSNP
rs1222437012 558 dbSNP
rs1379647491 561 dbSNP
rs1278243643 562 dbSNP
rs201500861 562 dbSNP
rs901667086 580 dbSNP
rs1189309423 581 dbSNP
rs62973861 582 dbSNP
rs11324999 583 dbSNP
rs1192903678 583 dbSNP
rs1237828032 583 dbSNP
rs1373356178 583 dbSNP
rs1427122990 583 dbSNP
rs1431216158 583 dbSNP
rs398027812 583 dbSNP
rs56993633 583 dbSNP
rs752685243 583 dbSNP
rs769203034 583 dbSNP
rs780088210 583 dbSNP
rs1440869452 584 dbSNP
rs1491343981 584 dbSNP
rs61999925 585 dbSNP
rs1211613665 586 dbSNP
rs1258347510 586 dbSNP
rs943222210 586 dbSNP
rs1204953347 587 dbSNP
rs1451663206 590 dbSNP
rs1191398546 591 dbSNP
rs534603669 592 dbSNP
rs1177591422 593 dbSNP
rs1343431704 598 dbSNP
rs1452931829 604 dbSNP
rs1289282088 613 dbSNP
rs1012103318 614 dbSNP
rs909091087 618 dbSNP
rs957376213 628 dbSNP
rs1370509179 632 dbSNP
rs1235202787 641 dbSNP
rs1303454680 650 dbSNP
rs1238983862 653 dbSNP
rs562880674 653 dbSNP
rs1048986536 658 dbSNP
rs1466535880 658 dbSNP
rs1034783019 668 dbSNP
rs928943668 669 dbSNP
rs918947811 671 dbSNP
rs375438747 672 dbSNP
rs1421104708 674 dbSNP
rs1380725837 675 dbSNP
rs1468641235 677 dbSNP
rs576155772 685 dbSNP
rs371847423 686 dbSNP
rs1254770596 688 dbSNP
rs184834592 690 dbSNP
rs971154687 697 dbSNP
rs1459729677 703 dbSNP
rs918083500 703 dbSNP
rs905119875 705 dbSNP
rs1046226176 706 dbSNP
rs1258419110 707 dbSNP
rs1394075816 712 dbSNP
rs181158923 713 dbSNP
rs188584866 715 dbSNP
rs553697894 716 dbSNP
rs931071452 720 dbSNP
rs542679272 721 dbSNP
rs780878597 722 dbSNP
rs1272911675 732 dbSNP
rs529660630 734 dbSNP
rs901886478 735 dbSNP
rs912810862 736 dbSNP
rs1303984178 741 dbSNP
rs1177258248 743 dbSNP
rs987046816 747 dbSNP
rs1007779533 749 dbSNP
rs144383829 750 dbSNP
rs554628036 751 dbSNP
rs1361359247 753 dbSNP
rs1406835685 756 dbSNP
rs1167177391 761 dbSNP
rs149469374 762 dbSNP
rs990226810 763 dbSNP
rs957700839 766 dbSNP
rs1352911578 775 dbSNP
rs766035854 783 dbSNP
rs974018211 784 dbSNP
rs1293162577 785 dbSNP
rs1001945740 789 dbSNP
rs915632789 790 dbSNP
rs1176777319 796 dbSNP
rs751184326 797 dbSNP
rs183913737 800 dbSNP
rs1013539464 805 dbSNP
rs886915272 806 dbSNP
rs1484374635 809 dbSNP
rs925501825 810 dbSNP
rs191381418 817 dbSNP
rs1473665083 821 dbSNP
rs1256289136 828 dbSNP
rs1417725445 830 dbSNP
rs967023968 835 dbSNP
rs1021217807 842 dbSNP
rs1372512876 849 dbSNP
rs1432902269 852 dbSNP
rs1210637672 855 dbSNP
rs1346242169 858 dbSNP
rs1258134059 859 dbSNP
rs1312810691 859 dbSNP
rs995231926 860 dbSNP
rs898240154 861 dbSNP
rs1234653878 865 dbSNP
rs1268756588 865 dbSNP
rs1307404554 869 dbSNP
rs1360900204 869 dbSNP
rs997485983 870 dbSNP
rs1039493315 871 dbSNP
rs966049244 871 dbSNP
rs188951221 873 dbSNP
rs1007668792 878 dbSNP
rs1444064625 879 dbSNP
rs1213438221 881 dbSNP
rs532809120 885 dbSNP
rs1475591353 889 dbSNP
rs779782177 892 dbSNP
rs887594804 892 dbSNP
rs890820316 895 dbSNP
rs559393505 898 dbSNP
rs1403589803 900 dbSNP
rs946319807 904 dbSNP
rs1057515 910 dbSNP
rs1057516 912 dbSNP
rs1172911195 919 dbSNP
rs913372111 920 dbSNP
rs990732948 924 dbSNP
rs1461461768 928 dbSNP
rs1045636348 931 dbSNP
rs769641089 932 dbSNP
rs1371216299 938 dbSNP
rs1322149899 939 dbSNP
rs936061324 943 dbSNP
rs894168082 944 dbSNP
rs1274896625 950 dbSNP
rs1347105427 953 dbSNP
rs1055937452 957 dbSNP
rs554578198 959 dbSNP
rs1185443709 961 dbSNP
rs658939 963 dbSNP
rs1465187489 969 dbSNP
rs749937536 972 dbSNP
rs530080303 978 dbSNP
rs1250207222 980 dbSNP
rs1467285497 983 dbSNP
rs1193141840 984 dbSNP
rs971376674 991 dbSNP
rs368389316 995 dbSNP
rs979583513 997 dbSNP
rs765890642 999 dbSNP
rs1258761067 1005 dbSNP
rs1201341681 1006 dbSNP
rs992045552 1007 dbSNP
rs1479023897 1008 dbSNP
rs1157340733 1009 dbSNP
rs1480611457 1012 dbSNP
rs1250054400 1013 dbSNP
rs1407817236 1016 dbSNP
rs1458146071 1018 dbSNP
rs1220556788 1024 dbSNP
rs1318767424 1029 dbSNP
rs945532972 1030 dbSNP
rs1323757341 1032 dbSNP
rs1332349572 1044 dbSNP
rs1292744215 1063 dbSNP
rs561144937 1066 dbSNP
rs951381078 1069 dbSNP
rs976352607 1070 dbSNP
rs1342459560 1072 dbSNP
rs541183993 1074 dbSNP
rs1390562330 1075 dbSNP
rs1333819574 1079 dbSNP
rs1209502142 1080 dbSNP
rs78545270 1081 dbSNP
rs80196193 1082 dbSNP
rs1394268197 1094 dbSNP
rs1017635363 1095 dbSNP
rs1161892408 1095 dbSNP
rs1179731485 1095 dbSNP
rs1453410952 1095 dbSNP
rs1473189046 1095 dbSNP
rs75524903 1095 dbSNP
rs777326176 1095 dbSNP
rs1333354488 1096 dbSNP
rs61999924 1099 dbSNP
rs1393154933 1100 dbSNP
rs1162144831 1101 dbSNP
rs1163486345 1106 dbSNP
rs1392362592 1108 dbSNP
rs1407773827 1109 dbSNP
rs1327564161 1110 dbSNP
rs952203628 1111 dbSNP
rs185486701 1116 dbSNP
rs1291316095 1119 dbSNP
rs993311978 1124 dbSNP
rs1245169668 1131 dbSNP
rs1266317022 1133 dbSNP
rs754325246 1136 dbSNP
rs562295466 1139 dbSNP
rs1194193702 1142 dbSNP
rs1273986001 1148 dbSNP
rs897681694 1150 dbSNP
rs1185018331 1152 dbSNP
rs545590418 1154 dbSNP
rs898361691 1155 dbSNP
rs1188664081 1157 dbSNP
rs1369907655 1161 dbSNP
rs1474208431 1169 dbSNP
rs1166907403 1176 dbSNP
rs576667222 1178 dbSNP
rs1431032072 1183 dbSNP
rs1236716365 1185 dbSNP
rs1006619270 1186 dbSNP
rs1458581945 1187 dbSNP
rs1055503409 1189 dbSNP
rs536275598 1189 dbSNP
rs1396455147 1192 dbSNP
rs192927725 1194 dbSNP
rs139401654 1196 dbSNP
rs147381770 1205 dbSNP
rs946269342 1208 dbSNP
rs1297096338 1209 dbSNP
rs1342968329 1210 dbSNP
rs1207311738 1211 dbSNP
rs892047280 1219 dbSNP
rs1483208023 1222 dbSNP
rs1201434729 1224 dbSNP
rs1427064667 1225 dbSNP
rs1487503202 1229 dbSNP
rs1041872467 1230 dbSNP
rs1333836839 1231 dbSNP
rs571308875 1232 dbSNP
rs367705933 1234 dbSNP
rs528782355 1236 dbSNP
rs1304468090 1240 dbSNP
rs758988858 1240 dbSNP
rs936161369 1243 dbSNP
rs1381376837 1251 dbSNP
rs1406538415 1261 dbSNP
rs927514889 1262 dbSNP
rs980166536 1263 dbSNP
rs950123853 1265 dbSNP
rs1451170356 1266 dbSNP
rs1378897012 1268 dbSNP
rs1234638941 1269 dbSNP
rs3195776 1270 dbSNP
rs986111278 1270 dbSNP
rs574347761 1271 dbSNP
rs554285655 1272 dbSNP
rs1027714558 1273 dbSNP
rs1178146977 1274 dbSNP
rs1361939184 1274 dbSNP
rs1456565957 1275 dbSNP
rs972145809 1280 dbSNP
rs1389716289 1281 dbSNP
rs961839677 1282 dbSNP
rs950785853 1283 dbSNP
rs1366996690 1286 dbSNP
rs1387363155 1290 dbSNP
rs918490229 1292 dbSNP
rs958607404 1293 dbSNP
rs1228205680 1295 dbSNP
rs974045304 1299 dbSNP
rs1269137135 1301 dbSNP
rs1331612354 1305 dbSNP
rs1034686704 1308 dbSNP
rs663517 1311 dbSNP
rs904207094 1315 dbSNP
rs538719444 1321 dbSNP
rs1472208166 1325 dbSNP
rs1006566894 1336 dbSNP
rs754776321 1337 dbSNP
rs558734624 1339 dbSNP
rs1010020661 1341 dbSNP
rs539229549 1347 dbSNP
rs1040605480 1354 dbSNP
