pre-miRNA Information
pre-miRNA hsa-mir-10a   
Genomic Coordinates chr17: 48579838 - 48579947
Synonyms MIRN10A, hsa-mir-10a, miRNA10A, mir-10a, MIR10A
Description Homo sapiens miR-10a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-10a-5p
Sequence 22| UACCCUGUAGAUCCGAAUUUGUG |44
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30152819 13 COSMIC
COSN30458892 14 COSMIC
COSN23023008 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1333990950 2 dbSNP
rs770328167 3 dbSNP
rs1453440972 5 dbSNP
rs1391955925 7 dbSNP
rs1157653116 8 dbSNP
rs760091682 10 dbSNP
rs1161287321 12 dbSNP
rs369632753 13 dbSNP
rs985848773 14 dbSNP
rs772649724 18 dbSNP
rs529115879 22 dbSNP
rs375865628 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B6HZE2 miR-10a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Muscle Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol GATAD2A   
Synonyms p66alpha
Description GATA zinc finger domain containing 2A
Transcript NM_017660   
Expression
Putative miRNA Targets on GATAD2A
3'UTR of GATAD2A
(miRNA target sites are highlighted)
>GATAD2A|NM_017660|3'UTR
   1 TGCGAGCCAGGCCCCGTGGAAGACGGGCTCCCTCCTCCCCCACCTGGCCCCTGGTCTAGAAGGACCCACTGCACCACCCT
  81 CCGCTGGCTCGGGAAGACACCGTGCCCGCCCCAAGAGCAAGCACCGGCCATGCTGCAGAGGCAAGACCTCAATTCTTGGC
 161 TGCAAAGTTTCATCAGGGCTAGGGGGCTGGTGCCGCCTCATAGGCAGACGAGGATCATCGCTGGGGGACCTTTCCCGTGG
 241 GCTTTCTTCCTTTCTCTCTTTGCCTTTAGTTTGCCCGACACCAGCAGAAAAGTGGACCTTGGGGGCTGGTTCTGCTCCTG
 321 GCCCCCTTGTTCAGCCCCTGCCGGCACACGGGCGGCTCACCCTGGACACTGTGATGCGCATGGGCAAGGCCAGCGCCCGG
 401 GGCTTCTGAACCGAGCGGGGTGTTTCATTTTTTTGCTTTTCCCTGTCTTAGGCTCCCAGTCTTTGACTGCCTTCCCATGG
 481 CGATCTATAAGTTGAAAGATTTTTTTTTTTTTTAATCACCTCATGATGATGGAGTTAAAAGTAAACCGTGCAGACCCTGG
 561 GGTCCCTGTTGTACGCTGCATCATCCCGCTGGCCCTGTGCCCTGGAGGGTGGGCGGCTCATGGTGCCACAGCCCCTGGCA
 641 GGGACGGCCGGCCCGCCCCCGTGACTGACTGACAGATGCAGGGATGGCCGAGGCAGCCCTCGCTCCAGCTGAACGCCTCC
 721 ATTGCTGCTTGTTCTGGAGACCCCCGCCCCCGCACCTTCCAGACTTAGCAGAAGAACAAACTGAAGAACAGACCCAGCCA
 801 GAGAAGCAGGGATTCCAGAAGCTGCCCATTAAGGGAGAAGGAGAGGATCCGGTCGGCAGCAGCCCTGAGCAGAAAGCTGG
 881 AGGGGGGACTGTCGCGGGGTTTTTCTGTTGTGGTTTATTTTATTAAATTTTTTCCTTTTTTCTATTCATTTCGATGGACG
 961 CAATCTTAAGCCACCCTGGCCTTGCTCCTGGGAGGTGAGCGTGCACAGGTGTGTGCAGGTCAGGAGGTGCCGTCCAGGTG
1041 TGCGGCGAGCCGCTGCGCACAGATGTCAGGATTTCCGTTTGGGTCTAGTTTAGAACCTGTCCTTAAACCTAGGGGTTGCT
1121 GTCAGGATTTGCTTTCAGACTTTTTTTTTTTTTGTAATTCCCTTTAGAGTCTACAAAAATGTTTTTAAAAGGATCAGGTC
1201 TGCTTTTAGTTTCATTTTTGTTTCTTTCCCGTCCCACTCTTTAAAAACTGGTTCCGTGAGGAAAGGCAGAAGCCGTTCCG
1281 TGTCTCTTGCAGGCTGGGCCGGCTTCATGCCAGTGCGAGGGCGTCCCGTGCCCACGTACATACGTATGTCTCCATGAGTT
1361 CTGGGCTCCACTGGTTCCAATTGAGCTCCAGCCCTGGTTTTCCTACCCATGCAGTTAGGGACTTTAATTTAATTTTTTTT
1441 TTGTAGGGCCACCGCCTTCAAACACAACTGCTACAACATTCTAATAAAGGCTCATTTAACCCCCAGGCTCCTGTCGTGTG
1521 AATATCCTCAGTCTGTAGGAAACTTTTTTTGACACAGCATAGAAGACCTAGTTTTGGAAAACATTATCTAATTTTTTGTT
1601 GTGCAAATCCCCAAATTTCTCACTAATTTTTGTTTTTTTGTGCATAACTTGGATGGGCTGAAGGAGGTGAGGACAGATTG
1681 GGGAAGGGTGGCTTTCATTCCAAGATCCAGGGATTTGGGGAAAAGGAAGGAATTTGATGTTTTTTGGGGTGGGAGGGGAG
1761 GGTGTGTTTTTTACACCAAAAAAAAAAAAAAAAATCAAGAGTATGCAAGCATTTCTATTCCTCGCATTTTTCTGTGTGCC
1841 TGGCAAATAAATACCTGTCTCCTACGACCCTGAGCTGTTAGCCCTCTCTGTTCCATGACAGGGGCCAGATCTTCCAGCTC
1921 CTCCCAGAAGGAGCACCCAGGCTGGCTTCTTCCCACTGAAAGCCCTCCCCAGCGAACCAACCTCAGTTCTATGCAGTGGC
2001 TGGGGATCAGGCATCCAGACCGAAGTCACCTCTGCCTGCTCCAGCTTGGGTCAGCTGGGTCTGACCAGGGGGCCAGATCC
2081 GAGCCGCACCTGCCGGCCCCCAGCCCCAGCTCCAGCTCCTGACCTCTCCCAGCCTGGCCTGGCTGTTCCTCCAGGGCTGA
2161 TGGCTGTCAACCCATCCTTGTGAGTTCATATGGACTGCTGCCCCTCGAAAGGGAGAGGGTCGGCCCCATGTCCCCAGGGA
2241 GCATTCCATCAGGGACAACGTACATACTGTGATGTAAACTTTTTTTTTTTCCCCCCAGGGGGCAAAAGTGTGAGATGCCT
2321 TAATCTTTCCTTCATTTCTGCTGTCTCGAACACTCTAGCCCATTATTTCCTTTCAGTTCCTTGCAGCATAACCTCTACGA
2401 TAAGCCCCAAGCGGGTTGTTGTATTATGACGTTTATGATGTTCCAGGTGAAGGCATTATTAAGTACCTCTCTGGGTGTGG
2481 GGTTTGGACGCACCAGGATAGCTATTGATTAATGTTAAGGGTGTTCTACCCACAGCAAAGCACACCCTCTTAAACCAGGC
2561 ACTGCCTGGGTCCTGGTCCCGAGAGCCCTACCAGGATCAGGTTCCTGCAAGCCGTCAGAATGTGGGAGCCCCCAGCCCAA
2641 CTGATTGTAACTGTCCCCTGTTACCTGTGACATGAACCTCCAACAGCACCTGGAAACGGTTCCCTCTGTCAGCTGCTCTG
2721 TAGACAGGGCTGGGGAGATCTCAGAGTTCACACCTCGCCTGTTGTAGGGGAGGTTGGGGGTAGGGTTTGGAATGGCCAAG
2801 TGCCCTTGGAACCTCCCACAGCTATGGCCGTCCTGACCTCATCCCAGGAACTCTACGGTGACCAGGAACCACCCCTCTGA
2881 CGAGGTCTGTAGCGGCCCTTCTCAGAGTGGAACAGCCCACAGTGCTAGTTGTGCCTGGTCTTACCTGTACTCCACGGACC
2961 TCGGTGAAGCAAAAGCTTCAGGGCAGAGGGAATGAGGCAACCCAGTGGCAGCCCCGCTGGGCCCCGTGGCTCCTGCTCTC
3041 CTATTGGACGTAGAGGCAGGGGAGAGACTTCTCTATACAAATATTCTCATCACAGAAGGGATGATCCTTGCTGCTCTGCC
3121 GTAGGGTTTTTGATGCTGAGCTATGCTGCACATGACGTTAACCTAAAGAACTTGGACTGAGCTTTTAAAAAAGGACAGCA
3201 AACAATTTTATAATCCTTAAAGTGTAATAGACGGTTACACTAGTGCAGGGTATTGGGGAGGCTCTTTGGGTGTGGAGGCT
3281 GTCACTTGTATTTATTGTGACTCTAAATCTTTGATAGTAAAACAAATGTAAAAAGAAATGTTTGCCACCAGATGGGAATA
3361 GAAGTTCCAATAAGCAGGCTGGAATGGGTGGCTATACGTTGTATCACGAGGAAGTTTTAGACTCTGAAGGATAATAAATG
3441 GATGATGTGTCAACTGGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' guguuuaagccuagAUGUCCCAu 5'
                        |:|||||| 
Target 5' gacggttacactagTGCAGGGTa 3'
3230 - 3252 129.00 -14.90
2
miRNA  3' guguuuaAGCCUAG--A-UGUCCCau 5'
                 || | ||  | ||||||  
Target 5' agccctcTCTGTTCCATGACAGGGgc 3'
1880 - 1905 126.00 -9.30
3
miRNA  3' guGUUUA--AGCCUAGAUGUCCCau 5'
            ||: |  || | |  ||||||  
Target 5' gtCAGCTGCTCTG-TAGACAGGGct 3'
2708 - 2731 126.00 -10.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30468739 16 COSMIC
COSN30504443 16 COSMIC
COSN31613097 25 COSMIC
COSN20079326 62 COSMIC
COSN17437539 77 COSMIC
COSN13790417 84 COSMIC
COSN29460786 129 COSMIC
COSN31522220 239 COSMIC
COSN31533723 293 COSMIC
COSN31538615 344 COSMIC
COSN31597285 355 COSMIC
COSN9350316 391 COSMIC
COSN17338120 427 COSMIC
COSN31568079 428 COSMIC
COSN31563214 446 COSMIC
COSN31486305 495 COSMIC
COSN31563289 562 COSMIC
COSN6667480 671 COSMIC
COSN26636559 688 COSMIC
COSN30172167 690 COSMIC
COSN26548634 691 COSMIC
COSN19505475 702 COSMIC
COSN26573490 702 COSMIC
COSN26574260 703 COSMIC
COSN26465321 716 COSMIC
COSN24306871 752 COSMIC
COSN1212339 827 COSMIC
COSN31609078 846 COSMIC
COSN21968228 853 COSMIC
COSN31556635 879 COSMIC
COSN1212340 1154 COSMIC
COSN7117468 1155 COSMIC
COSN20093544 1607 COSMIC
COSN5183791 1687 COSMIC
COSN25199548 1738 COSMIC
COSN25520435 1751 COSMIC
COSN25519922 1755 COSMIC
COSN23171325 1981 COSMIC
COSN20115560 2290 COSMIC
COSN27239455 2291 COSMIC
COSN16682842 2292 COSMIC
COSN27913117 2993 COSMIC
COSN31961521 3237 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs756205923 4 dbSNP
rs765101597 5 dbSNP
rs888914498 9 dbSNP
rs1225236122 11 dbSNP
rs752614691 13 dbSNP
rs758157464 15 dbSNP
rs777659955 16 dbSNP
rs776164878 17 dbSNP
rs1178686092 18 dbSNP
rs1018949643 19 dbSNP
rs375882343 22 dbSNP
rs201411491 25 dbSNP
rs112988582 26 dbSNP
rs775862915 28 dbSNP
rs749756745 29 dbSNP
rs369930948 30 dbSNP
rs557446760 31 dbSNP
rs1213006451 32 dbSNP
rs774741534 33 dbSNP
rs1189994361 37 dbSNP
rs762164778 38 dbSNP
rs374131882 42 dbSNP
rs1409637166 45 dbSNP
rs753197744 52 dbSNP
rs971818215 52 dbSNP
rs1026375201 59 dbSNP
rs951747007 67 dbSNP
rs569229777 73 dbSNP
rs1217434042 77 dbSNP
rs1363750872 78 dbSNP
rs535010304 79 dbSNP
rs577427010 80 dbSNP
rs1362670778 82 dbSNP
rs1338113302 83 dbSNP
rs554807650 84 dbSNP
rs989295951 87 dbSNP
rs991598903 91 dbSNP
rs142824867 92 dbSNP
rs1391138312 96 dbSNP
rs1188405333 99 dbSNP
rs950108804 102 dbSNP
rs1041802991 103 dbSNP
rs948013809 105 dbSNP
rs537276171 108 dbSNP
rs903144753 109 dbSNP
rs1227466487 111 dbSNP
rs1339818554 111 dbSNP
rs1316630258 118 dbSNP
rs936025361 126 dbSNP
rs369561692 127 dbSNP
rs1444985196 131 dbSNP
rs1255942455 136 dbSNP
rs889038473 137 dbSNP
rs909934602 140 dbSNP
rs1428148322 144 dbSNP
rs1007507398 146 dbSNP
rs772837922 153 dbSNP
rs1039910926 158 dbSNP
rs774914161 159 dbSNP
rs899979700 163 dbSNP
rs1183761916 169 dbSNP
rs998466235 178 dbSNP
rs1472091178 180 dbSNP
rs60847535 182 dbSNP
rs890142241 186 dbSNP
rs999155099 195 dbSNP
rs1031178262 196 dbSNP
rs1371455117 202 dbSNP
rs1026070460 210 dbSNP
rs112211097 211 dbSNP
rs984471135 217 dbSNP
rs1309939971 218 dbSNP
rs1033787061 220 dbSNP
rs958934276 221 dbSNP
rs762660312 223 dbSNP
rs1310008332 228 dbSNP
rs1408563321 231 dbSNP
rs781741829 234 dbSNP
rs552936505 237 dbSNP
rs917392807 238 dbSNP
rs969181282 240 dbSNP
rs982007558 247 dbSNP
rs1472919865 250 dbSNP
rs538252648 251 dbSNP
rs1181337261 253 dbSNP
rs927861878 253 dbSNP
rs951391625 269 dbSNP
rs1488045448 274 dbSNP
rs1263251394 276 dbSNP
rs977444181 277 dbSNP
rs909870834 278 dbSNP
rs941476794 282 dbSNP
rs1227059626 290 dbSNP
rs1370118482 294 dbSNP
rs1302393450 295 dbSNP
rs1386506147 297 dbSNP
rs1461659084 298 dbSNP
rs924713103 299 dbSNP
rs1217882704 300 dbSNP
rs1301147703 301 dbSNP
rs936125814 304 dbSNP
rs1054444734 306 dbSNP
rs1290811515 315 dbSNP
rs1457984490 316 dbSNP
rs1387960387 320 dbSNP
rs910553969 321 dbSNP
rs1471562085 327 dbSNP
rs1379240139 335 dbSNP
rs1199503033 340 dbSNP
rs921443486 342 dbSNP
rs1265033060 343 dbSNP
rs943241144 344 dbSNP
rs1465097996 350 dbSNP
rs1040316430 354 dbSNP
rs766166213 355 dbSNP
rs1325085799 357 dbSNP
rs748588195 360 dbSNP
rs12610417 369 dbSNP
rs1221800354 370 dbSNP
rs1233197735 370 dbSNP
rs1248121071 371 dbSNP
rs1048060378 372 dbSNP
rs756711170 375 dbSNP
rs999102820 376 dbSNP
rs762491498 377 dbSNP
rs1436086263 378 dbSNP
rs542158531 379 dbSNP
rs887516858 383 dbSNP
rs1403045407 393 dbSNP
rs561994755 395 dbSNP
rs1465528551 397 dbSNP
rs1451316911 399 dbSNP
rs1170324925 400 dbSNP
rs1449679271 401 dbSNP
rs1246965816 407 dbSNP
rs893446185 411 dbSNP
rs530802069 413 dbSNP
rs544439905 414 dbSNP
rs1343576377 417 dbSNP
rs564087260 417 dbSNP
rs532644316 418 dbSNP
rs1024521301 422 dbSNP
rs868149396 428 dbSNP
rs977617082 432 dbSNP
rs924800016 434 dbSNP
rs1295633315 437 dbSNP
rs1454806307 444 dbSNP
rs777967790 448 dbSNP
rs552365171 451 dbSNP
rs1063966 460 dbSNP
rs1434754312 465 dbSNP
rs990656011 470 dbSNP
rs910513547 471 dbSNP
rs1170425691 477 dbSNP
rs1366389126 482 dbSNP
rs528500839 483 dbSNP
rs1040430361 485 dbSNP
rs923180085 486 dbSNP
rs1340787058 488 dbSNP
rs1368536929 489 dbSNP
rs1228446685 494 dbSNP
rs1440211751 499 dbSNP
rs111397533 500 dbSNP
rs1438361748 500 dbSNP
rs1482907133 500 dbSNP
rs1230213056 514 dbSNP
rs909913262 514 dbSNP
rs1449582675 515 dbSNP
rs1220542808 516 dbSNP
rs1357400106 517 dbSNP
rs1248350704 518 dbSNP
rs1283656260 519 dbSNP
rs1242622662 521 dbSNP
rs548156972 522 dbSNP
rs568462878 523 dbSNP
rs929231907 525 dbSNP
rs1410379799 527 dbSNP
rs963003645 528 dbSNP
rs975540267 530 dbSNP
rs1406726943 533 dbSNP
rs1047544216 548 dbSNP
rs887620807 554 dbSNP
rs987003732 557 dbSNP
rs924772740 558 dbSNP
rs934953713 573 dbSNP
rs1005946697 575 dbSNP
rs767362888 576 dbSNP
rs1416208907 577 dbSNP
rs894781625 583 dbSNP
rs537337214 588 dbSNP
rs190813063 589 dbSNP
rs1331260874 595 dbSNP
rs946352005 597 dbSNP
rs1437757285 600 dbSNP
rs1349866978 603 dbSNP
rs1044795127 604 dbSNP
rs904985278 615 dbSNP
rs1013198987 620 dbSNP
rs1438267277 624 dbSNP
rs1024637638 632 dbSNP
rs1003244553 633 dbSNP
rs1034839441 634 dbSNP
rs868225763 636 dbSNP
rs1004144583 639 dbSNP
rs999544836 640 dbSNP
rs752765790 643 dbSNP
rs570909071 646 dbSNP
rs957773561 647 dbSNP
rs1017238792 650 dbSNP
rs962743002 651 dbSNP
rs990215153 653 dbSNP
rs1478536037 655 dbSNP
rs376625442 656 dbSNP
rs1196995068 657 dbSNP
rs1220918049 662 dbSNP
rs145055663 665 dbSNP
rs1268844793 670 dbSNP
rs1054284 671 dbSNP
rs1330919679 674 dbSNP
rs1220896124 678 dbSNP
rs183011067 680 dbSNP
rs1274072427 685 dbSNP
rs541874535 690 dbSNP
rs1438261712 691 dbSNP
rs955483036 698 dbSNP
rs1320821731 699 dbSNP
rs1342954528 702 dbSNP
rs1433620344 702 dbSNP
rs929210364 703 dbSNP
rs762250426 707 dbSNP
rs1247334594 709 dbSNP
rs1442990652 715 dbSNP
rs1424860716 716 dbSNP
rs986865594 718 dbSNP
rs555398188 720 dbSNP
rs909007787 722 dbSNP
rs941867591 723 dbSNP
rs1055002380 726 dbSNP
rs1463561554 728 dbSNP
rs34667451 735 dbSNP
rs775052146 737 dbSNP
rs1413042407 739 dbSNP
rs544132293 744 dbSNP
rs1277642856 746 dbSNP
rs902203339 747 dbSNP
rs1044748764 750 dbSNP
rs187349662 751 dbSNP
rs1032345557 752 dbSNP
rs893420920 753 dbSNP
rs1336723883 764 dbSNP
rs1304117384 765 dbSNP
rs1012155458 768 dbSNP
rs1017809147 772 dbSNP
rs879069076 775 dbSNP
rs1311597148 778 dbSNP
rs1431973753 781 dbSNP
rs867340610 789 dbSNP
rs577730728 799 dbSNP
rs1056111646 810 dbSNP
rs376115183 812 dbSNP
rs976177637 817 dbSNP
rs1416050498 829 dbSNP
rs1182584598 831 dbSNP
rs1482977076 836 dbSNP
rs1236757131 838 dbSNP
rs559451468 839 dbSNP
rs1352019193 841 dbSNP
rs1226330234 848 dbSNP
rs760501719 851 dbSNP
rs2033481 852 dbSNP
rs950779233 855 dbSNP
rs983355030 856 dbSNP
rs1028353862 868 dbSNP
rs1377850054 870 dbSNP
rs1291923881 871 dbSNP
rs1276448115 882 dbSNP
rs1466869984 882 dbSNP
rs909115165 884 dbSNP
rs1440751857 888 dbSNP
rs1187365118 894 dbSNP
rs779286069 895 dbSNP
rs75467485 896 dbSNP
rs990596193 897 dbSNP
rs1031738245 899 dbSNP
rs1363518272 900 dbSNP
rs1415795552 906 dbSNP
rs372835426 918 dbSNP
rs956236160 922 dbSNP
rs1473554199 923 dbSNP
rs1478573539 928 dbSNP
rs990690356 929 dbSNP
rs1174806337 930 dbSNP
rs914743270 935 dbSNP
rs916445965 936 dbSNP
rs1266804947 942 dbSNP
rs534776232 943 dbSNP
rs949113291 953 dbSNP
rs1046131934 954 dbSNP
rs902140350 957 dbSNP
rs934981771 960 dbSNP
rs561704585 961 dbSNP
rs1288290373 965 dbSNP
rs776241812 966 dbSNP
rs1252798862 973 dbSNP
rs1389966494 976 dbSNP
rs1370215625 980 dbSNP
rs893359493 987 dbSNP
rs1011858850 988 dbSNP
rs1056143463 995 dbSNP
rs1235210974 996 dbSNP
rs1017756885 997 dbSNP
rs1458736880 998 dbSNP
rs1347150453 1001 dbSNP
rs900690645 1002 dbSNP
rs1181006505 1004 dbSNP
rs939775826 1010 dbSNP
rs1484079891 1017 dbSNP
rs191882327 1020 dbSNP
rs1467807217 1027 dbSNP
rs1030429298 1032 dbSNP
rs1209997847 1033 dbSNP
rs1434091927 1034 dbSNP
rs550961382 1041 dbSNP
rs866317837 1044 dbSNP
rs183032082 1045 dbSNP
rs1016292472 1048 dbSNP
rs1376415162 1049 dbSNP
rs963614052 1052 dbSNP
rs539679649 1053 dbSNP
rs1435819886 1054 dbSNP
rs772559647 1057 dbSNP
rs916393689 1058 dbSNP
rs547193578 1062 dbSNP
rs970540616 1066 dbSNP
rs981943401 1071 dbSNP
rs923681315 1078 dbSNP
rs1451595310 1084 dbSNP
rs891150678 1085 dbSNP
rs935118296 1089 dbSNP
rs1453594027 1101 dbSNP
rs1053848861 1103 dbSNP
rs3194807 1104 dbSNP
rs1250685971 1109 dbSNP
rs1008194044 1111 dbSNP
rs1031764539 1136 dbSNP
rs11434961 1141 dbSNP
rs1232916534 1141 dbSNP
rs1484563073 1141 dbSNP
rs1491031471 1141 dbSNP
rs750042781 1141 dbSNP
rs750053834 1143 dbSNP
rs1297232873 1144 dbSNP
rs1229476812 1147 dbSNP
rs1316400256 1154 dbSNP
rs188117458 1154 dbSNP
rs980129237 1155 dbSNP
rs1388295731 1156 dbSNP
rs1321411494 1157 dbSNP
rs1369996902 1161 dbSNP
rs1228967705 1162 dbSNP
rs1299772610 1163 dbSNP
rs1344379587 1166 dbSNP
rs1404195721 1171 dbSNP
rs571422245 1175 dbSNP
rs1433829347 1182 dbSNP
rs1022239742 1187 dbSNP
rs1170068135 1193 dbSNP
rs970221963 1194 dbSNP
rs1371993062 1195 dbSNP
rs535532681 1216 dbSNP
rs947594951 1225 dbSNP
rs1039306248 1226 dbSNP
rs980339730 1229 dbSNP
rs1443653777 1231 dbSNP
rs1257394251 1232 dbSNP
rs1210835581 1237 dbSNP
rs192403109 1238 dbSNP
rs1277264685 1240 dbSNP
rs1206134660 1241 dbSNP
rs1251449176 1251 dbSNP
rs376229578 1251 dbSNP
rs780434922 1256 dbSNP
rs146312755 1257 dbSNP
rs747571767 1261 dbSNP
rs997677509 1270 dbSNP
rs1250499283 1273 dbSNP
rs769288146 1275 dbSNP
rs8101565 1276 dbSNP
rs1004998903 1279 dbSNP
rs1016651136 1280 dbSNP
rs1309696546 1281 dbSNP
rs1429988464 1285 dbSNP
rs1395250574 1289 dbSNP
rs1459071066 1299 dbSNP
rs963431547 1301 dbSNP
rs8101573 1302 dbSNP
rs550163768 1304 dbSNP
rs939792294 1314 dbSNP
rs970656718 1324 dbSNP
rs1183270195 1325 dbSNP
rs1437613054 1326 dbSNP
rs866534989 1328 dbSNP
rs919768442 1329 dbSNP
rs981891098 1333 dbSNP
rs923824488 1336 dbSNP
rs1357123090 1337 dbSNP
rs932450537 1340 dbSNP
rs956629442 1341 dbSNP
rs1049677295 1343 dbSNP
rs557801627 1344 dbSNP
rs1334983160 1345 dbSNP
rs1322425179 1348 dbSNP
rs577849217 1354 dbSNP
rs1390819598 1355 dbSNP
rs914851850 1367 dbSNP
rs540104922 1369 dbSNP
rs377481857 1372 dbSNP
rs67115486 1372 dbSNP
rs6626 1373 dbSNP
rs1054308 1374 dbSNP
rs541871730 1381 dbSNP
rs1012086956 1382 dbSNP
rs371264892 1388 dbSNP
rs1201245196 1392 dbSNP
rs1452478918 1402 dbSNP
rs1252439408 1404 dbSNP
rs1211837275 1407 dbSNP
rs1331329136 1413 dbSNP
rs1334585531 1420 dbSNP
rs1349655566 1423 dbSNP
rs200936988 1423 dbSNP
rs1270574900 1426 dbSNP
rs1438151464 1426 dbSNP
rs770523579 1429 dbSNP
rs147560270 1432 dbSNP
rs1001622935 1433 dbSNP
rs933585510 1433 dbSNP
rs970201832 1433 dbSNP
rs8102361 1434 dbSNP
rs1485213467 1439 dbSNP
rs1186462059 1444 dbSNP
rs1035810435 1453 dbSNP
rs1256163549 1455 dbSNP
rs1425071722 1469 dbSNP
rs1174741590 1472 dbSNP
rs546446593 1485 dbSNP
rs1394636004 1486 dbSNP
rs1185284129 1492 dbSNP
rs1052352288 1494 dbSNP
rs886615890 1496 dbSNP
rs960316700 1501 dbSNP
rs184374956 1502 dbSNP
rs1037806071 1505 dbSNP
rs34424225 1506 dbSNP
rs1248777482 1509 dbSNP
rs983705139 1510 dbSNP
rs1386197812 1511 dbSNP