rs774384473 1358 dbSNP
rs1349499126 1359 dbSNP
rs1010316256 1360 dbSNP
rs1301088388 1361 dbSNP
rs891496452 1362 dbSNP
rs1051133666 1363 dbSNP
rs1316979596 1365 dbSNP
rs1289483220 1371 dbSNP
rs1352720771 1374 dbSNP
rs1055105217 1380 dbSNP
rs1000478569 1393 dbSNP
rs28694338 1395 dbSNP
rs1160855456 1400 dbSNP
rs1321948013 1405 dbSNP
rs1223187429 1407 dbSNP
rs1341880860 1413 dbSNP
rs906004721 1417 dbSNP
rs1249092519 1418 dbSNP
rs771000537 1419 dbSNP
rs1395020732 1424 dbSNP
rs1474134127 1425 dbSNP
rs76700928 1426 dbSNP
rs1413392821 1427 dbSNP
rs917332294 1429 dbSNP
rs1278417231 1433 dbSNP
rs374535045 1433 dbSNP
rs370550810 1437 dbSNP
rs1192500952 1438 dbSNP
rs1446374226 1438 dbSNP
rs1491291828 1438 dbSNP
rs1491587704 1439 dbSNP
rs1265529903 1440 dbSNP
rs1294859559 1440 dbSNP
rs1000546113 1441 dbSNP
rs1034249254 1441 dbSNP
rs968403055 1441 dbSNP
rs1019997931 1445 dbSNP
rs1343212192 1446 dbSNP
rs11072133 1447 dbSNP
rs139167120 1448 dbSNP
rs1449002631 1448 dbSNP
rs531097533 1448 dbSNP
rs71794409 1448 dbSNP
rs1169301028 1452 dbSNP
rs1392618015 1454 dbSNP
rs1217083445 1456 dbSNP
rs1413247098 1463 dbSNP
rs530340880 1467 dbSNP
rs1276234565 1468 dbSNP
rs1228549222 1469 dbSNP
rs1450561229 1469 dbSNP
rs900883970 1469 dbSNP
rs1299150324 1470 dbSNP
rs1414922360 1471 dbSNP
rs1220910841 1472 dbSNP
rs1218607441 1485 dbSNP
rs1040825580 1491 dbSNP
rs1313755953 1492 dbSNP
rs781126370 1494 dbSNP
rs567607714 1495 dbSNP
rs1464592075 1496 dbSNP
rs1427991370 1498 dbSNP
rs1250007843 1500 dbSNP
rs1477060366 1502 dbSNP
rs1047875638 1505 dbSNP
rs889306000 1506 dbSNP
rs1426465210 1508 dbSNP
rs761206398 1512 dbSNP
rs1416578294 1518 dbSNP
rs929284781 1519 dbSNP
rs1298365203 1520 dbSNP
rs1050685509 1523 dbSNP
rs1375264591 1525 dbSNP
rs1332584552 1537 dbSNP
rs550701908 1538 dbSNP
rs974373103 1546 dbSNP
rs1167417454 1559 dbSNP
rs1435056927 1564 dbSNP
rs1476850563 1580 dbSNP
rs1425860816 1590 dbSNP
rs962671299 1591 dbSNP
rs1226390439 1594 dbSNP
rs1267240241 1595 dbSNP
rs940700865 1596 dbSNP
rs569794353 1602 dbSNP
rs530979647 1608 dbSNP
rs1211910784 1614 dbSNP
rs985263845 1621 dbSNP
rs955247556 1629 dbSNP
rs1198238560 1632 dbSNP
rs1442966979 1633 dbSNP
rs1479276937 1639 dbSNP
rs565028529 1643 dbSNP
rs1272121669 1650 dbSNP
rs138852351 1661 dbSNP
rs545132155 1662 dbSNP
rs556093838 1666 dbSNP
rs955881477 1667 dbSNP
rs768336607 1669 dbSNP
rs1000819598 1671 dbSNP
rs537793055 1672 dbSNP
rs969081120 1674 dbSNP
rs1376457869 1677 dbSNP
rs1407949386 1683 dbSNP
rs906114986 1689 dbSNP
rs535883705 1690 dbSNP
rs1014422554 1694 dbSNP
rs896014453 1695 dbSNP
rs746812573 1696 dbSNP
rs1281556532 1698 dbSNP
rs559937546 1702 dbSNP
rs1354466673 1705 dbSNP
rs965055683 1707 dbSNP
rs929424789 1714 dbSNP
rs1019351621 1716 dbSNP
rs920563288 1717 dbSNP
rs1037716406 1719 dbSNP
rs369705429 1720 dbSNP
rs777235128 1721 dbSNP
rs146014797 1722 dbSNP
rs1472248693 1725 dbSNP
rs899388079 1727 dbSNP
rs985378563 1728 dbSNP
rs933815187 1729 dbSNP
rs1183383379 1735 dbSNP
rs1307402550 1736 dbSNP
rs1371081426 1738 dbSNP
rs779908485 1741 dbSNP
rs370214333 1743 dbSNP
rs1339599017 1745 dbSNP
rs1244373849 1753 dbSNP
rs1284931330 1757 dbSNP
rs376459734 1758 dbSNP
rs955830784 1763 dbSNP
rs940669956 1766 dbSNP
rs377451123 1769 dbSNP
rs11540323 1770 dbSNP
rs758099632 1771 dbSNP
rs1197977998 1777 dbSNP
rs543863707 1794 dbSNP
rs1254541635 1804 dbSNP
rs1442169528 1807 dbSNP
rs1187824525 1809 dbSNP
rs1057132833 1815 dbSNP
rs937459123 1816 dbSNP
rs376180218 1818 dbSNP
rs978446668 1819 dbSNP
rs969744323 1822 dbSNP
rs1258169819 1823 dbSNP
rs1390759061 1823 dbSNP
rs1212478730 1824 dbSNP
rs1319561502 1826 dbSNP
rs1023208754 1828 dbSNP
rs1014537298 1832 dbSNP
rs1401239717 1833 dbSNP
rs371645223 1834 dbSNP
rs913125955 1834 dbSNP
rs947248319 1834 dbSNP
rs895963516 1840 dbSNP
rs750064021 1846 dbSNP
rs1424492860 1854 dbSNP
rs1380437376 1857 dbSNP
rs1296938158 1860 dbSNP
rs1308947127 1862 dbSNP
rs1230304106 1878 dbSNP
rs993955828 1881 dbSNP
rs1254706608 1882 dbSNP
rs1445275877 1892 dbSNP
rs1379692563 1894 dbSNP
rs899251484 1895 dbSNP
rs575353417 1896 dbSNP
rs1332160601 1899 dbSNP
rs1457412880 1901 dbSNP
rs1038231668 1902 dbSNP
rs1466419385 1903 dbSNP
rs1178285698 1905 dbSNP
rs558673164 1907 dbSNP
rs965028604 1908 dbSNP
rs1320097024 1921 dbSNP
rs889145313 1922 dbSNP
rs3743309 1925 dbSNP
rs573438095 1927 dbSNP
rs1265410449 1930 dbSNP
rs985223961 1930 dbSNP
rs1207716170 1938 dbSNP
rs1407045301 1942 dbSNP
rs1176494035 1943 dbSNP
rs1441502277 1944 dbSNP
rs1201439909 1945 dbSNP
rs75902277 1945 dbSNP
rs1192485212 1949 dbSNP
rs1026741335 1950 dbSNP
rs1346002309 1950 dbSNP
rs536902543 1951 dbSNP
rs540119946 1951 dbSNP
rs1390042081 1954 dbSNP
rs1387889279 1956 dbSNP
rs1349028886 1957 dbSNP
rs769037635 1957 dbSNP
rs1005122746 1958 dbSNP
rs762654710 1958 dbSNP
rs1221898207 1959 dbSNP
rs1318319193 1960 dbSNP
rs1218804946 1964 dbSNP
rs1315935752 1964 dbSNP
rs1285775981 1965 dbSNP
rs933930231 1966 dbSNP
rs1356471201 1968 dbSNP
rs1239515412 1973 dbSNP
rs1224639018 1981 dbSNP
rs748458458 1981 dbSNP
rs1310559243 1983 dbSNP
rs566683769 1990 dbSNP
rs988661545 1991 dbSNP
rs528024012 1993 dbSNP
rs754309707 1996 dbSNP
rs1295341385 2000 dbSNP
rs551296978 2002 dbSNP
rs1409048428 2004 dbSNP
rs1360089923 2013 dbSNP
rs1162893744 2018 dbSNP
rs1367967874 2019 dbSNP
rs764657604 2020 dbSNP
rs756494601 2021 dbSNP
rs1375919683 2025 dbSNP
rs1226289813 2026 dbSNP
rs944101798 2035 dbSNP
rs1321810743 2037 dbSNP
rs1247519077 2041 dbSNP
rs377668355 2055 dbSNP
rs537035717 2056 dbSNP
rs1482113146 2064 dbSNP
rs960281313 2066 dbSNP
rs1026864908 2069 dbSNP
rs1165512390 2071 dbSNP
rs1388915883 2073 dbSNP
rs993672546 2076 dbSNP
rs1171688743 2093 dbSNP
rs753040056 2094 dbSNP
rs899368077 2096 dbSNP
rs1016331339 2097 dbSNP
rs1294792796 2108 dbSNP
rs1191217281 2112 dbSNP
rs1215091420 2113 dbSNP
rs1274954208 2117 dbSNP
rs1310278156 2119 dbSNP
rs114712014 2121 dbSNP
rs1260503581 2126 dbSNP
rs373728986 2128 dbSNP
rs1051731604 2129 dbSNP
rs933868217 2134 dbSNP
rs963502557 2137 dbSNP
rs528580419 2143 dbSNP
rs533021982 2144 dbSNP
rs559876118 2146 dbSNP
rs1175763619 2156 dbSNP
rs546483118 2158 dbSNP
rs1470767364 2159 dbSNP
rs199581038 2160 dbSNP
rs767768493 2161 dbSNP
rs1035954508 2162 dbSNP
rs960244751 2162 dbSNP
rs1271926438 2163 dbSNP
rs1365367202 2173 dbSNP
rs1001913066 2179 dbSNP
rs1263554237 2190 dbSNP
rs1325369779 2191 dbSNP
rs925808859 2194 dbSNP
rs1219818506 2203 dbSNP
rs1340138655 2206 dbSNP
rs1266410617 2214 dbSNP
rs905882445 2221 dbSNP
rs759783073 2225 dbSNP
rs1296650076 2231 dbSNP
rs1402082075 2232 dbSNP
rs1360978038 2234 dbSNP
rs1244376704 2240 dbSNP
rs1477316166 2241 dbSNP
rs1191079152 2258 dbSNP
rs1302019340 2267 dbSNP
rs1011700918 2273 dbSNP
rs575813187 2273 dbSNP
rs1042785458 2275 dbSNP
rs891631429 2282 dbSNP
rs1442312674 2284 dbSNP
rs547128617 2287 dbSNP
rs747462917 2288 dbSNP
rs561018975 2303 dbSNP
rs188536419 2304 dbSNP
rs1347178776 2306 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER- ER- breast cancer 0.432 3.5e-5 0.334 1.3e-3 79 Click to see details
GSE19536 Breast cancer 0.379 5.0e-5 0.289 1.8e-3 100 Click to see details
GSE19350 CNS germ cell tumors -0.722 4.0e-3 -0.622 1.5e-2 12 Click to see details
GSE21032 Prostate cancer -0.263 8.1e-3 -0.230 1.8e-2 83 Click to see details
GSE14794 Lymphoblastoid cells 0.22 1.9e-2 0.164 6.1e-2 90 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.447 2.4e-2 -0.833 2.6e-6 20 Click to see details
GSE21687 Ependynoma primary tumors 0.221 4.0e-2 -0.089 2.4e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.325 5.6e-2 0.468 9.2e-3 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.309 7.6e-2 -0.394 3.1e-2 23 Click to see details
GSE27834 Pluripotent stem cells 0.324 1.1e-1 0.491 2.7e-2 16 Click to see details
GSE28544 Breast cancer -0.217 1.5e-1 -0.301 7.6e-2 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.215 1.6e-1 -0.214 1.6e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.376 1.8e-1 -0.310 2.3e-1 8 Click to see details
GSE38226 Liver fibrosis -0.14 2.7e-1 -0.070 3.8e-1 21 Click to see details
GSE17306 Multiple myeloma -0.085 2.8e-1 -0.061 3.4e-1 49 Click to see details
GSE21849 B cell lymphoma 0.105 2.9e-1 0.097 3.1e-1 29 Click to see details
GSE28260 Renal cortex and medulla 0.158 3.0e-1 0.264 1.9e-1 13 Click to see details
GSE19783 ER+ ER+ breast cancer 0.099 3.4e-1 0.176 2.3e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.075 3.6e-1 -0.020 4.6e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.036 4.2e-1 -0.221 1.1e-1 32 Click to see details
GSE17498 Multiple myeloma 0.001 5.0e-1 -0.038 4.1e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.286 0.01 0.309 0.01 68 Click to see details
ESCA -0.687 0.01 -0.664 0.01 11 Click to see details
KIRP 0.41 0.01 0.514 0 32 Click to see details
BRCA 0.252 0.01 0.096 0.19 84 Click to see details
BLCA 0.503 0.02 0.420 0.04 18 Click to see details
HNSC 0.283 0.03 0.266 0.04 42 Click to see details
PAAD 0.926 0.04 0.400 0.3 4 Click to see details
PCPG 0.989 0.05 1.000 0.5 3 Click to see details
KICH 0.283 0.09 0.329 0.05 25 Click to see details
CESC -0.865 0.17 -0.500 0.33 3 Click to see details
LUAD -0.116 0.36 -0.189 0.28 12 Click to see details
COAD 0.122 0.39 0.262 0.27 8 Click to see details
LIHC 0.036 0.4 0.061 0.34 49 Click to see details
LUSC -0.027 0.44 -0.075 0.33 38 Click to see details
THCA 0.018 0.45 0.034 0.4 59 Click to see details
UCEC -0.023 0.46 0.000 0.5 19 Click to see details
PRAD 0.01 0.47 0.053 0.36 50 Click to see details
STAD -0.012 0.47 -0.058 0.38 32 Click to see details
CHOL -0.009 0.49 -0.100 0.4 9 Click to see details
CHOL -0.009 0.49 -0.100 0.4 9 Click to see details
CHOL -0.009 0.49 -0.100 0.4 9 Click to see details
449 hsa-miR-10a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001140 HOXA1 homeobox A1 4 3
MIRT003896 USF2 upstream transcription factor 2, c-fos interacting 4 1
MIRT005454 NCOR2 nuclear receptor corepressor 2 3 1
MIRT005509 MAP3K7 mitogen-activated protein kinase kinase kinase 7 5 1
MIRT005510 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 7 2
MIRT006536 SRSF1 serine and arginine rich splicing factor 1 1 1
MIRT006537 TRA2B transformer 2 beta homolog 3 3
MIRT006972 EPHA4 EPH receptor A4 4 2
MIRT007021 CHL1 cell adhesion molecule L1 like 1 1
MIRT025588 GPR63 G protein-coupled receptor 63 1 1
MIRT025589 BCL2L13 BCL2 like 13 1 1
MIRT025590 CREB5 cAMP responsive element binding protein 5 1 1
MIRT025591 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT025592 OMA1 OMA1 zinc metallopeptidase 1 1
MIRT025593 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT025594 RBM17 RNA binding motif protein 17 1 1
MIRT025595 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT025596 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT025597 SNX4 sorting nexin 4 2 4
MIRT025598 SERBP1 SERPINE1 mRNA binding protein 1 1 2
MIRT025599 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT025600 NOP16 NOP16 nucleolar protein 1 1
MIRT025601 AJUBA ajuba LIM protein 1 1
MIRT025602 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT025603 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT025604 TMEM101 transmembrane protein 101 2 4
MIRT025605 YES1 YES proto-oncogene 1, Src family tyrosine kinase 1 1
MIRT025606 DUSP3 dual specificity phosphatase 3 1 1
MIRT025607 PANX1 pannexin 1 1 1
MIRT025608 WEE1 WEE1 G2 checkpoint kinase 1 1
MIRT025609 TLE3 transducin like enhancer of split 3 1 1
MIRT025610 PDPK1 3-phosphoinositide dependent protein kinase 1 1 1
MIRT025611 CMPK1 cytidine/uridine monophosphate kinase 1 2 6
MIRT025612 NDUFB6 NADH:ubiquinone oxidoreductase subunit B6 1 1
MIRT025613 ARPC5 actin related protein 2/3 complex subunit 5 1 1
MIRT025614 PUM2 pumilio RNA binding family member 2 1 1
MIRT025615 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT025616 ACVR2A activin A receptor type 2A 2 2
MIRT025617 RBM12B RNA binding motif protein 12B 2 5
MIRT025618 THUMPD1 THUMP domain containing 1 1 2
MIRT025619 BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 1 1
MIRT025620 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT025621 XRN1 5'-3' exoribonuclease 1 1 1
MIRT025622 E2F7 E2F transcription factor 7 1 1
MIRT025623 LCA5 LCA5, lebercilin 1 1
MIRT025624 ELOVL2 ELOVL fatty acid elongase 2 1 1
MIRT025625 TFAP2C transcription factor AP-2 gamma 2 3
MIRT025626 TRIM2 tripartite motif containing 2 2 4
MIRT025627 HOXB3 homeobox B3 2 5
MIRT047505 FUS FUS RNA binding protein 1 1
MIRT047506 LMBR1L limb development membrane protein 1 like 1 1
MIRT047507 HSP90AA1 heat shock protein 90 alpha family class A member 1 1 1
MIRT047508 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT047509 EXTL3 exostosin like glycosyltransferase 3 1 1
MIRT047510 POLR2A RNA polymerase II subunit A 1 1
MIRT047511 RIOK2 RIO kinase 2 1 1
MIRT047512 C12orf76 chromosome 12 open reading frame 76 1 1
MIRT047513 CCDC151 coiled-coil domain containing 151 1 1
MIRT047514 FAT2 FAT atypical cadherin 2 1 1
MIRT047515 TPI1 triosephosphate isomerase 1 1 1
MIRT047516 BTAF1 B-TFIID TATA-box binding protein associated factor 1 1 1