rs566635426 1514 dbSNP
rs774129960 1516 dbSNP
rs1015706996 1517 dbSNP
rs1302173242 1526 dbSNP
rs1231680981 1527 dbSNP
rs961044549 1529 dbSNP
rs1012186959 1531 dbSNP
rs1023632626 1536 dbSNP
rs970612587 1538 dbSNP
rs1343893238 1554 dbSNP
rs8101898 1558 dbSNP
rs1397907798 1562 dbSNP
rs371810894 1564 dbSNP
rs557336742 1564 dbSNP
rs1355142649 1566 dbSNP
rs1394881140 1568 dbSNP
rs1229382895 1569 dbSNP
rs1451604745 1583 dbSNP
rs1185944734 1585 dbSNP
rs1390851172 1585 dbSNP
rs1003424535 1586 dbSNP
rs932481767 1594 dbSNP
rs1270353377 1607 dbSNP
rs985324954 1622 dbSNP
rs1460097831 1624 dbSNP
rs1208278960 1626 dbSNP
rs558631267 1633 dbSNP
rs1295870211 1636 dbSNP
rs1213411627 1642 dbSNP
rs1031214062 1643 dbSNP
rs1359295112 1655 dbSNP
rs1286421431 1667 dbSNP
rs1415991876 1672 dbSNP
rs943964332 1673 dbSNP
rs1311503802 1675 dbSNP
rs190516978 1688 dbSNP
rs1355265876 1693 dbSNP
rs1483934765 1700 dbSNP
rs891808836 1701 dbSNP
rs1408226711 1705 dbSNP
rs1416110673 1717 dbSNP
rs1208187096 1720 dbSNP
rs1183491162 1721 dbSNP
rs1475530748 1721 dbSNP
rs1256528873 1724 dbSNP
rs1256351123 1729 dbSNP
rs1185464342 1731 dbSNP
rs1483917868 1732 dbSNP
rs1251489972 1738 dbSNP
rs1203405368 1740 dbSNP
rs77004382 1746 dbSNP
rs989714909 1751 dbSNP
rs71338326 1755 dbSNP
rs913766686 1755 dbSNP
rs1355317793 1756 dbSNP
rs945272143 1760 dbSNP
rs1412017711 1762 dbSNP
rs1374534343 1763 dbSNP
rs557909310 1765 dbSNP
rs1440340222 1767 dbSNP
rs1351678489 1769 dbSNP
rs71339282 1773 dbSNP
rs550934096 1776 dbSNP
rs1416996133 1777 dbSNP
rs188740326 1777 dbSNP
rs1043540971 1778 dbSNP
rs1230821933 1778 dbSNP
rs1242434417 1778 dbSNP
rs1306816252 1778 dbSNP
rs1369933801 1778 dbSNP
rs1395013667 1778 dbSNP
rs35542121 1778 dbSNP
rs56401562 1778 dbSNP
rs79539432 1778 dbSNP
rs878992857 1778 dbSNP
rs1360863155 1781 dbSNP
rs1001569046 1791 dbSNP
rs1323784823 1791 dbSNP
rs905989460 1791 dbSNP
rs1455320776 1792 dbSNP
rs1035841640 1793 dbSNP
rs1158179583 1794 dbSNP
rs1374945039 1795 dbSNP
rs1417086318 1795 dbSNP
rs989606927 1796 dbSNP
rs1467619360 1797 dbSNP
rs895977885 1797 dbSNP
rs1290478161 1799 dbSNP
rs1486510302 1800 dbSNP
rs1022031739 1802 dbSNP
rs1237255677 1804 dbSNP
rs1314342433 1810 dbSNP
rs963811334 1816 dbSNP
rs138632805 1824 dbSNP
rs192487126 1825 dbSNP
rs1302581687 1830 dbSNP
rs1015155134 1832 dbSNP
rs1299999230 1833 dbSNP
rs1314523754 1837 dbSNP
rs1385495967 1845 dbSNP
rs961338107 1845 dbSNP
rs536272590 1848 dbSNP
rs1377094913 1857 dbSNP
rs922295740 1862 dbSNP
rs1483112806 1863 dbSNP
rs767403611 1866 dbSNP
rs933524041 1867 dbSNP
rs1206791880 1870 dbSNP
rs953815685 1870 dbSNP
rs987741922 1871 dbSNP
rs908009955 1875 dbSNP
rs943862545 1878 dbSNP
rs940858728 1880 dbSNP
rs1281545767 1884 dbSNP
rs1230868437 1887 dbSNP
rs1346063014 1890 dbSNP
rs775567459 1900 dbSNP
rs989136758 1900 dbSNP
rs1325953696 1904 dbSNP
rs547254872 1906 dbSNP
rs1380497240 1910 dbSNP
rs1357126729 1912 dbSNP
rs1313319157 1918 dbSNP
rs1427167827 1924 dbSNP
rs1452441416 1927 dbSNP
rs55965542 1928 dbSNP
rs567028159 1931 dbSNP
rs1169320428 1934 dbSNP
rs1462011695 1938 dbSNP
rs1372051547 1943 dbSNP
rs947281421 1952 dbSNP
rs948175575 1952 dbSNP
rs1258638672 1954 dbSNP
rs1484912971 1959 dbSNP
rs1275318789 1965 dbSNP
rs535568138 1970 dbSNP
rs1196649682 1974 dbSNP
rs149330179 1975 dbSNP
rs1430510482 1979 dbSNP
rs905853468 1981 dbSNP
rs1293832412 1986 dbSNP
rs1413902506 1992 dbSNP
rs906547942 1993 dbSNP
rs1054313 1994 dbSNP
rs144529902 1995 dbSNP
rs1030930949 2001 dbSNP
rs377114973 2007 dbSNP
rs1321360519 2008 dbSNP
rs10411169 2012 dbSNP
rs1010720845 2026 dbSNP
rs1005015116 2029 dbSNP
rs1164859532 2031 dbSNP
rs1015600459 2032 dbSNP
rs1022176355 2040 dbSNP
rs1370186510 2055 dbSNP
rs963779684 2068 dbSNP
rs899449430 2071 dbSNP
rs995496221 2072 dbSNP
rs577067535 2074 dbSNP
rs1335579363 2076 dbSNP
rs1273688327 2081 dbSNP
rs1353959827 2082 dbSNP
rs1303336966 2086 dbSNP
rs975166170 2087 dbSNP
rs953663773 2088 dbSNP
rs1328879477 2091 dbSNP
rs1029291414 2095 dbSNP
rs1006661623 2096 dbSNP
rs1460397997 2098 dbSNP
rs199581833 2098 dbSNP
rs1342218612 2099 dbSNP
rs1230024165 2100 dbSNP
rs1159446264 2102 dbSNP
rs1362233445 2103 dbSNP
rs1195761218 2106 dbSNP
rs1468950644 2111 dbSNP
rs537471487 2112 dbSNP
rs148458424 2116 dbSNP
rs1449853246 2117 dbSNP
rs1286276856 2120 dbSNP
rs1306621938 2124 dbSNP
rs753995586 2125 dbSNP
rs908103772 2135 dbSNP
rs577902914 2140 dbSNP
rs913051642 2144 dbSNP
rs940981802 2146 dbSNP
rs1302131429 2148 dbSNP
rs1433688698 2149 dbSNP
rs184716902 2150 dbSNP
rs1400439928 2152 dbSNP
rs978634411 2153 dbSNP
rs1175728534 2156 dbSNP
rs927312642 2158 dbSNP
rs920773417 2160 dbSNP
rs948100904 2169 dbSNP
rs1450133517 2171 dbSNP
rs937322018 2179 dbSNP
rs1057150174 2186 dbSNP
rs1169784079 2189 dbSNP
rs1417476324 2190 dbSNP
rs1045145183 2192 dbSNP
rs1446180015 2194 dbSNP
rs1283703073 2203 dbSNP
rs553552396 2207 dbSNP
rs573472067 2208 dbSNP
rs541932920 2209 dbSNP
rs939354146 2222 dbSNP
rs555611349 2223 dbSNP
rs1439219693 2227 dbSNP
rs1052888542 2229 dbSNP
rs1036573579 2233 dbSNP
rs1435744037 2235 dbSNP
rs1375005989 2240 dbSNP
rs899311074 2247 dbSNP
rs750737868 2248 dbSNP
rs1187032031 2250 dbSNP
rs1260953401 2252 dbSNP
rs1475076522 2252 dbSNP
rs1189716774 2257 dbSNP
rs1011273724 2260 dbSNP
rs1050642725 2261 dbSNP
rs1360670588 2262 dbSNP
rs1228499322 2274 dbSNP
rs575671242 2278 dbSNP
rs1308719400 2279 dbSNP
rs1006527323 2280 dbSNP
rs1355251522 2280 dbSNP
rs1415740760 2280 dbSNP
rs544729736 2280 dbSNP
rs55702467 2280 dbSNP
rs572902388 2280 dbSNP
rs796962323 2280 dbSNP
rs878868548 2280 dbSNP
rs1022101469 2283 dbSNP
rs1355173237 2284 dbSNP
rs899668659 2285 dbSNP
rs1421337469 2287 dbSNP
rs1019281138 2288 dbSNP
rs996572990 2289 dbSNP
rs185194735 2290 dbSNP
rs755977878 2290 dbSNP
rs1491399100 2291 dbSNP
rs188557016 2291 dbSNP
rs1268687342 2292 dbSNP
rs1029428912 2294 dbSNP
rs1275545544 2296 dbSNP
rs955325595 2297 dbSNP
rs1334604561 2299 dbSNP
rs1311099199 2303 dbSNP
rs558616764 2304 dbSNP
rs1374240789 2305 dbSNP
rs1297847010 2308 dbSNP
rs1240390359 2310 dbSNP
rs1003882581 2311 dbSNP
rs1015711764 2313 dbSNP
rs962287554 2315 dbSNP
rs1327800294 2316 dbSNP
rs1461961323 2320 dbSNP
rs1367667147 2322 dbSNP
rs958709356 2322 dbSNP
rs564495884 2335 dbSNP
rs189090856 2339 dbSNP
rs1177651573 2346 dbSNP
rs145084629 2348 dbSNP
rs940811166 2348 dbSNP
rs569178600 2349 dbSNP
rs1036842822 2350 dbSNP
rs1264209739 2351 dbSNP
rs1218331910 2352 dbSNP
rs1317917784 2356 dbSNP
rs1460199030 2362 dbSNP
rs147166404 2363 dbSNP
rs1238294548 2370 dbSNP
rs1389862422 2371 dbSNP
rs980934957 2375 dbSNP
rs930758869 2376 dbSNP
rs928033781 2383 dbSNP
rs113279996 2384 dbSNP
rs1052438676 2390 dbSNP
rs112624389 2393 dbSNP
rs1009148012 2394 dbSNP
rs1040754921 2395 dbSNP
rs1325306268 2399 dbSNP
rs1396519978 2400 dbSNP
rs1193639074 2406 dbSNP
rs780533863 2411 dbSNP
rs747483466 2413 dbSNP
rs755527603 2414 dbSNP
rs1486378381 2416 dbSNP
rs549576557 2418 dbSNP
rs1020432785 2419 dbSNP
rs996666578 2428 dbSNP
rs144176312 2431 dbSNP
rs890874077 2432 dbSNP
rs1233613449 2437 dbSNP
rs757618870 2441 dbSNP
rs1232313954 2443 dbSNP
rs1288672998 2444 dbSNP
rs1004379024 2445 dbSNP
rs1362380965 2448 dbSNP
rs1034139209 2452 dbSNP
rs1203259167 2455 dbSNP
rs1283530903 2456 dbSNP
rs1376854192 2463 dbSNP
rs1015222243 2465 dbSNP
rs962712059 2467 dbSNP
rs1375464418 2468 dbSNP
rs995022888 2474 dbSNP
rs1027850814 2475 dbSNP
rs969635741 2476 dbSNP
rs748803930 2478 dbSNP
rs1191875178 2481 dbSNP
rs1486878525 2486 dbSNP
rs1474317619 2489 dbSNP
rs1200144106 2490 dbSNP
rs371029124 2490 dbSNP
rs972175894 2491 dbSNP
rs928155736 2494 dbSNP
rs11879240 2497 dbSNP
rs778476704 2499 dbSNP
rs1307934865 2502 dbSNP
rs1413116023 2505 dbSNP
rs151148187 2506 dbSNP
rs770560906 2511 dbSNP
rs571177541 2514 dbSNP
rs960787324 2516 dbSNP
rs1357183296 2520 dbSNP
rs1157317503 2521 dbSNP
rs1384924984 2524 dbSNP
rs773862652 2527 dbSNP
rs988633057 2528 dbSNP
rs533855074 2532 dbSNP
rs946718814 2533 dbSNP
rs1314237855 2538 dbSNP
rs753558986 2541 dbSNP
rs1413742598 2545 dbSNP
rs1308283252 2547 dbSNP
rs1337285183 2548 dbSNP
rs1423491184 2557 dbSNP
rs952992268 2558 dbSNP
rs1476378567 2560 dbSNP
rs1419083789 2563 dbSNP
rs1040996778 2565 dbSNP
rs945665950 2574 dbSNP
rs553613840 2581 dbSNP
rs181470014 2582 dbSNP
rs1257320970 2586 dbSNP
rs1216763925 2590 dbSNP
rs921182104 2594 dbSNP
rs536067145 2595 dbSNP
rs1282484353 2599 dbSNP
rs1484751710 2605 dbSNP
rs186407036 2614 dbSNP
rs999900570 2615 dbSNP
rs1391415972 2617 dbSNP
rs1398984964 2635 dbSNP