MIRT047517 MSANTD1 Myb/SANT DNA binding domain containing 1 1 1
MIRT047518 PLA2G4A phospholipase A2 group IVA 1 1
MIRT047519 IGSF1 immunoglobulin superfamily member 1 1 1
MIRT047520 LEMD3 LEM domain containing 3 1 1
MIRT047521 E2F1 E2F transcription factor 1 1 1
MIRT047522 KIF3B kinesin family member 3B 1 1
MIRT047523 GBAS nipsnap homolog 2 1 1
MIRT047524 LIMA1 LIM domain and actin binding 1 1 1
MIRT047525 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT047526 MRC2 mannose receptor C type 2 1 1
MIRT047527 TMEM106B transmembrane protein 106B 1 1
MIRT047528 ZFP30 ZFP30 zinc finger protein 1 1
MIRT047529 AMPD1 adenosine monophosphate deaminase 1 1 1
MIRT047530 SLC2A3 solute carrier family 2 member 3 1 1
MIRT047531 RPL15 ribosomal protein L15 1 1
MIRT047532 AGER advanced glycosylation end-product specific receptor 1 1
MIRT047533 CNTLN centlein 1 1
MIRT047534 C21orf59 chromosome 21 open reading frame 59 1 1
MIRT047535 SEPT9 septin 9 1 1
MIRT047536 COL6A2 collagen type VI alpha 2 chain 1 1
MIRT047537 MLNR motilin receptor 1 1
MIRT047538 RTKN2 rhotekin 2 1 1
MIRT047539 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT047540 CSNK2A1 casein kinase 2 alpha 1 2 3
MIRT047541 AQP12B aquaporin 12B 1 1
MIRT047542 AGBL2 ATP/GTP binding protein like 2 1 1
MIRT047543 GOLGA8A golgin A8 family member A 1 1
MIRT047544 CPED1 cadherin like and PC-esterase domain containing 1 1 1
MIRT047545 HSPA8 heat shock protein family A (Hsp70) member 8 1 1
MIRT047546 SLC41A3 solute carrier family 41 member 3 1 1
MIRT047547 KXD1 KxDL motif containing 1 1 1
MIRT047548 RELN reelin 1 1
MIRT047549 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT047550 PTPRT protein tyrosine phosphatase, receptor type T 1 1
MIRT047551 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT047552 CYP8B1 cytochrome P450 family 8 subfamily B member 1 1 1
MIRT047553 COL4A3 collagen type IV alpha 3 chain 1 1
MIRT047554 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT047555 MSL3 MSL complex subunit 3 1 1
MIRT047556 TTC7A tetratricopeptide repeat domain 7A 1 1
MIRT047557 COX7B cytochrome c oxidase subunit 7B 1 1
MIRT047558 ZNF318 zinc finger protein 318 1 1
MIRT047559 ACAA1 acetyl-CoA acyltransferase 1 1 1
MIRT047560 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT047561 SCAP SREBF chaperone 1 1
MIRT047562 KCTD11 potassium channel tetramerization domain containing 11 2 11
MIRT047563 RIOK3 RIO kinase 3 1 1
MIRT047564 C5 complement C5 1 1
MIRT047565 GLB1L3 galactosidase beta 1 like 3 1 1
MIRT047566 PAPD5 poly(A) RNA polymerase D5, non-canonical 1 1
MIRT047567 RNF123 ring finger protein 123 1 1
MIRT047568 ZNF629 zinc finger protein 629 1 1
MIRT047569 AMMECR1L AMMECR1 like 1 1
MIRT047570 KLHL6 kelch like family member 6 1 1
MIRT047571 SYMPK symplekin 1 1
MIRT047572 NCSTN nicastrin 1 1
MIRT047573 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 1
MIRT047574 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT047575 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 1
MIRT047576 RAB18 RAB18, member RAS oncogene family 1 1
MIRT047577 CUL3 cullin 3 1 1
MIRT047578 MTF2 metal response element binding transcription factor 2 1 1
MIRT047579 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT047580 NUP37 nucleoporin 37 1 1
MIRT047581 GPR98 adhesion G protein-coupled receptor V1 1 1
MIRT047582 RUNDC3B RUN domain containing 3B 1 1
MIRT047583 KIF21A kinesin family member 21A 1 1
MIRT047584 FEM1B fem-1 homolog B 1 1
MIRT047585 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT047586 PLA2G4F phospholipase A2 group IVF 1 1
MIRT047587 SNTB2 syntrophin beta 2 1 1
MIRT047588 NUB1 negative regulator of ubiquitin like proteins 1 1 1
MIRT047589 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT047590 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT047591 C11orf63 chromosome 11 open reading frame 63 1 1
MIRT047592 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT047593 CHRNA5 cholinergic receptor nicotinic alpha 5 subunit 1 1
MIRT047594 RPS9 ribosomal protein S9 1 1
MIRT047595 DDX42 DEAD-box helicase 42 1 1
MIRT047596 XPO7 exportin 7 1 1
MIRT047597 PYGL glycogen phosphorylase L 1 1
MIRT047598 TGFB3 transforming growth factor beta 3 1 1
MIRT047599 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT047600 PHB2 prohibitin 2 1 1
MIRT047601 ALDH1A2 aldehyde dehydrogenase 1 family member A2 1 1
MIRT047602 SLC3A2 solute carrier family 3 member 2 1 1
MIRT047603 POLR2H RNA polymerase II subunit H 1 1
MIRT047604 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT047605 MOB3C MOB kinase activator 3C 1 1
MIRT047606 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT047607 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT047608 INTS2 integrator complex subunit 2 1 1
MIRT047609 MYEF2 myelin expression factor 2 1 1
MIRT047610 PANK2 pantothenate kinase 2 1 1
MIRT047611 EMB embigin 1 1
MIRT047612 HK1 hexokinase 1 1 1
MIRT047613 UBE2Z ubiquitin conjugating enzyme E2 Z 1 1
MIRT047614 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT047615 HOXA3 homeobox A3 1 1
MIRT047616 NT5DC1 5'-nucleotidase domain containing 1 1 1
MIRT047617 YOD1 YOD1 deubiquitinase 1 1
MIRT047618 APRT adenine phosphoribosyltransferase 1 1
MIRT047619 C2CD2 C2 calcium dependent domain containing 2 1 1
MIRT047620 SHBG sex hormone binding globulin 1 1
MIRT047621 PPP1R12A protein phosphatase 1 regulatory subunit 12A 1 1
MIRT047622 SCD stearoyl-CoA desaturase 1 1
MIRT047623 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT047624 ETS1 ETS proto-oncogene 1, transcription factor 1 1
MIRT047625 GTF3C2 general transcription factor IIIC subunit 2 1 1
MIRT047626 NOP2 NOP2 nucleolar protein 1 1
MIRT047627 RPS29 ribosomal protein S29 1 1
MIRT047628 LAMC1 laminin subunit gamma 1 1 1
MIRT047629 GNAL G protein subunit alpha L 1 1
MIRT047630 KIAA1147 KIAA1147 1 1
MIRT047631 NACC2 NACC family member 2 1 1
MIRT047632 TMEM179B transmembrane protein 179B 1 1
MIRT047633 ARF3 ADP ribosylation factor 3 1 1
MIRT047634 MCPH1 microcephalin 1 1 1
MIRT047635 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT047636 UBN2 ubinuclein 2 1 1
MIRT047637 ANO6 anoctamin 6 1 1
MIRT047638 NEK7 NIMA related kinase 7 1 1
MIRT047639 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT047640 MED1 mediator complex subunit 1 1 1
MIRT047641 PTPRG protein tyrosine phosphatase, receptor type G 1 1
MIRT047642 ERMN ermin 1 1
MIRT047643 LYPD6 LY6/PLAUR domain containing 6 1 1
MIRT047644 SLC25A5 solute carrier family 25 member 5 1 1
MIRT047645 EPB41L2 erythrocyte membrane protein band 4.1 like 2 1 1
MIRT047646 ARFGEF1 ADP ribosylation factor guanine nucleotide exchange factor 1 1 1
MIRT047647 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT047648 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 1 1
MIRT047649 KLHL23 kelch like family member 23 1 1
MIRT047650 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT047651 HOXD13 homeobox D13 1 1
MIRT047652 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT047653 ZNF592 zinc finger protein 592 1 1
MIRT047654 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT047655 RRP1B ribosomal RNA processing 1B 1 1
MIRT047656 UHRF1 ubiquitin like with PHD and ring finger domains 1 1 1
MIRT047657 SORD sorbitol dehydrogenase 1 1
MIRT047658 PPM1G protein phosphatase, Mg2+/Mn2+ dependent 1G 1 1
MIRT047659 SF3B3 splicing factor 3b subunit 3 1 1
MIRT047660 PRPF8 pre-mRNA processing factor 8 1 1
MIRT047661 PRDX2 peroxiredoxin 2 1 1
MIRT047662 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT047663 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT047664 CAB39L calcium binding protein 39 like 1 1
MIRT047665 ATP5F1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1 1 1
MIRT047666 PARL presenilin associated rhomboid like 1 1
MIRT047667 ERLIN1 ER lipid raft associated 1 1 1
MIRT047668 MARS methionyl-tRNA synthetase 1 1
MIRT047669 TRPM7 transient receptor potential cation channel subfamily M member 7 1 1
MIRT047670 DLG4 discs large MAGUK scaffold protein 4 1 1
MIRT047671 WDR74 WD repeat domain 74 1 1
MIRT047672 PWP1 PWP1 homolog, endonuclein 1 1
MIRT047673 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT047674 NAP1L1 nucleosome assembly protein 1 like 1 1 1
MIRT047675 CTNND1 catenin delta 1 1 1
MIRT047676 IQCB1 IQ motif containing B1 1 1
MIRT047677 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT047678 CDK19 cyclin dependent kinase 19 1 1
MIRT047679 LRP3 LDL receptor related protein 3 1 1
MIRT047680 UBE2D2 ubiquitin conjugating enzyme E2 D2 1 1
MIRT047681 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT047682 GORASP2 golgi reassembly stacking protein 2 1 1
MIRT047683 DDX54 DEAD-box helicase 54 1 1
MIRT047684 CARHSP1 calcium regulated heat stable protein 1 1 1
MIRT047685 FAM168A family with sequence similarity 168 member A 1 1
MIRT047686 SF3B4 splicing factor 3b subunit 4 1 1
MIRT047687 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 1 1
MIRT047688 PLEKHB2 pleckstrin homology domain containing B2 1 1
MIRT047689 LRFN1 leucine rich repeat and fibronectin type III domain containing 1 1 1
MIRT047690 KIAA0100 KIAA0100 1 1
MIRT047691 DVL1 dishevelled segment polarity protein 1 1 1
MIRT047692 NOMO1 NODAL modulator 1 1 1
MIRT047693 MIS12 MIS12, kinetochore complex component 1 1
MIRT047694 GLOD4 glyoxalase domain containing 4 1 1
MIRT047695 USP11 ubiquitin specific peptidase 11 1 1
MIRT047696 UBE3C ubiquitin protein ligase E3C 1 1
MIRT047697 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT047698 SPARC secreted protein acidic and cysteine rich 1 1
MIRT047699 SLC26A2 solute carrier family 26 member 2 1 1
MIRT047700 MED12 mediator complex subunit 12 1 1
MIRT047701 FAM219B family with sequence similarity 219 member B 1 1
MIRT047702 GOSR2 golgi SNAP receptor complex member 2 1 1
MIRT047703 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT047704 PIAS3 protein inhibitor of activated STAT 3 1 1
MIRT047705 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT047706 COL4A2 collagen type IV alpha 2 chain 1 1
MIRT047707 NUP205 nucleoporin 205 1 1
MIRT047708 POLR3A RNA polymerase III subunit A 1 1
MIRT047709 ATG3 autophagy related 3 1 1
MIRT047710 COPA coatomer protein complex subunit alpha 1 1
MIRT047711 CD59 CD59 molecule (CD59 blood group) 1 1
MIRT047712 TENM3 teneurin transmembrane protein 3 1 1
MIRT047713 TUBA1A tubulin alpha 1a 1 1
MIRT047714 LSS lanosterol synthase 1 1
MIRT047715 FASN fatty acid synthase 4 1
MIRT047716 PSMD13 proteasome 26S subunit, non-ATPase 13 1 1
MIRT047717 ZNF618 zinc finger protein 618 1 1
MIRT047718 TSPAN33 tetraspanin 33 1 1
MIRT047719 KANK1 KN motif and ankyrin repeat domains 1 1 1
MIRT047720 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT047721 DPYSL2 dihydropyrimidinase like 2 1 1
MIRT047722 SUPT6H SPT6 homolog, histone chaperone 1 1
MIRT047723 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT047724 ACTG1 actin gamma 1 3 2
MIRT047725 PLSCR1 phospholipid scramblase 1 1 1
MIRT047726 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT047727 SFPQ splicing factor proline and glutamine rich 1 1
MIRT047728 VDAC1 voltage dependent anion channel 1 1 1
MIRT047729 ADCY9 adenylate cyclase 9 1 1
MIRT047730 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT047731 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 1 1
MIRT047732 SLC25A13 solute carrier family 25 member 13 1 1
MIRT047733 IGSF9B immunoglobulin superfamily member 9B 1 1
MIRT047734 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047735 MCU mitochondrial calcium uniporter 1 1
MIRT047736 CDK8 cyclin dependent kinase 8 1 1
MIRT047737 CEP128 centrosomal protein 128 1 1
MIRT047738 TRAPPC12 trafficking protein particle complex 12 1 1
MIRT047739 SYNJ1 synaptojanin 1 1 1
MIRT047740 NOB1 NIN1/PSMD8 binding protein 1 homolog 1 1
MIRT047741 AP5S1 adaptor related protein complex 5 sigma 1 subunit 1 1
MIRT047742 RNF213 ring finger protein 213 1 1
MIRT047743 PSMB1 proteasome subunit beta 1 1 1
MIRT047744 BCR BCR, RhoGEF and GTPase activating protein 1 1
MIRT047745 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT047746 NPTX1 neuronal pentraxin 1 1 1
MIRT047747 PRRC2C proline rich coiled-coil 2C 1 1
MIRT047748 PABPC3 poly(A) binding protein cytoplasmic 3 1 1
MIRT047749 NF2 neurofibromin 2 1 1
MIRT047750 RALBP1 ralA binding protein 1 1 1
MIRT047751 EHD4 EH domain containing 4 1 1
MIRT047752 RLIM ring finger protein, LIM domain interacting 1 1
MIRT076413 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT084600 BCL2L11 BCL2 like 11 3 5
MIRT093335 RAPGEF2 Rap guanine nucleotide exchange factor 2 2 2
MIRT097757 ARSK arylsulfatase family member K 2 2
MIRT099597 ID4 inhibitor of DNA binding 4, HLH protein 2 6
MIRT249192 RAP2A RAP2A, member of RAS oncogene family 2 1
MIRT299201 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT437577 ZFAND5 zinc finger AN1-type containing 5 2 1
MIRT437578 CNST consortin, connexin sorting protein 2 1
MIRT437579 TIAM1 T-cell lymphoma invasion and metastasis 1 2 1