rs890958294 2639 dbSNP
rs1463541165 2641 dbSNP
rs1439887441 2646 dbSNP
rs374458990 2658 dbSNP
rs894300633 2658 dbSNP
rs544652355 2661 dbSNP
rs771755909 2663 dbSNP
rs1037202123 2665 dbSNP
rs1014139980 2666 dbSNP
rs898273345 2674 dbSNP
rs995116188 2677 dbSNP
rs1236503302 2679 dbSNP
rs140585298 2691 dbSNP
rs367659346 2695 dbSNP
rs1002418091 2698 dbSNP
rs962076448 2699 dbSNP
rs972507681 2703 dbSNP
rs1433614251 2704 dbSNP
rs1027652349 2708 dbSNP
rs1308223255 2709 dbSNP
rs150063568 2717 dbSNP
rs775479178 2719 dbSNP
rs560796741 2741 dbSNP
rs1491399678 2742 dbSNP
rs1491294115 2743 dbSNP
rs1331480196 2748 dbSNP
rs878936505 2751 dbSNP
rs1442964617 2752 dbSNP
rs988213066 2754 dbSNP
rs1021442033 2755 dbSNP
rs968146678 2757 dbSNP
rs1387646486 2762 dbSNP
rs1159362184 2771 dbSNP
rs1419390115 2775 dbSNP
rs1378711411 2776 dbSNP
rs979421453 2778 dbSNP
rs760642630 2786 dbSNP
rs1454789657 2791 dbSNP
rs921276875 2796 dbSNP
rs1198138650 2803 dbSNP
rs932519054 2806 dbSNP
rs1345793835 2813 dbSNP
rs976366405 2814 dbSNP
rs1352456310 2818 dbSNP
rs1283476037 2827 dbSNP
rs529610006 2829 dbSNP
rs1235786560 2830 dbSNP
rs1233713109 2831 dbSNP
rs1274741005 2835 dbSNP
rs914108064 2838 dbSNP
rs1252107232 2841 dbSNP
rs987143434 2845 dbSNP
rs189744272 2851 dbSNP
rs945643945 2852 dbSNP
rs912369805 2854 dbSNP
rs1041814757 2855 dbSNP
rs1358816127 2855 dbSNP
rs1435395103 2856 dbSNP
rs563060169 2857 dbSNP
rs1477035597 2858 dbSNP
rs1469205978 2872 dbSNP
rs1055442376 2876 dbSNP
rs932317867 2881 dbSNP
rs576515856 2882 dbSNP
rs1312259637 2889 dbSNP
rs1277371533 2894 dbSNP
rs553226038 2895 dbSNP
rs1279423843 2897 dbSNP
rs1218353583 2901 dbSNP
rs1338970987 2907 dbSNP
rs897776153 2908 dbSNP
rs1449121536 2910 dbSNP
rs931097329 2911 dbSNP
rs371558046 2920 dbSNP
rs1028096773 2922 dbSNP
rs1007664571 2923 dbSNP
rs1171355728 2928 dbSNP
rs1166999006 2930 dbSNP
rs1477352870 2945 dbSNP
rs905538202 2946 dbSNP
rs370802123 2948 dbSNP
rs776782598 2951 dbSNP
rs531311719 2953 dbSNP
rs551425902 2954 dbSNP
rs1483339466 2955 dbSNP
rs573377133 2956 dbSNP
rs1207364168 2957 dbSNP
rs1439068509 2961 dbSNP
rs1010129393 2963 dbSNP
rs976692819 2972 dbSNP
rs1316443470 2974 dbSNP
rs914073649 2976 dbSNP
rs1323778245 2995 dbSNP
rs761807751 2999 dbSNP
rs1229268006 3003 dbSNP
rs1378637035 3012 dbSNP
rs967388194 3013 dbSNP
rs571168639 3014 dbSNP
rs527319927 3016 dbSNP
rs979516239 3017 dbSNP
rs1187578208 3022 dbSNP
rs1028306652 3023 dbSNP
rs954041482 3026 dbSNP
rs925635464 3027 dbSNP
rs935646160 3030 dbSNP
rs10282 3035 dbSNP
rs912450968 3036 dbSNP
rs1179807705 3044 dbSNP
rs1238329299 3045 dbSNP
rs1198560172 3050 dbSNP
rs1225454529 3051 dbSNP
rs180993509 3058 dbSNP
rs1321542787 3059 dbSNP
rs939992988 3060 dbSNP
rs1225750303 3063 dbSNP
rs888200209 3064 dbSNP
rs1335869719 3069 dbSNP
rs1444661428 3071 dbSNP
rs1374518594 3081 dbSNP
rs972969737 3087 dbSNP
rs1216011063 3092 dbSNP
rs1458201027 3093 dbSNP
rs919767595 3094 dbSNP
rs1162253763 3097 dbSNP
rs1421203308 3103 dbSNP
rs1380546007 3109 dbSNP
rs1177403557 3111 dbSNP
rs1437316188 3114 dbSNP
rs931023635 3115 dbSNP
rs1044142021 3121 dbSNP
rs141347590 3122 dbSNP
rs1488355493 3126 dbSNP
rs938335212 3127 dbSNP
rs1056820519 3144 dbSNP
rs1354600327 3146 dbSNP
rs539382287 3153 dbSNP
rs1009831987 3157 dbSNP
rs758686552 3175 dbSNP
rs1192001509 3178 dbSNP
rs1350209747 3187 dbSNP
rs1303280029 3188 dbSNP
rs1387349439 3195 dbSNP
rs1042913995 3211 dbSNP
rs1291520290 3218 dbSNP
rs1476062732 3220 dbSNP
rs887779121 3223 dbSNP
rs1393475150 3225 dbSNP
rs755514593 3229 dbSNP
rs1457643647 3231 dbSNP
rs575541677 3233 dbSNP
rs1417282243 3234 dbSNP
rs904041814 3235 dbSNP
rs1177401414 3242 dbSNP
rs1433050914 3250 dbSNP
rs1265887317 3251 dbSNP
rs1387204198 3255 dbSNP
rs1488833422 3257 dbSNP
rs1262715693 3258 dbSNP
rs6909 3260 dbSNP
rs1295122311 3261 dbSNP
rs1256725559 3262 dbSNP
rs1356397762 3268 dbSNP
rs1311471072 3279 dbSNP
rs1235381523 3283 dbSNP
rs1220189700 3284 dbSNP
rs1291743349 3286 dbSNP
rs1340952685 3286 dbSNP
rs1334643854 3287 dbSNP
rs1028399809 3291 dbSNP
rs1397811740 3295 dbSNP
rs1403917713 3301 dbSNP
rs954134567 3303 dbSNP
rs1008642074 3304 dbSNP
rs1465135642 3306 dbSNP
rs1017611317 3308 dbSNP
rs1019646183 3309 dbSNP
rs778395449 3310 dbSNP
rs961555265 3310 dbSNP
rs1263070784 3316 dbSNP
rs972678752 3316 dbSNP
rs1191763729 3324 dbSNP
rs577856642 3324 dbSNP
rs919736265 3328 dbSNP
rs997594452 3332 dbSNP
rs537970984 3333 dbSNP
rs1482332169 3335 dbSNP
rs558266130 3337 dbSNP
rs1005595119 3348 dbSNP
rs979932903 3349 dbSNP
rs1216567960 3350 dbSNP
rs1341851074 3350 dbSNP
rs927025758 3351 dbSNP
rs1313015812 3356 dbSNP
rs1257765943 3359 dbSNP
rs751942209 3362 dbSNP
rs1333948996 3370 dbSNP
rs1466658027 3373 dbSNP
rs1185354239 3376 dbSNP
rs578129129 3386 dbSNP
rs1416848788 3390 dbSNP
rs563758558 3398 dbSNP
rs534232534 3399 dbSNP
rs1362058685 3402 dbSNP
rs554201605 3404 dbSNP
rs574398266 3406 dbSNP
rs1458104007 3408 dbSNP
rs915559339 3408 dbSNP
rs781675565 3409 dbSNP
rs1042677162 3414 dbSNP
rs745580172 3422 dbSNP
rs904134702 3433 dbSNP
rs1311318476 3438 dbSNP
rs1355203571 3444 dbSNP
rs1001017604 3452 dbSNP
rs1310741041 3459 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors -0.343 2.8e-3 -0.171 8.8e-2 64 Click to see details
GSE42095 Differentiated embryonic stem cells -0.511 6.4e-3 -0.670 2.3e-4 23 Click to see details
GSE19783 ER- ER- breast cancer -0.235 1.9e-2 -0.186 5.0e-2 79 Click to see details
GSE17498 Multiple myeloma 0.322 2.1e-2 0.140 1.9e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.452 2.3e-2 -0.768 3.8e-5 20 Click to see details
GSE21032 Prostate cancer -0.209 2.9e-2 -0.290 3.9e-3 83 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.336 5.0e-2 0.405 2.2e-2 25 Click to see details
GSE14794 Lymphoblastoid cells -0.163 6.2e-2 -0.160 6.6e-2 90 Click to see details
GSE19536 Breast cancer -0.15 6.8e-2 -0.141 8.1e-2 100 Click to see details
GSE28544 Breast cancer 0.296 8.0e-2 0.192 1.8e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.415 9.0e-2 -0.294 1.8e-1 12 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.321 2.2e-1 -0.143 3.7e-1 8 Click to see details
GSE38226 Liver fibrosis -0.147 2.6e-1 -0.070 3.8e-1 21 Click to see details
GSE26953 Aortic valvular endothelial cells -0.132 2.7e-1 -0.075 3.6e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.101 2.9e-1 0.073 3.5e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.113 3.6e-1 -0.066 4.2e-1 13 Click to see details
GSE27834 Pluripotent stem cells 0.069 4.0e-1 0.053 4.2e-1 16 Click to see details
GSE17306 Multiple myeloma -0.029 4.2e-1 0.069 3.2e-1 49 Click to see details
GSE21849 B cell lymphoma 0.03 4.4e-1 -0.014 4.7e-1 29 Click to see details
GSE19783 ER+ ER+ breast cancer 0.028 4.5e-1 -0.146 2.7e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.018 4.7e-1 0.090 3.3e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD 0.445 0 0.305 0.02 50 Click to see details
KIRP -0.352 0.02 -0.255 0.08 32 Click to see details
KIRC -0.224 0.03 -0.235 0.03 68 Click to see details
CESC -0.985 0.06 -1.000 0.5 3 Click to see details
LIHC 0.218 0.07 0.233 0.05 49 Click to see details
BLCA 0.368 0.07 0.488 0.02 18 Click to see details
STAD -0.263 0.07 -0.299 0.05 32 Click to see details
HNSC -0.183 0.12 -0.183 0.12 42 Click to see details
THCA -0.149 0.13 -0.138 0.15 59 Click to see details
LUAD -0.331 0.15 -0.559 0.03 12 Click to see details
PAAD 0.603 0.2 0.800 0.1 4 Click to see details
COAD -0.336 0.21 -0.429 0.14 8 Click to see details
UCEC 0.177 0.23 0.091 0.36 19 Click to see details
BRCA -0.078 0.24 -0.180 0.05 84 Click to see details
LUSC 0.11 0.26 0.096 0.28 38 Click to see details
ESCA -0.131 0.35 -0.055 0.44 11 Click to see details
PCPG -0.255 0.42 -0.500 0.33 3 Click to see details
CHOL 0.048 0.45 0.017 0.48 9 Click to see details
KICH 0.016 0.47 -0.045 0.42 25 Click to see details
KICH 0.016 0.47 -0.045 0.42 25 Click to see details
KICH 0.016 0.47 -0.045 0.42 25 Click to see details
449 hsa-miR-10a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001140 HOXA1 homeobox A1 4 3
MIRT003896 USF2 upstream transcription factor 2, c-fos interacting 4 1
MIRT005454 NCOR2 nuclear receptor corepressor 2 3 1
MIRT005509 MAP3K7 mitogen-activated protein kinase kinase kinase 7 5 1
MIRT005510 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 7 2
MIRT006536 SRSF1 serine and arginine rich splicing factor 1 1 1
MIRT006537 TRA2B transformer 2 beta homolog 3 3
MIRT006972 EPHA4 EPH receptor A4 4 2