MIRT438258 PTEN phosphatase and tensin homolog 2 2
MIRT438408 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT448051 SFRP1 secreted frizzled related protein 1 2 2
MIRT459965 POC1A POC1 centriolar protein A 2 2
MIRT466175 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT470412 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT475883 H3F3C H3 histone family member 3C 2 10
MIRT475919 H3F3B H3 histone family member 3B 2 8
MIRT493173 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT497272 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT507101 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508100 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT508628 PLA2G2C phospholipase A2 group IIC 2 2
MIRT510735 SON SON DNA binding protein 2 6
MIRT513973 CNOT6 CCR4-NOT transcription complex subunit 6 2 2
MIRT514262 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT514577 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 4
MIRT515044 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515692 TFPI tissue factor pathway inhibitor 2 2
MIRT515752 ONECUT3 one cut homeobox 3 2 2
MIRT517389 METTL7A methyltransferase like 7A 2 2
MIRT519732 ZNF460 zinc finger protein 460 2 2
MIRT520247 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT520270 URGCP upregulator of cell proliferation 2 2
MIRT522213 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT523700 FHL2 four and a half LIM domains 2 2 4
MIRT523978 DVL3 dishevelled segment polarity protein 3 2 2
MIRT525569 MTRNR2L7 MT-RNR2-like 7 2 6
MIRT525619 MTRNR2L3 MT-RNR2-like 3 2 4
MIRT530223 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT530549 SYNPO synaptopodin 2 2
MIRT531041 ZNF502 zinc finger protein 502 2 2
MIRT532579 GSS glutathione synthetase 2 2
MIRT534840 RAB15 RAB15, member RAS oncogene family 2 2
MIRT535793 MTRNR2L11 MT-RNR2-like 11 2 6
MIRT535811 MTRNR2L10 MT-RNR2-like 10 2 4
MIRT536818 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT539894 IRGQ immunity related GTPase Q 2 2
MIRT540209 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT540951 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541937 ORC1 origin recognition complex subunit 1 2 4
MIRT542195 FUT1 fucosyltransferase 1 (H blood group) 2 6
MIRT542374 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542508 WDR13 WD repeat domain 13 2 2
MIRT542575 ZNF280B zinc finger protein 280B 2 2
MIRT542714 RPS15A ribosomal protein S15a 2 2
MIRT546705 RORA RAR related orphan receptor A 5 4
MIRT549929 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550162 ZNF223 zinc finger protein 223 2 4
MIRT558566 CRLF3 cytokine receptor like factor 3 2 4
MIRT560945 TPM4 tropomyosin 4 2 4
MIRT574848 CADM1 cell adhesion molecule 1 2 2
MIRT575176 Atg9a autophagy related 9A 2 2
MIRT576664 Fam216a family with sequence similarity 216, member A 2 2
MIRT609434 MTX3 metaxin 3 2 2
MIRT612162 TCF15 transcription factor 15 2 2
MIRT617414 API5 apoptosis inhibitor 5 2 2
MIRT617469 CCS copper chaperone for superoxide dismutase 2 2
MIRT618780 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618835 PHF20 PHD finger protein 20 2 2
MIRT619339 RNF2 ring finger protein 2 2 2
MIRT625244 C6orf89 chromosome 6 open reading frame 89 2 2
MIRT626439 CHDH choline dehydrogenase 2 2
MIRT634929 CHMP1B charged multivesicular body protein 1B 2 2
MIRT635875 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636235 SLC24A4 solute carrier family 24 member 4 2 2
MIRT636641 CHAF1B chromatin assembly factor 1 subunit B 2 2
MIRT640545 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT648661 ALKBH4 alkB homolog 4, lysine demethylase 2 2
MIRT650186 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT650790 GSR glutathione-disulfide reductase 2 2
MIRT652027 TTYH3 tweety family member 3 2 2
MIRT652517 TMEM109 transmembrane protein 109 2 2
MIRT661940 MAVS mitochondrial antiviral signaling protein 2 2
MIRT661951 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT662020 ZNF445 zinc finger protein 445 2 2
MIRT664015 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT664059 KIAA1551 KIAA1551 2 2
MIRT666872 POU2F2 POU class 2 homeobox 2 2 2
MIRT669168 CCNG1 cyclin G1 2 2
MIRT673243 KLHDC8A kelch domain containing 8A 2 2
MIRT680410 SFT2D2 SFT2 domain containing 2 2 2
MIRT680484 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT683577 CARD8 caspase recruitment domain family member 8 2 2
MIRT684398 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT684558 ZNF708 zinc finger protein 708 2 2
MIRT685421 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT686050 SLC5A5 solute carrier family 5 member 5 2 2
MIRT687955 HHIP hedgehog interacting protein 2 2
MIRT688181 FRRS1 ferric chelate reductase 1 2 2
MIRT688303 FAM208A family with sequence similarity 208 member A 2 2
MIRT688900 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT689205 ZNF574 zinc finger protein 574 2 2
MIRT689917 ACOT13 acyl-CoA thioesterase 13 2 2
MIRT692931 EXOSC2 exosome component 2 2 2
MIRT693632 CENPL centromere protein L 2 2
MIRT694762 FZD2 frizzled class receptor 2 2 2
MIRT695373 PHAX phosphorylated adaptor for RNA export 2 2
MIRT696630 WDR77 WD repeat domain 77 2 2
MIRT696690 APOC3 apolipoprotein C3 2 2
MIRT697367 ZNF394 zinc finger protein 394 2 2
MIRT697611 XIAP X-linked inhibitor of apoptosis 2 2
MIRT697737 USP6NL USP6 N-terminal like 2 2
MIRT697788 UBXN7 UBX domain protein 7 2 2
MIRT698361 TMEM127 transmembrane protein 127 2 2
MIRT704519 CNKSR3 CNKSR family member 3 2 2
MIRT704600 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT705849 AHCY adenosylhomocysteinase 2 2
MIRT707093 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT707154 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT707243 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT707356 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT707459 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707503 AXL AXL receptor tyrosine kinase 2 2
MIRT707647 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT707703 FAM118A family with sequence similarity 118 member A 2 2
MIRT707714 CDC6 cell division cycle 6 2 2
MIRT707825 TMEM170A transmembrane protein 170A 2 2
MIRT707966 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT708006 NUDT4 nudix hydrolase 4 2 2
MIRT708035 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT708073 LIX1L limb and CNS expressed 1 like 2 2
MIRT708131 GK5 glycerol kinase 5 (putative) 2 2
MIRT708200 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT708210 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT708940 CRY2 cryptochrome circadian clock 2 2 2
MIRT709199 SAPCD2 suppressor APC domain containing 2 2 2
MIRT714403 FBXO31 F-box protein 31 2 2
MIRT714629 KIAA1143 KIAA1143 2 2
MIRT720741 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT720894 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT723335 DGAT1 diacylglycerol O-acyltransferase 1 2 2
MIRT724452 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT731180 SERPINE1 serpin family E member 1 3 1
MIRT732377 GP1BA glycoprotein Ib platelet alpha subunit 2 1
MIRT733585 SDC1 syndecan 1 3 0
MIRT734393 ARNTL aryl hydrocarbon receptor nuclear translocator like 3 0
MIRT735361 BDNF brain derived neurotrophic factor 4 0
MIRT735799 MAP2K6 mitogen-activated protein kinase kinase 6 3 0
MIRT735868 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736834 SKA1 spindle and kinetochore associated complex subunit 1 3 0
MIRT737248 LEF1-AS1 LEF1 antisense RNA 1 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-10a RAR-alpha antagonist Ro-41-5253 NULL NULL Northern blot pancreatic cancer 19747919 2009 down-regulated
miR-10a 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-10a Oxaliplatin (L-OHP) approved 5310940 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-10a Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells HT-29 cells 20955366 2011 down-regulated
miR-10a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Microarray acute myeloid leukemia (AML) cell line HL-60 21518431 2011 down-regulated
miR-10a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Quantitative real-time PCR regulatory T cells (T(reg) cells) 22544395 2012 up-regulated
miR-10a Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-10a Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Northern blot fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Quantitative real-time PCR fetal mouse brains 19091803 2009 up-regulated
miR-10a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 up-regualted
miR-10a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-10a-5p Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-10a-5p Comfrey NULL 6440495 Microarray rat liver 21370286 2011 down-regulated
miR-10a-5p Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-10a-5p Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-10a-5p Acarbose Approved 444254 Microarray diabetic rats cells 24260283 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-10a Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-10a Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-10a Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-10a Tamoxifen 2733525 NSC180973 approved sensitive tissue (ER-positive breast cancer)
hsa-mir-10a Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-10a-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 resistant
hsa-miR-10a-5p (3aR)-7-[3-[4-[3-[[(3aR)-8-methoxy-10-oxo-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-7-yl]oxy]propyl]piperazin-1-yl]propoxy]-8-methoxy-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-10-one 24202913 NSC726262 resistant
hsa-miR-10a-5p (4z,6z)-4,6-dibenzylidene-2,2-dimethyl-1,3-dioxan-5-one 5387558 NSC624512 resistant
hsa-miR-10a-5p (5e)-5-benzylidene-3-(2,4,5-trichlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470506 NSC702355 resistant
hsa-miR-10a-5p (6e,7r,8r,8as)-8-methyl-6-[(2r)-2-methylhexylidene]-8-phenylmethoxy-1,2,3,5,7,8a-hexahydroindolizin-7-ol 5470307 NSC699382 resistant
hsa-miR-10a-5p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 resistant
hsa-miR-10a-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-[4-(diethylamino)phenyl]prop-2-en-1-one 5471159 NSC709103 resistant
hsa-miR-10a-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 resistant
hsa-miR-10a-5p (e)-2-methyl-1-[2-(2-methyl-1h-indol-3-yl)indolin-1-yl]but-2-en-1-one 5388204 NSC633484 resistant
hsa-miR-10a-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-(cyclohexanecarbonylamino)-3-cyclohexyl-2-hydroxypropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10 383477 NSC671869 resistant
hsa-miR-10a-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-10a-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-10a-5p [(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-26-[(E)-[(2,4-dinitrophenyl)hydrazinylidene]methyl]-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12,14,16,18,22-heptamethyl-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta-1(29),2,4,9,19,21, 135483937 NSC144126 resistant
hsa-miR-10a-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-2-oxo-6-phenylpyridin-1-yl]oxan-2-yl]methyl acetate 368873 NSC640212 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-phenyl-2,4-bis(sulfanylidene)quinazolin-1-yl]oxan-2-yl]methyl acetate 368629 NSC639741 resistant
hsa-miR-10a-5p [4-[[dimethyl(octadecyl)azaniumyl]methyl]phenyl]methyl-dimethyl-octadecylazanium;bromide 361976 NSC625458 resistant
hsa-miR-10a-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] acetate 9555726 NSC144055 resistant
hsa-miR-10a-5p 1-(dimethylamino)-4-methyl-4H-pyrido[3,4-g]quinoline-5,10-dione 388892 NSC684118 sensitive
hsa-miR-10a-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 resistant
hsa-miR-10a-5p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 resistant
hsa-miR-10a-5p 1-[7-methyl-8-(3,4,5-trimethoxyphenyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]piperazine 384846 NSC675364 resistant
hsa-miR-10a-5p 10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2,4,6,8,11(19),12,14(18)-heptaene-15,17-dione 399629 NSC710546 sensitive
hsa-miR-10a-5p 1h-pyrimido[4,5-b]quinoline-2,4-dithione 5472868 NSC722222 resistant
hsa-miR-10a-5p 2-(11h-indolo[3,2-c]quinolin-6-ylamino)ethanol NSC736606 sensitive
hsa-miR-10a-5p 2-(2-chlorophenyl)-5,7-dihydroxy-8-(3-hydroxy-1-methylpiperidin-4-yl)chromen-4-one 5466794 NSC642740 resistant
hsa-miR-10a-5p 2-trans-n-buten-1-yl-estradiol 5468334 NSC669229 resistant
hsa-miR-10a-5p 2,5-diphenyl-1h-[1,2,4]triazino[4,3-a]quinoxaline 399102 NSC709518 resistant
hsa-miR-10a-5p 3-(((cyclohexylamino)carbonyl)oxy)-4-methyl-1,3-thiazole-2(3h)-thione 372703 NSC648263 resistant
hsa-miR-10a-5p 3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-phenyl-3,4-dihydropyrazole-2-carbaldehyde 155810020 NSC762559 resistant
hsa-miR-10a-5p 3,3,4,4,4-pentachloro-1-phenylbutan-1-one 405828 NSC723515 sensitive
hsa-miR-10a-5p 4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 374328 NSC651852 resistant