MIRT007021 CHL1 cell adhesion molecule L1 like 1 1
MIRT025588 GPR63 G protein-coupled receptor 63 1 1
MIRT025589 BCL2L13 BCL2 like 13 1 1
MIRT025590 CREB5 cAMP responsive element binding protein 5 1 1
MIRT025591 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT025592 OMA1 OMA1 zinc metallopeptidase 1 1
MIRT025593 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT025594 RBM17 RNA binding motif protein 17 1 1
MIRT025595 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT025596 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT025597 SNX4 sorting nexin 4 2 4
MIRT025598 SERBP1 SERPINE1 mRNA binding protein 1 1 2
MIRT025599 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT025600 NOP16 NOP16 nucleolar protein 1 1
MIRT025601 AJUBA ajuba LIM protein 1 1
MIRT025602 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT025603 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT025604 TMEM101 transmembrane protein 101 2 4
MIRT025605 YES1 YES proto-oncogene 1, Src family tyrosine kinase 1 1
MIRT025606 DUSP3 dual specificity phosphatase 3 1 1
MIRT025607 PANX1 pannexin 1 1 1
MIRT025608 WEE1 WEE1 G2 checkpoint kinase 1 1
MIRT025609 TLE3 transducin like enhancer of split 3 1 1
MIRT025610 PDPK1 3-phosphoinositide dependent protein kinase 1 1 1
MIRT025611 CMPK1 cytidine/uridine monophosphate kinase 1 2 6
MIRT025612 NDUFB6 NADH:ubiquinone oxidoreductase subunit B6 1 1
MIRT025613 ARPC5 actin related protein 2/3 complex subunit 5 1 1
MIRT025614 PUM2 pumilio RNA binding family member 2 1 1
MIRT025615 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT025616 ACVR2A activin A receptor type 2A 2 2
MIRT025617 RBM12B RNA binding motif protein 12B 2 5
MIRT025618 THUMPD1 THUMP domain containing 1 1 2
MIRT025619 BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 1 1
MIRT025620 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT025621 XRN1 5'-3' exoribonuclease 1 1 1
MIRT025622 E2F7 E2F transcription factor 7 1 1
MIRT025623 LCA5 LCA5, lebercilin 1 1
MIRT025624 ELOVL2 ELOVL fatty acid elongase 2 1 1
MIRT025625 TFAP2C transcription factor AP-2 gamma 2 3
MIRT025626 TRIM2 tripartite motif containing 2 2 4
MIRT025627 HOXB3 homeobox B3 2 5
MIRT047505 FUS FUS RNA binding protein 1 1
MIRT047506 LMBR1L limb development membrane protein 1 like 1 1
MIRT047507 HSP90AA1 heat shock protein 90 alpha family class A member 1 1 1
MIRT047508 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT047509 EXTL3 exostosin like glycosyltransferase 3 1 1
MIRT047510 POLR2A RNA polymerase II subunit A 1 1
MIRT047511 RIOK2 RIO kinase 2 1 1
MIRT047512 C12orf76 chromosome 12 open reading frame 76 1 1
MIRT047513 CCDC151 coiled-coil domain containing 151 1 1
MIRT047514 FAT2 FAT atypical cadherin 2 1 1
MIRT047515 TPI1 triosephosphate isomerase 1 1 1
MIRT047516 BTAF1 B-TFIID TATA-box binding protein associated factor 1 1 1
MIRT047517 MSANTD1 Myb/SANT DNA binding domain containing 1 1 1
MIRT047518 PLA2G4A phospholipase A2 group IVA 1 1
MIRT047519 IGSF1 immunoglobulin superfamily member 1 1 1
MIRT047520 LEMD3 LEM domain containing 3 1 1
MIRT047521 E2F1 E2F transcription factor 1 1 1
MIRT047522 KIF3B kinesin family member 3B 1 1
MIRT047523 GBAS nipsnap homolog 2 1 1
MIRT047524 LIMA1 LIM domain and actin binding 1 1 1
MIRT047525 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT047526 MRC2 mannose receptor C type 2 1 1
MIRT047527 TMEM106B transmembrane protein 106B 1 1
MIRT047528 ZFP30 ZFP30 zinc finger protein 1 1
MIRT047529 AMPD1 adenosine monophosphate deaminase 1 1 1
MIRT047530 SLC2A3 solute carrier family 2 member 3 1 1
MIRT047531 RPL15 ribosomal protein L15 1 1
MIRT047532 AGER advanced glycosylation end-product specific receptor 1 1
MIRT047533 CNTLN centlein 1 1
MIRT047534 C21orf59 chromosome 21 open reading frame 59 1 1
MIRT047535 SEPT9 septin 9 1 1
MIRT047536 COL6A2 collagen type VI alpha 2 chain 1 1
MIRT047537 MLNR motilin receptor 1 1
MIRT047538 RTKN2 rhotekin 2 1 1
MIRT047539 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT047540 CSNK2A1 casein kinase 2 alpha 1 2 3
MIRT047541 AQP12B aquaporin 12B 1 1
MIRT047542 AGBL2 ATP/GTP binding protein like 2 1 1
MIRT047543 GOLGA8A golgin A8 family member A 1 1
MIRT047544 CPED1 cadherin like and PC-esterase domain containing 1 1 1
MIRT047545 HSPA8 heat shock protein family A (Hsp70) member 8 1 1
MIRT047546 SLC41A3 solute carrier family 41 member 3 1 1
MIRT047547 KXD1 KxDL motif containing 1 1 1
MIRT047548 RELN reelin 1 1
MIRT047549 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT047550 PTPRT protein tyrosine phosphatase, receptor type T 1 1
MIRT047551 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT047552 CYP8B1 cytochrome P450 family 8 subfamily B member 1 1 1
MIRT047553 COL4A3 collagen type IV alpha 3 chain 1 1
MIRT047554 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT047555 MSL3 MSL complex subunit 3 1 1
MIRT047556 TTC7A tetratricopeptide repeat domain 7A 1 1
MIRT047557 COX7B cytochrome c oxidase subunit 7B 1 1
MIRT047558 ZNF318 zinc finger protein 318 1 1
MIRT047559 ACAA1 acetyl-CoA acyltransferase 1 1 1
MIRT047560 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT047561 SCAP SREBF chaperone 1 1
MIRT047562 KCTD11 potassium channel tetramerization domain containing 11 2 11
MIRT047563 RIOK3 RIO kinase 3 1 1
MIRT047564 C5 complement C5 1 1
MIRT047565 GLB1L3 galactosidase beta 1 like 3 1 1
MIRT047566 PAPD5 poly(A) RNA polymerase D5, non-canonical 1 1
MIRT047567 RNF123 ring finger protein 123 1 1
MIRT047568 ZNF629 zinc finger protein 629 1 1
MIRT047569 AMMECR1L AMMECR1 like 1 1
MIRT047570 KLHL6 kelch like family member 6 1 1
MIRT047571 SYMPK symplekin 1 1
MIRT047572 NCSTN nicastrin 1 1
MIRT047573 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 1
MIRT047574 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT047575 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 1
MIRT047576 RAB18 RAB18, member RAS oncogene family 1 1
MIRT047577 CUL3 cullin 3 1 1
MIRT047578 MTF2 metal response element binding transcription factor 2 1 1
MIRT047579 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT047580 NUP37 nucleoporin 37 1 1
MIRT047581 GPR98 adhesion G protein-coupled receptor V1 1 1
MIRT047582 RUNDC3B RUN domain containing 3B 1 1
MIRT047583 KIF21A kinesin family member 21A 1 1
MIRT047584 FEM1B fem-1 homolog B 1 1
MIRT047585 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT047586 PLA2G4F phospholipase A2 group IVF 1 1
MIRT047587 SNTB2 syntrophin beta 2 1 1
MIRT047588 NUB1 negative regulator of ubiquitin like proteins 1 1 1
MIRT047589 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT047590 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT047591 C11orf63 chromosome 11 open reading frame 63 1 1
MIRT047592 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT047593 CHRNA5 cholinergic receptor nicotinic alpha 5 subunit 1 1
MIRT047594 RPS9 ribosomal protein S9 1 1
MIRT047595 DDX42 DEAD-box helicase 42 1 1
MIRT047596 XPO7 exportin 7 1 1
MIRT047597 PYGL glycogen phosphorylase L 1 1
MIRT047598 TGFB3 transforming growth factor beta 3 1 1
MIRT047599 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT047600 PHB2 prohibitin 2 1 1
MIRT047601 ALDH1A2 aldehyde dehydrogenase 1 family member A2 1 1
MIRT047602 SLC3A2 solute carrier family 3 member 2 1 1
MIRT047603 POLR2H RNA polymerase II subunit H 1 1
MIRT047604 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT047605 MOB3C MOB kinase activator 3C 1 1
MIRT047606 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT047607 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT047608 INTS2 integrator complex subunit 2 1 1
MIRT047609 MYEF2 myelin expression factor 2 1 1
MIRT047610 PANK2 pantothenate kinase 2 1 1
MIRT047611 EMB embigin 1 1
MIRT047612 HK1 hexokinase 1 1 1
MIRT047613 UBE2Z ubiquitin conjugating enzyme E2 Z 1 1
MIRT047614 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT047615 HOXA3 homeobox A3 1 1
MIRT047616 NT5DC1 5'-nucleotidase domain containing 1 1 1
MIRT047617 YOD1 YOD1 deubiquitinase 1 1
MIRT047618 APRT adenine phosphoribosyltransferase 1 1
MIRT047619 C2CD2 C2 calcium dependent domain containing 2 1 1
MIRT047620 SHBG sex hormone binding globulin 1 1
MIRT047621 PPP1R12A protein phosphatase 1 regulatory subunit 12A 1 1
MIRT047622 SCD stearoyl-CoA desaturase 1 1
MIRT047623 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT047624 ETS1 ETS proto-oncogene 1, transcription factor 1 1
MIRT047625 GTF3C2 general transcription factor IIIC subunit 2 1 1
MIRT047626 NOP2 NOP2 nucleolar protein 1 1
MIRT047627 RPS29 ribosomal protein S29 1 1
MIRT047628 LAMC1 laminin subunit gamma 1 1 1
MIRT047629 GNAL G protein subunit alpha L 1 1
MIRT047630 KIAA1147 KIAA1147 1 1
MIRT047631 NACC2 NACC family member 2 1 1
MIRT047632 TMEM179B transmembrane protein 179B 1 1
MIRT047633 ARF3 ADP ribosylation factor 3 1 1
MIRT047634 MCPH1 microcephalin 1 1 1
MIRT047635 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT047636 UBN2 ubinuclein 2 1 1
MIRT047637 ANO6 anoctamin 6 1 1
MIRT047638 NEK7 NIMA related kinase 7 1 1
MIRT047639 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT047640 MED1 mediator complex subunit 1 1 1
MIRT047641 PTPRG protein tyrosine phosphatase, receptor type G 1 1
MIRT047642 ERMN ermin 1 1
MIRT047643 LYPD6 LY6/PLAUR domain containing 6 1 1
MIRT047644 SLC25A5 solute carrier family 25 member 5 1 1
MIRT047645 EPB41L2 erythrocyte membrane protein band 4.1 like 2 1 1
MIRT047646 ARFGEF1 ADP ribosylation factor guanine nucleotide exchange factor 1 1 1
MIRT047647 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT047648 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 1 1
MIRT047649 KLHL23 kelch like family member 23 1 1
MIRT047650 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT047651 HOXD13 homeobox D13 1 1
MIRT047652 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT047653 ZNF592 zinc finger protein 592 1 1
MIRT047654 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT047655 RRP1B ribosomal RNA processing 1B 1 1
MIRT047656 UHRF1 ubiquitin like with PHD and ring finger domains 1 1 1
MIRT047657 SORD sorbitol dehydrogenase 1 1
MIRT047658 PPM1G protein phosphatase, Mg2+/Mn2+ dependent 1G 1 1
MIRT047659 SF3B3 splicing factor 3b subunit 3 1 1
MIRT047660 PRPF8 pre-mRNA processing factor 8 1 1
MIRT047661 PRDX2 peroxiredoxin 2 1 1
MIRT047662 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT047663 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT047664 CAB39L calcium binding protein 39 like 1 1
MIRT047665 ATP5F1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1 1 1
MIRT047666 PARL presenilin associated rhomboid like 1 1
MIRT047667 ERLIN1 ER lipid raft associated 1 1 1
MIRT047668 MARS methionyl-tRNA synthetase 1 1
MIRT047669 TRPM7 transient receptor potential cation channel subfamily M member 7 1 1
MIRT047670 DLG4 discs large MAGUK scaffold protein 4 1 1
MIRT047671 WDR74 WD repeat domain 74 1 1
MIRT047672 PWP1 PWP1 homolog, endonuclein 1 1
MIRT047673 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT047674 NAP1L1 nucleosome assembly protein 1 like 1 1 1
MIRT047675 CTNND1 catenin delta 1 1 1
MIRT047676 IQCB1 IQ motif containing B1 1 1
MIRT047677 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT047678 CDK19 cyclin dependent kinase 19 1 1
MIRT047679 LRP3 LDL receptor related protein 3 1 1
MIRT047680 UBE2D2 ubiquitin conjugating enzyme E2 D2 1 1
MIRT047681 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT047682 GORASP2 golgi reassembly stacking protein 2 1 1
MIRT047683 DDX54 DEAD-box helicase 54 1 1
MIRT047684 CARHSP1 calcium regulated heat stable protein 1 1 1
MIRT047685 FAM168A family with sequence similarity 168 member A 1 1
MIRT047686 SF3B4 splicing factor 3b subunit 4 1 1
MIRT047687 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 1 1
MIRT047688 PLEKHB2 pleckstrin homology domain containing B2 1 1
MIRT047689 LRFN1 leucine rich repeat and fibronectin type III domain containing 1 1 1
MIRT047690 KIAA0100 KIAA0100 1 1
MIRT047691 DVL1 dishevelled segment polarity protein 1 1 1
MIRT047692 NOMO1 NODAL modulator 1 1 1
MIRT047693 MIS12 MIS12, kinetochore complex component 1 1
MIRT047694 GLOD4 glyoxalase domain containing 4 1 1
MIRT047695 USP11 ubiquitin specific peptidase 11 1 1
MIRT047696 UBE3C ubiquitin protein ligase E3C 1 1
MIRT047697 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT047698 SPARC secreted protein acidic and cysteine rich 1 1
MIRT047699 SLC26A2 solute carrier family 26 member 2 1 1
MIRT047700 MED12 mediator complex subunit 12 1 1
MIRT047701 FAM219B family with sequence similarity 219 member B 1 1
MIRT047702 GOSR2 golgi SNAP receptor complex member 2 1 1
MIRT047703 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT047704 PIAS3 protein inhibitor of activated STAT 3 1 1
MIRT047705 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT047706 COL4A2 collagen type IV alpha 2 chain 1 1
MIRT047707 NUP205 nucleoporin 205 1 1
MIRT047708 POLR3A RNA polymerase III subunit A 1 1
MIRT047709 ATG3 autophagy related 3 1 1
MIRT047710 COPA coatomer protein complex subunit alpha 1 1
MIRT047711 CD59 CD59 molecule (CD59 blood group) 1 1
MIRT047712 TENM3 teneurin transmembrane protein 3 1 1
MIRT047713 TUBA1A tubulin alpha 1a 1 1
MIRT047714 LSS lanosterol synthase 1 1
MIRT047715 FASN fatty acid synthase 4 1
MIRT047716 PSMD13 proteasome 26S subunit, non-ATPase 13 1 1
MIRT047717 ZNF618 zinc finger protein 618 1 1
MIRT047718 TSPAN33 tetraspanin 33 1 1
MIRT047719 KANK1 KN motif and ankyrin repeat domains 1 1 1
MIRT047720 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT047721 DPYSL2 dihydropyrimidinase like 2 1 1
MIRT047722 SUPT6H SPT6 homolog, histone chaperone 1 1
MIRT047723 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT047724 ACTG1 actin gamma 1 3 2
MIRT047725 PLSCR1 phospholipid scramblase 1 1 1
MIRT047726 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT047727 SFPQ splicing factor proline and glutamine rich 1 1
MIRT047728 VDAC1 voltage dependent anion channel 1 1 1
MIRT047729 ADCY9 adenylate cyclase 9 1 1
MIRT047730 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT047731 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 1 1
MIRT047732 SLC25A13 solute carrier family 25 member 13 1 1
MIRT047733 IGSF9B immunoglobulin superfamily member 9B 1 1
MIRT047734 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047735 MCU mitochondrial calcium uniporter 1 1
MIRT047736 CDK8 cyclin dependent kinase 8 1 1
MIRT047737 CEP128 centrosomal protein 128 1 1
MIRT047738 TRAPPC12 trafficking protein particle complex 12 1 1
MIRT047739 SYNJ1 synaptojanin 1 1 1
MIRT047740 NOB1 NIN1/PSMD8 binding protein 1 homolog 1 1
MIRT047741 AP5S1 adaptor related protein complex 5 sigma 1 subunit 1 1
MIRT047742 RNF213 ring finger protein 213 1 1
MIRT047743 PSMB1 proteasome subunit beta 1 1 1
MIRT047744 BCR BCR, RhoGEF and GTPase activating protein 1 1
MIRT047745 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT047746 NPTX1 neuronal pentraxin 1 1 1
MIRT047747 PRRC2C proline rich coiled-coil 2C 1 1
MIRT047748 PABPC3 poly(A) binding protein cytoplasmic 3 1 1
MIRT047749 NF2 neurofibromin 2 1 1
MIRT047750 RALBP1 ralA binding protein 1 1 1
MIRT047751 EHD4 EH domain containing 4 1 1
MIRT047752 RLIM ring finger protein, LIM domain interacting 1 1
MIRT076413 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT084600 BCL2L11 BCL2 like 11 3 5
MIRT093335 RAPGEF2 Rap guanine nucleotide exchange factor 2 2 2
MIRT097757 ARSK arylsulfatase family member K 2 2
MIRT099597 ID4 inhibitor of DNA binding 4, HLH protein 2 6
MIRT249192 RAP2A RAP2A, member of RAS oncogene family 2 1
MIRT299201 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT437577 ZFAND5 zinc finger AN1-type containing 5 2 1
MIRT437578 CNST consortin, connexin sorting protein 2 1
MIRT437579 TIAM1 T-cell lymphoma invasion and metastasis 1 2 1
MIRT438258 PTEN phosphatase and tensin homolog 2 2
MIRT438408 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT448051 SFRP1 secreted frizzled related protein 1 2 2
MIRT459965 POC1A POC1 centriolar protein A 2 2
MIRT466175 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT470412 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT475883 H3F3C H3 histone family member 3C 2 10
MIRT475919 H3F3B H3 histone family member 3B 2 8
MIRT493173 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT497272 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT507101 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508100 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT508628 PLA2G2C phospholipase A2 group IIC 2 2
MIRT510735 SON SON DNA binding protein 2 6
MIRT513973 CNOT6 CCR4-NOT transcription complex subunit 6 2 2
MIRT514262 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT514577 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 4
MIRT515044 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515692 TFPI tissue factor pathway inhibitor 2 2
MIRT515752 ONECUT3 one cut homeobox 3 2 2
MIRT517389 METTL7A methyltransferase like 7A 2 2
MIRT519732 ZNF460 zinc finger protein 460 2 2
MIRT520247 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT520270 URGCP upregulator of cell proliferation 2 2
MIRT522213 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT523700 FHL2 four and a half LIM domains 2 2 4
MIRT523978 DVL3 dishevelled segment polarity protein 3 2 2
MIRT525569 MTRNR2L7 MT-RNR2-like 7 2 6
MIRT525619 MTRNR2L3 MT-RNR2-like 3 2 4
MIRT530223 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT530549 SYNPO synaptopodin 2 2
MIRT531041 ZNF502 zinc finger protein 502 2 2
MIRT532579 GSS glutathione synthetase 2 2
MIRT534840 RAB15 RAB15, member RAS oncogene family 2 2
MIRT535793 MTRNR2L11 MT-RNR2-like 11 2 6
MIRT535811 MTRNR2L10 MT-RNR2-like 10 2 4
MIRT536818 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT539894 IRGQ immunity related GTPase Q 2 2
MIRT540209 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT540951 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541937 ORC1 origin recognition complex subunit 1 2 4
MIRT542195 FUT1 fucosyltransferase 1 (H blood group) 2 6
MIRT542374 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542508 WDR13 WD repeat domain 13 2 2
MIRT542575 ZNF280B zinc finger protein 280B 2 2
MIRT542714 RPS15A ribosomal protein S15a 2 2
MIRT546705 RORA RAR related orphan receptor A 5 4
MIRT549929 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550162 ZNF223 zinc finger protein 223 2 4
MIRT558566 CRLF3 cytokine receptor like factor 3 2 4
MIRT560945 TPM4 tropomyosin 4 2 4
MIRT574848 CADM1 cell adhesion molecule 1 2 2
MIRT575176 Atg9a autophagy related 9A 2 2
MIRT576664 Fam216a family with sequence similarity 216, member A 2 2
MIRT609434 MTX3 metaxin 3 2 2
MIRT612162 TCF15 transcription factor 15 2 2
MIRT617414 API5 apoptosis inhibitor 5 2 2
MIRT617469 CCS copper chaperone for superoxide dismutase 2 2
MIRT618780 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618835 PHF20 PHD finger protein 20 2 2
MIRT619339 RNF2 ring finger protein 2 2 2
MIRT625244 C6orf89 chromosome 6 open reading frame 89 2 2
MIRT626439 CHDH choline dehydrogenase 2 2
MIRT634929 CHMP1B charged multivesicular body protein 1B 2 2
MIRT635875 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636235 SLC24A4 solute carrier family 24 member 4 2 2
MIRT636641 CHAF1B chromatin assembly factor 1 subunit B 2 2
MIRT640545 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT648661 ALKBH4 alkB homolog 4, lysine demethylase 2 2
MIRT650186 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT650790 GSR glutathione-disulfide reductase 2 2
MIRT652027 TTYH3 tweety family member 3 2 2
MIRT652517 TMEM109 transmembrane protein 109 2 2
MIRT661940 MAVS mitochondrial antiviral signaling protein 2 2
MIRT661951 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT662020 ZNF445 zinc finger protein 445 2 2
MIRT664015 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT664059 KIAA1551 KIAA1551 2 2
MIRT666872 POU2F2 POU class 2 homeobox 2 2 2
MIRT669168 CCNG1 cyclin G1 2 2
MIRT673243 KLHDC8A kelch domain containing 8A 2 2
MIRT680410 SFT2D2 SFT2 domain containing 2 2 2
MIRT680484 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT683577 CARD8 caspase recruitment domain family member 8 2 2
MIRT684398 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT684558 ZNF708 zinc finger protein 708 2 2
MIRT685421 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT686050 SLC5A5 solute carrier family 5 member 5 2 2
MIRT687955 HHIP hedgehog interacting protein 2 2
MIRT688181 FRRS1 ferric chelate reductase 1 2 2
MIRT688303 FAM208A family with sequence similarity 208 member A 2 2
MIRT688900 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT689205 ZNF574 zinc finger protein 574 2 2
MIRT689917 ACOT13 acyl-CoA thioesterase 13 2 2
MIRT692931 EXOSC2 exosome component 2 2 2
MIRT693632 CENPL centromere protein L 2 2
MIRT694762 FZD2 frizzled class receptor 2 2 2
MIRT695373 PHAX phosphorylated adaptor for RNA export 2 2
MIRT696630 WDR77 WD repeat domain 77 2 2
MIRT696690 APOC3 apolipoprotein C3 2 2
MIRT697367 ZNF394 zinc finger protein 394 2 2
MIRT697611 XIAP X-linked inhibitor of apoptosis 2 2
MIRT697737 USP6NL USP6 N-terminal like 2 2
MIRT697788 UBXN7 UBX domain protein 7 2 2
MIRT698361 TMEM127 transmembrane protein 127 2 2
MIRT704519 CNKSR3 CNKSR family member 3 2 2
MIRT704600 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT705849 AHCY adenosylhomocysteinase 2 2
MIRT707093 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT707154 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT707243 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT707356 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT707459 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707503 AXL AXL receptor tyrosine kinase 2 2
MIRT707647 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT707703 FAM118A family with sequence similarity 118 member A 2 2
MIRT707714 CDC6 cell division cycle 6 2 2
MIRT707825 TMEM170A transmembrane protein 170A 2 2
MIRT707966 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT708006 NUDT4 nudix hydrolase 4 2 2
MIRT708035 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT708073 LIX1L limb and CNS expressed 1 like 2 2
MIRT708131 GK5 glycerol kinase 5 (putative) 2 2
MIRT708200 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT708210 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT708940 CRY2 cryptochrome circadian clock 2 2 2
MIRT709199 SAPCD2 suppressor APC domain containing 2 2 2
MIRT714403 FBXO31 F-box protein 31 2 2
MIRT714629 KIAA1143 KIAA1143 2 2
MIRT720741 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT720894 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT723335 DGAT1 diacylglycerol O-acyltransferase 1 2 2
MIRT724452 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT731180 SERPINE1 serpin family E member 1 3 1
MIRT732377 GP1BA glycoprotein Ib platelet alpha subunit 2 1
MIRT733585 SDC1 syndecan 1 3 0
MIRT734393 ARNTL aryl hydrocarbon receptor nuclear translocator like 3 0
MIRT735361 BDNF brain derived neurotrophic factor 4 0
MIRT735799 MAP2K6 mitogen-activated protein kinase kinase 6 3 0
MIRT735868 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736834 SKA1 spindle and kinetochore associated complex subunit 1 3 0
MIRT737248 LEF1-AS1 LEF1 antisense RNA 1 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-10a RAR-alpha antagonist Ro-41-5253 NULL NULL Northern blot pancreatic cancer 19747919 2009 down-regulated
miR-10a 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-10a Oxaliplatin (L-OHP) approved 5310940 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-10a Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells HT-29 cells 20955366 2011 down-regulated
miR-10a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Microarray acute myeloid leukemia (AML) cell line HL-60 21518431 2011 down-regulated
miR-10a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Quantitative real-time PCR regulatory T cells (T(reg) cells) 22544395 2012 up-regulated
miR-10a Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-10a Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Northern blot fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Quantitative real-time PCR fetal mouse brains 19091803 2009 up-regulated
miR-10a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 up-regualted
miR-10a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-10a-5p Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-10a-5p Comfrey NULL 6440495 Microarray rat liver 21370286 2011 down-regulated
miR-10a-5p Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-10a-5p Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-10a-5p Acarbose Approved 444254 Microarray diabetic rats cells 24260283 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-10a Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-10a Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-10a Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-10a Tamoxifen 2733525 NSC180973 approved sensitive tissue (ER-positive breast cancer)
hsa-mir-10a Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-10a-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 resistant
hsa-miR-10a-5p (3aR)-7-[3-[4-[3-[[(3aR)-8-methoxy-10-oxo-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-7-yl]oxy]propyl]piperazin-1-yl]propoxy]-8-methoxy-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-10-one 24202913 NSC726262 resistant
hsa-miR-10a-5p (4z,6z)-4,6-dibenzylidene-2,2-dimethyl-1,3-dioxan-5-one 5387558 NSC624512 resistant
hsa-miR-10a-5p (5e)-5-benzylidene-3-(2,4,5-trichlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470506 NSC702355 resistant
hsa-miR-10a-5p (6e,7r,8r,8as)-8-methyl-6-[(2r)-2-methylhexylidene]-8-phenylmethoxy-1,2,3,5,7,8a-hexahydroindolizin-7-ol 5470307 NSC699382 resistant
hsa-miR-10a-5p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 resistant
hsa-miR-10a-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-[4-(diethylamino)phenyl]prop-2-en-1-one 5471159 NSC709103 resistant
hsa-miR-10a-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 resistant
hsa-miR-10a-5p (e)-2-methyl-1-[2-(2-methyl-1h-indol-3-yl)indolin-1-yl]but-2-en-1-one 5388204 NSC633484 resistant
hsa-miR-10a-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-(cyclohexanecarbonylamino)-3-cyclohexyl-2-hydroxypropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10 383477 NSC671869 resistant
hsa-miR-10a-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-10a-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-10a-5p [(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-26-[(E)-[(2,4-dinitrophenyl)hydrazinylidene]methyl]-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12,14,16,18,22-heptamethyl-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta-1(29),2,4,9,19,21, 135483937 NSC144126 resistant
hsa-miR-10a-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-2-oxo-6-phenylpyridin-1-yl]oxan-2-yl]methyl acetate 368873 NSC640212 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-phenyl-2,4-bis(sulfanylidene)quinazolin-1-yl]oxan-2-yl]methyl acetate 368629 NSC639741 resistant
hsa-miR-10a-5p [4-[[dimethyl(octadecyl)azaniumyl]methyl]phenyl]methyl-dimethyl-octadecylazanium;bromide 361976 NSC625458 resistant
hsa-miR-10a-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] acetate 9555726 NSC144055 resistant
hsa-miR-10a-5p 1-(dimethylamino)-4-methyl-4H-pyrido[3,4-g]quinoline-5,10-dione 388892 NSC684118 sensitive
hsa-miR-10a-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 resistant
hsa-miR-10a-5p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 resistant
hsa-miR-10a-5p 1-[7-methyl-8-(3,4,5-trimethoxyphenyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]piperazine 384846 NSC675364 resistant
hsa-miR-10a-5p 10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2,4,6,8,11(19),12,14(18)-heptaene-15,17-dione 399629 NSC710546 sensitive
hsa-miR-10a-5p 1h-pyrimido[4,5-b]quinoline-2,4-dithione 5472868 NSC722222 resistant
hsa-miR-10a-5p 2-(11h-indolo[3,2-c]quinolin-6-ylamino)ethanol NSC736606 sensitive
hsa-miR-10a-5p 2-(2-chlorophenyl)-5,7-dihydroxy-8-(3-hydroxy-1-methylpiperidin-4-yl)chromen-4-one 5466794 NSC642740 resistant
hsa-miR-10a-5p 2-trans-n-buten-1-yl-estradiol 5468334 NSC669229 resistant
hsa-miR-10a-5p 2,5-diphenyl-1h-[1,2,4]triazino[4,3-a]quinoxaline 399102 NSC709518 resistant
hsa-miR-10a-5p 3-(((cyclohexylamino)carbonyl)oxy)-4-methyl-1,3-thiazole-2(3h)-thione 372703 NSC648263 resistant
hsa-miR-10a-5p 3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-phenyl-3,4-dihydropyrazole-2-carbaldehyde 155810020 NSC762559 resistant
hsa-miR-10a-5p 3,3,4,4,4-pentachloro-1-phenylbutan-1-one 405828 NSC723515 sensitive
hsa-miR-10a-5p 4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 374328 NSC651852 resistant
hsa-miR-10a-5p 4-appt 5995211 NSC195327 resistant
hsa-miR-10a-5p 4-methyl-3-[4-[2-[4-(4-methyl-5-sulfanylidene-1h-1,2,4-triazol-3-yl)phenyl]iminohydrazinyl]phenyl]-1h-1,2,4-triazole-5-thione 5472009 NSC715974 resistant
hsa-miR-10a-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 resistant
hsa-miR-10a-5p 5'-chloro-2'-methoxy-3-nitrosalicylanilide 186169 NSC79459 resistant
hsa-miR-10a-5p 5,6-dimethoxy-9-(methylthio)furo[3',4':4,5]cyclopenta[1,2,3-ij]isoquinoline 363754 NSC628946 resistant
hsa-miR-10a-5p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-10a-5p 6-(chloromethyl)-2-oxo-N-pentylchromene-3-carboxamide 402500 NSC716526 sensitive
hsa-miR-10a-5p 6-methoxy-1h-pyrazolo[3,4-b]quinoxalin-3-amine 395806 NSC700694 resistant
hsa-miR-10a-5p 6,7-diacetoxyisoflavan 353129 NSC600289 resistant
hsa-miR-10a-5p 8-[(4-tert-butylphenoxy)methyl]-1,3-dimethyl-7H-purine-2,6-dione 235292 NSC36525 resistant
hsa-miR-10a-5p 8455ab 1549990 NSC24189 resistant
hsa-miR-10a-5p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 resistant
hsa-miR-10a-5p Antibiotic p 168 5477807 NSC356885 resistant
hsa-miR-10a-5p Antineoplastic-656904 376224 NSC656904 resistant
hsa-miR-10a-5p Aquatris(1,3-diphenylpropane-1,3-dionato)neodymium(iii) 24202395 NSC647040 resistant
hsa-miR-10a-5p Bas100 monohydrate 45028404 NSC742554 resistant
hsa-miR-10a-5p Berberine iodide 72350 NSC150446 resistant
hsa-miR-10a-5p Bindschedler's green 73516 NSC7811 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p C4, carbonyl, ethyl prodigiosine 135540855 NSC742416 resistant
hsa-miR-10a-5p Cgp 57380 11644425 NSC741567 sensitive
hsa-miR-10a-5p Cinerubin a hcl 5458466 NSC243022 sensitive
hsa-miR-10a-5p Cis-dichlorobis(4-methoxyphenethylamine)platinum(ii) 498558 NSC631305 resistant
hsa-miR-10a-5p Cis-difluorobis(1-phenylhexane-1,3-dionato)titanium(iv) NSC637220 resistant
hsa-miR-10a-5p Cyano-[4-[[[3-(trifluoromethyl)phenyl]methylamino]carbamoyl]pyridin-1-ium-1-yl]boron 6334922 NSC698276 resistant
hsa-miR-10a-5p Cytembena 23663958 NSC104801 resistant
hsa-miR-10a-5p Cytovaricin 5477715 NSC349622 resistant
hsa-miR-10a-5p Diethyl 2-[[4-[[[3-ethoxycarbonyl-7-(trifluoromethyl)quinoxalin-2-yl]amino]methyl]benzoyl]amino]pentanedioate 390810 NSC688812 resistant
hsa-miR-10a-5p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-10a-5p Echinomycin 3197 NSC526417 resistant
hsa-miR-10a-5p Ethyl 2-((4-(2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494007 NSC691084 resistant
hsa-miR-10a-5p Ethyl 2-((4-(6-bromo-2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494008 NSC691085 resistant
hsa-miR-10a-5p Ethyl 5-amino-4-(3,4-dihydro-2h-1,5-benzodioxepin-7-ylamino)-2-methylsulfanylthieno[2,3-d]pyrimidine-6-carboxylate 399955 NSC711107 resistant
hsa-miR-10a-5p From combretum caffrum plant 5386397 NSC609397 resistant
hsa-miR-10a-5p Kuc100204 378309 NSC660313 resistant
hsa-miR-10a-5p Lddhtajmmdseme-okkqscsosa-n 6712634 NSC702655 sensitive
hsa-miR-10a-5p Ls-77867 395636 NSC700418 resistant
hsa-miR-10a-5p Methyl (1s,10r)-6-methyl-10-nonyl-7,9,12-triazatricyclo[6.3.1.04,12]dodeca-5,8-diene-5-carboxylate 401693 NSC715423 resistant
hsa-miR-10a-5p Methyl 3-butylsulfanyl-2-[[(e)-3-(6-methyl-2,4-dioxo-1h-pyrimidin-5-yl)prop-2-enoyl]amino]propanoate 5383838 NSC201241 resistant
hsa-miR-10a-5p Mggh 5351153 NSC32946 resistant
hsa-miR-10a-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 resistant
hsa-miR-10a-5p N-[3-bromo-6-oxo-1-(4-phenylpiperidin-1-yl)-4,5-dihydrocyclopenta[c]thiophen-4-yl]-2,2,2-trifluoroacetamide 378804 NSC662123 resistant
hsa-miR-10a-5p NSC657492 NSC657492 sensitive
hsa-miR-10a-5p NSC751830 NSC751830 sensitive
hsa-miR-10a-5p Plumericin 5281545 NSC112152 resistant
hsa-miR-10a-5p Propan-2-yl (1r,9s,12e)-3,4,6-trimethoxy-11-[(4-methoxyphenyl)methyl]-5-methyl-10-oxo-12-[(2,4,5-trimethoxy-3-methylphenyl)methylidene]-11,13-diazatricyclo[7.3.1.02,7]trideca-2(7),3,5-triene-13-carbox 6330789 NSC622075 resistant
hsa-miR-10a-5p Resorufin 69462 NSC12097 resistant
hsa-miR-10a-5p Rhamnazin 5320945 NSC678106 resistant
hsa-miR-10a-5p Roridin a, 8-hydroxy-9b,10b-epoxy- 5458716 NSC327993 resistant
hsa-miR-10a-5p Sb-236687 17892742 NSC756422 sensitive
hsa-miR-10a-5p Sergeolide,desacetyl 125729 NSC364170 resistant
hsa-miR-10a-5p Sodium;4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 54612576 NSC651853 resistant
hsa-miR-10a-5p Tert-butyl n-[6-[2-[(2-amino-2-oxoethyl)carbamoyl]pyrrolidin-1-yl]-5-(9h-fluoren-9-ylmethoxycarbonylamino)-6-oxohexyl]carbamate 383818 NSC672434 sensitive
hsa-miR-10a-5p Tetra(isobutenyl)antimony bromide NSC651199 resistant
hsa-miR-10a-5p Tributylgermyl 2-acetoxy-2-phenyl-acetate 16683233 NSC645575 resistant
hsa-miR-10a-5p Verrucarin a 9,10-epoxide 5358836 NSC283445 sensitive
hsa-miR-10a-5p Z28714792 2671841 NSC746248 resistant
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved resistant High Myelogen