hsa-miR-10a-5p 4-appt 5995211 NSC195327 resistant
hsa-miR-10a-5p 4-methyl-3-[4-[2-[4-(4-methyl-5-sulfanylidene-1h-1,2,4-triazol-3-yl)phenyl]iminohydrazinyl]phenyl]-1h-1,2,4-triazole-5-thione 5472009 NSC715974 resistant
hsa-miR-10a-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 resistant
hsa-miR-10a-5p 5'-chloro-2'-methoxy-3-nitrosalicylanilide 186169 NSC79459 resistant
hsa-miR-10a-5p 5,6-dimethoxy-9-(methylthio)furo[3',4':4,5]cyclopenta[1,2,3-ij]isoquinoline 363754 NSC628946 resistant
hsa-miR-10a-5p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-10a-5p 6-(chloromethyl)-2-oxo-N-pentylchromene-3-carboxamide 402500 NSC716526 sensitive
hsa-miR-10a-5p 6-methoxy-1h-pyrazolo[3,4-b]quinoxalin-3-amine 395806 NSC700694 resistant
hsa-miR-10a-5p 6,7-diacetoxyisoflavan 353129 NSC600289 resistant
hsa-miR-10a-5p 8-[(4-tert-butylphenoxy)methyl]-1,3-dimethyl-7H-purine-2,6-dione 235292 NSC36525 resistant
hsa-miR-10a-5p 8455ab 1549990 NSC24189 resistant
hsa-miR-10a-5p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 resistant
hsa-miR-10a-5p Antibiotic p 168 5477807 NSC356885 resistant
hsa-miR-10a-5p Antineoplastic-656904 376224 NSC656904 resistant
hsa-miR-10a-5p Aquatris(1,3-diphenylpropane-1,3-dionato)neodymium(iii) 24202395 NSC647040 resistant
hsa-miR-10a-5p Bas100 monohydrate 45028404 NSC742554 resistant
hsa-miR-10a-5p Berberine iodide 72350 NSC150446 resistant
hsa-miR-10a-5p Bindschedler's green 73516 NSC7811 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p C4, carbonyl, ethyl prodigiosine 135540855 NSC742416 resistant
hsa-miR-10a-5p Cgp 57380 11644425 NSC741567 sensitive
hsa-miR-10a-5p Cinerubin a hcl 5458466 NSC243022 sensitive
hsa-miR-10a-5p Cis-dichlorobis(4-methoxyphenethylamine)platinum(ii) 498558 NSC631305 resistant
hsa-miR-10a-5p Cis-difluorobis(1-phenylhexane-1,3-dionato)titanium(iv) NSC637220 resistant
hsa-miR-10a-5p Cyano-[4-[[[3-(trifluoromethyl)phenyl]methylamino]carbamoyl]pyridin-1-ium-1-yl]boron 6334922 NSC698276 resistant
hsa-miR-10a-5p Cytembena 23663958 NSC104801 resistant
hsa-miR-10a-5p Cytovaricin 5477715 NSC349622 resistant
hsa-miR-10a-5p Diethyl 2-[[4-[[[3-ethoxycarbonyl-7-(trifluoromethyl)quinoxalin-2-yl]amino]methyl]benzoyl]amino]pentanedioate 390810 NSC688812 resistant
hsa-miR-10a-5p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-10a-5p Echinomycin 3197 NSC526417 resistant
hsa-miR-10a-5p Ethyl 2-((4-(2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494007 NSC691084 resistant
hsa-miR-10a-5p Ethyl 2-((4-(6-bromo-2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494008 NSC691085 resistant
hsa-miR-10a-5p Ethyl 5-amino-4-(3,4-dihydro-2h-1,5-benzodioxepin-7-ylamino)-2-methylsulfanylthieno[2,3-d]pyrimidine-6-carboxylate 399955 NSC711107 resistant
hsa-miR-10a-5p From combretum caffrum plant 5386397 NSC609397 resistant
hsa-miR-10a-5p Kuc100204 378309 NSC660313 resistant
hsa-miR-10a-5p Lddhtajmmdseme-okkqscsosa-n 6712634 NSC702655 sensitive
hsa-miR-10a-5p Ls-77867 395636 NSC700418 resistant
hsa-miR-10a-5p Methyl (1s,10r)-6-methyl-10-nonyl-7,9,12-triazatricyclo[6.3.1.04,12]dodeca-5,8-diene-5-carboxylate 401693 NSC715423 resistant
hsa-miR-10a-5p Methyl 3-butylsulfanyl-2-[[(e)-3-(6-methyl-2,4-dioxo-1h-pyrimidin-5-yl)prop-2-enoyl]amino]propanoate 5383838 NSC201241 resistant
hsa-miR-10a-5p Mggh 5351153 NSC32946 resistant
hsa-miR-10a-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 resistant
hsa-miR-10a-5p N-[3-bromo-6-oxo-1-(4-phenylpiperidin-1-yl)-4,5-dihydrocyclopenta[c]thiophen-4-yl]-2,2,2-trifluoroacetamide 378804 NSC662123 resistant
hsa-miR-10a-5p NSC657492 NSC657492 sensitive
hsa-miR-10a-5p NSC751830 NSC751830 sensitive
hsa-miR-10a-5p Plumericin 5281545 NSC112152 resistant
hsa-miR-10a-5p Propan-2-yl (1r,9s,12e)-3,4,6-trimethoxy-11-[(4-methoxyphenyl)methyl]-5-methyl-10-oxo-12-[(2,4,5-trimethoxy-3-methylphenyl)methylidene]-11,13-diazatricyclo[7.3.1.02,7]trideca-2(7),3,5-triene-13-carbox 6330789 NSC622075 resistant
hsa-miR-10a-5p Resorufin 69462 NSC12097 resistant
hsa-miR-10a-5p Rhamnazin 5320945 NSC678106 resistant
hsa-miR-10a-5p Roridin a, 8-hydroxy-9b,10b-epoxy- 5458716 NSC327993 resistant
hsa-miR-10a-5p Sb-236687 17892742 NSC756422 sensitive
hsa-miR-10a-5p Sergeolide,desacetyl 125729 NSC364170 resistant
hsa-miR-10a-5p Sodium;4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 54612576 NSC651853 resistant
hsa-miR-10a-5p Tert-butyl n-[6-[2-[(2-amino-2-oxoethyl)carbamoyl]pyrrolidin-1-yl]-5-(9h-fluoren-9-ylmethoxycarbonylamino)-6-oxohexyl]carbamate 383818 NSC672434 sensitive
hsa-miR-10a-5p Tetra(isobutenyl)antimony bromide NSC651199 resistant
hsa-miR-10a-5p Tributylgermyl 2-acetoxy-2-phenyl-acetate 16683233 NSC645575 resistant
hsa-miR-10a-5p Verrucarin a 9,10-epoxide 5358836 NSC283445 sensitive
hsa-miR-10a-5p Z28714792 2671841 NSC746248 resistant
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-10a-5p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Esophageal Squamous Cell Carcinoma tissue and cell line (TE1, TE5, TE8, TE9, TE10, TE11, TE13)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PaCa-2)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Vinorelbine 44424639 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-10a-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-10a-5p Cytarabine 6253 NSC287459 approved sensitive Low Acute Myeloid Leukemia tissue and cell line (KG-1a, Kasumi-1, K562, OCI-AML3)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant Low Acute Myeloid Leukemia tissue and cell line (HL-60)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (HepG2, Huh-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Small Cell Lung Cancer cell line (H446)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-10a-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-10a-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (W1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (TE1, KYSE450)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3ip1, HeyA8)
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (A172)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HS578T)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-10a-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-10a-5p Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-10a-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Methotrexate 126941 NSC740 approved sensitive cell line (HT29)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-10a-5p Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission