pre-miRNA Information
pre-miRNA hsa-mir-10a   
Genomic Coordinates chr17: 48579838 - 48579947
Synonyms MIRN10A, hsa-mir-10a, miRNA10A, mir-10a, MIR10A
Description Homo sapiens miR-10a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-10a-5p
Sequence 22| UACCCUGUAGAUCCGAAUUUGUG |44
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30152819 13 COSMIC
COSN30458892 14 COSMIC
COSN23023008 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1333990950 2 dbSNP
rs770328167 3 dbSNP
rs1453440972 5 dbSNP
rs1391955925 7 dbSNP
rs1157653116 8 dbSNP
rs760091682 10 dbSNP
rs1161287321 12 dbSNP
rs369632753 13 dbSNP
rs985848773 14 dbSNP
rs772649724 18 dbSNP
rs529115879 22 dbSNP
rs375865628 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B6HZE2 miR-10a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Muscle Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol ACVR2A   
Synonyms ACTRII, ACVR2
Description activin A receptor type 2A
Transcript NM_001616   
Expression
Putative miRNA Targets on ACVR2A
3'UTR of ACVR2A
(miRNA target sites are highlighted)
>ACVR2A|NM_001616|3'UTR
   1 TGGTTGCGCCATCTGTGCACACTAAGAAATGGGACTCTGAACTGGAGCTGCTAAGCTAAAGAAACTGCTTACAGTTTATT
  81 TTCTGTGTAAAATGAGTAGGATGTCTCTTGGAAATGTTAAGAAAGAAGACCCTTTGTTGAAAAATGTTGCTCTGGGAGAC
 161 TTACTGCATTGCCGACAGCACAGATGTGAAGGACATGAGACTAAGAGAAACCTTGCAAACTCTATAAAGAAACTTTTGAA
 241 AAAGTGTACATGAAGAATGTAGCCCTCTCCAAATCAAGGATCTTTTGGACCTGGCTAATGGAGTGTTTGAAAACTGACAT
 321 CAGATTTCTTAATGTCTGTCAGAAGACACTAATTCCTTAAATGAACTACTGCTATTTTTTTTAAATCAAAAACTTTTCAT
 401 TTCAGATTTTAAAAAGGGTAACTTGTTTTTATTGCATTTGCTGTTGTTTCTATAAATGACTATTGTAATGCCAATATGAC
 481 ACAGCTTGTGAATGTTTAGTGTGCTGCTGTTCTGTGTACATAAAGTCATCAAAGTGGGGTACAGTAAAGAGGCTTCCAAG
 561 CATTACTTTAACCTCCCTCAACAAGGTATACCTCAGTTCCACGGTTGCTAAATTATAAAATTGAAAACACTAACAAAATT
 641 TGAATAATAAATCGATCCATGTTTTGTAACAAATTCACTGTGTTATTTAAGGAAAAAAAGGTAAGCTATGCTTAGTGCCA
 721 ACAATAAGTGGCCATTCGTAAAGCAGTGTTTTAGCATTTCTTGTGCTGGCTTGTAATGTAGGGAAAAAAAGTGCTGTTTT
 801 TTGAAAAGATGGTGTCATTTCCCCCTTCTTCCCATGTTTTAAAGCCCCATCTTATATCCAGTTCCCAAAATTTGCATACT
 881 TACCTAAGTATTTTTTTTAGGTGTGCTGTGTTTGGGGAATATTTGAAAATTTAAAGCATGATTTAAAATTTTTTAAAGTG
 961 AGCTGTGACACTGGAAAGCTCTTCATTTTATCTTTTAAAATAGAGTTTTTTCTATTTATATATGTAAAATTGTAGTGTAT
1041 TTCTTTTCACCAAACAGTGTGTGGGACATTCTTTATCACTGTTTTAGGATCACCTCAGGAAGTGTCGTTACCCAGAATTC
1121 CCCACTGTCTGCTATGAGACTTGTAACTTTATCACTATACTTCTGCTTGGTGCCATCTTGTCAGAGTAATATTTGATGTC
1201 TGTGATATGTAAAGAATTATCCTAGGATAAAGATATTAAACTTTAAGCAGATTTCAGATGTTACTGCTTTAAAACAAATC
1281 AGGGATAACAAATTAAACGTATAACTTAAAATATGCAATGACATTTAGAGGTAACCAATGTTGATATAGGTAGCATAGCC
1361 TAGCCTCCTCCCCAAAATTGCTTTTACAACTAACACTGATACTAATTTAGGATAGTTCATGCCTTATCCTTGCTAAGAAA
1441 ATGGAATTGATGGTAGGCAGGTGCTAAAGTGCTTTTCAAAACAATATTACGTTAGAATACAATTGGATTCTTCCTCAAAT
1521 TTATACAGGCCAAAAAGTAAAACATTAATTTTCTGAATTTCCAGATTACCAATCAATTAATCAACAAATAGCCAGTATTA
1601 TGCTGTGTATTTCTGTCAGGTCATTTTAAAATCCATGTTAATTTTATAAAAGAATTTTTTACATGTCACTGTCAGGAGCT
1681 CACTGTGAATGTGTTGTCTTCAAATGGTTATTTAACCACACAGTACACTACATTTTACATATATGTACGTAATCTCTGGG
1761 AATAGTAAATTAATTATGTTATTTATAAACAATACATAGGTCAACAGACTTTAAGCAGGGAGGAAAAGAAGAGTAATAGC
1841 GTCTGTGTGCTGCAGACCATTCAGAACTGTCACGTGTGTCCCCATGGTCTCATTCATTGTATTCCTAGCAATTCCCTTTT
1921 CAATGTTGAGTTCACCTCTTTATTTCACAAAGTACTTGGTCTCTCAATTTCTTGATCTGGTTTTGCTTCCATTTAAAAAC
2001 TAATCAAGAAGGGAAAATATTGAGAATGTGCATACAAGAAAATCATTAATTTCCTGAAGATGAATTTCTACCTGTTGTGA
2081 ACATTTAACTTTCTTTTTAAAAGTTAAACAAAAATAAACAAGGGATATTATGATGAATGTTTGGCTTATGTGAGTACTAG
2161 AGATAAAATTTTTAAACCCAGTTATTCACAATATAAAATGTTTTCAAGTTAGAAAAAATTTTTAGAAATCCTGGGTATTG
2241 TATTTAACTGTAGCTAACCAATTTTAAAACTTGTATTCTTTTGAGAACTATTATTAATAGAAAAACTTTTTATAAGCAGT
2321 AAAATAAGAATGTTCCAGTGACTACCTGTCCTTATACCTAGTCTTGTTAAAACTTTCTTTTGCAGGGTATTTAGTGTTTG
2401 GTTTACAGTCAGTGCAGAGTGGGCAAGTTAACAGAAAGTTTGAGCTAGAGATACTGGAAAAAAAAAAGATCAAAGAATGA
2481 GAAAAATGGTGATCCATTTTGGGGCAAACTGAGACCCCCCAAATAACTCTTTCCTCATGTGTATGGTGCTCCTCATGACT
2561 CGTCTTGTATTTTGCCTTTCTGATACCCATCAGAACTGCTGCTGCTCTAACTTATACTCTTTACCTTGCCCAGATCTCCG
2641 CGTAAGGAATGCTTTATGATCAACTTGCCATAGGACTGATGGATTAACCAGTGTTCGGCTTTATTTGAAGTCTATGCCCT
2721 GCACAGCTCTTGTATGTATTTTAGATGCTAGAAGTTTTTTTAGCATGTGATGTGTGATTCTTGTTTGAATTCTAGGTACC
2801 TTGTGAATTCCAGAAAAAGAGACTGTGCTTCACGATTGTTAGTCCCATGAACTTGCACTATCTATCTTTCATGGTGATGT
2881 TTTGAAAATACAATCAGGAAAAAACCCAACACCTTTGGAATTTAAAATAGAATCATATCATGAAATTTAAAAAGAATCTC
2961 TTCTGTTGCATTTCCTCACCCCTAAGTAACAGCTACATTTAAGTAAAATGCAGGTGGTAGGGGAAAAAAAACCATGGCGA
3041 GATGGTGGTTTAGTGGAATAAACTGATTACTGGTTTTTTTGTTTTTTTTTTTTTTTTTAAAGAAAGAAGCTTCATCACAG
3121 ATACTTTCCAGTTTCTCTTTTATACTTTTTTGAAAGATTACTTTTTAGGAACATTTGGTATGATATGCATAAAATTATTT
3201 ATCCATTTATGGGCAAAATGATACAAGTAGCATCTTGATTGAACATCATTTACCTCAGATATTCAACCAGCAGTACGTTT
3281 TTTATGCAGTCTCAACCCATATCCCATTTGTTACCTCTCAGAATATTGGTAAGCAGTTATTTTCGCTTTACTCTGTATTT
3361 CTTGTGTTTTGGGCACAGGTTATTGTACTACTGTCAAATCGTACTTGCTATTTTTTCTGCAAGTATTTAACAGAAAGCTT
3441 AAAATCCCCATAAAACCCCACCTTGGATAAGTGATTGTTAAATATTGTACAAATAAAATGTATGCTATCCCCATTCCATC
3521 CCCAAGTTAAATAAAAAAATGAATACGGTATGAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gugUUUAAGCCUAGAUGUCCCAu 5'
             ||| |:   |:|:|||||| 
Target 5' ttaAAACTTTCTTTTGCAGGGTa 3'
2367 - 2389 144.00 -14.80
2
miRNA  3' guguUUAAGCCUAGA---UGUCCCAu 5'
              | ||| |||:|   | ||||| 
Target 5' tttcATTTCAGATTTTAAAAAGGGTa 3'
395 - 420 131.00 -12.30
3
miRNA  3' guGUUUAAGCCUAGAUGUCCcau 5'
            ||||||    | ||||||   
Target 5' ctCAAATT----TATACAGGcca 3'
1514 - 1532 123.00 -8.92
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30119090 5 COSMIC
COSN20074171 8 COSMIC
COSN13939688 9 COSMIC
COSN30578028 26 COSMIC
COSN30709014 50 COSMIC
COSN31660838 57 COSMIC
COSN31525551 62 COSMIC
COSN30144452 69 COSMIC
COSN31521980 172 COSMIC
COSN28882146 178 COSMIC
COSN24720514 231 COSMIC
COSN4797521 271 COSMIC
COSN31578836 285 COSMIC
COSN30170884 404 COSMIC
COSN31536400 445 COSMIC
COSN9862514 466 COSMIC
COSN9862515 467 COSMIC
COSN31527985 528 COSMIC
COSN31596471 669 COSMIC
COSN28814130 778 COSMIC
COSN31540163 899 COSMIC
COSN24294820 1003 COSMIC
COSN31485100 1012 COSMIC
COSN30173299 1044 COSMIC
COSN31576249 1128 COSMIC
COSN31549835 1298 COSMIC
COSN31567820 1440 COSMIC
COSN26645708 1606 COSMIC
COSN31590305 1655 COSMIC
COSN31961725 1699 COSMIC
COSN27156928 1905 COSMIC
COSN20097222 2106 COSMIC
COSN22628673 2178 COSMIC
COSN24230470 2272 COSMIC
COSN31486654 2284 COSMIC
COSN31584361 2286 COSMIC
COSN21695814 2537 COSMIC
COSN26560600 2628 COSMIC
COSN21963287 2683 COSMIC
COSN20229284 2784 COSMIC
COSN31583086 2793 COSMIC
COSN20097224 3099 COSMIC
COSN15660959 3100 COSMIC
COSN7107992 3187 COSMIC
COSN26636642 3188 COSMIC
COSN7107993 3227 COSMIC
COSN31531182 3252 COSMIC
COSN31547359 3346 COSMIC
COSN28778519 3364 COSMIC
COSN31523841 3388 COSMIC
COSN9067879 3476 COSMIC
COSN30029508 3504 COSMIC
COSN31592607 3504 COSMIC
rs17692648 2889 GWAS
rs151062078 3082 GWAS
rs5835176 3083 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1426520441 4 dbSNP
rs770324693 4 dbSNP
rs978379535 6 dbSNP
rs201620807 8 dbSNP
rs375329742 9 dbSNP
rs757398334 14 dbSNP
rs1430033047 23 dbSNP
rs1463608927 25 dbSNP
rs558172231 30 dbSNP
rs1168504682 32 dbSNP
rs1399640405 34 dbSNP
rs778868374 36 dbSNP
rs890119377 38 dbSNP
rs745374659 48 dbSNP
rs566531448 63 dbSNP
rs1168441643 65 dbSNP
rs933445120 69 dbSNP
rs1014615807 72 dbSNP
rs1371870584 73 dbSNP
rs1317819195 74 dbSNP
rs1051695973 78 dbSNP
rs907896834 81 dbSNP
rs780376676 86 dbSNP
rs1312481237 94 dbSNP
rs1389551447 101 dbSNP
rs1338094575 102 dbSNP
rs939919235 102 dbSNP
rs527739012 109 dbSNP
rs973206133 112 dbSNP
rs1036956450 115 dbSNP
rs1322146753 116 dbSNP
rs1024204964 119 dbSNP
rs1373414591 121 dbSNP
rs1186656676 124 dbSNP
rs1803029 131 dbSNP
rs1434124621 133 dbSNP
rs969621476 138 dbSNP
rs1245250525 154 dbSNP
rs1293306226 155 dbSNP
rs898290924 159 dbSNP
rs982760973 161 dbSNP
rs1457339077 163 dbSNP
rs1270982289 174 dbSNP
rs1198017468 175 dbSNP
rs1340759058 181 dbSNP
rs1247051272 184 dbSNP
rs751273191 188 dbSNP
rs935586979 189 dbSNP
rs1055407836 196 dbSNP
rs894880405 198 dbSNP
rs147387385 208 dbSNP
rs1211984361 209 dbSNP
rs192909728 219 dbSNP
rs946780579 222 dbSNP
rs1411585614 223 dbSNP
rs1162407444 226 dbSNP
rs1397173111 226 dbSNP
rs1465589698 227 dbSNP
rs1039816135 230 dbSNP
rs921759335 231 dbSNP
rs1186328126 234 dbSNP
rs931868537 234 dbSNP
rs1051606866 237 dbSNP
rs1231238395 242 dbSNP
rs112515489 250 dbSNP
rs1004816000 266 dbSNP
rs184320682 268 dbSNP
rs898855159 270 dbSNP
rs1361989384 271 dbSNP
rs994992677 277 dbSNP
rs1023415899 278 dbSNP
rs1352613435 289 dbSNP
rs1277232641 295 dbSNP
rs1443799912 300 dbSNP
rs1367316955 308 dbSNP
rs1459429735 325 dbSNP
rs1160866655 330 dbSNP
rs1388965322 333 dbSNP
rs1367147873 335 dbSNP
rs1164041621 346 dbSNP
rs569751857 350 dbSNP
rs1419327177 372 dbSNP
rs1434044854 373 dbSNP
rs1003673453 375 dbSNP
rs969550761 375 dbSNP
rs1377173616 378 dbSNP
rs1035170944 383 dbSNP
rs1490999908 384 dbSNP
rs1270042576 385 dbSNP
rs772972639 387 dbSNP
rs1446042220 394 dbSNP
rs568257205 394 dbSNP
rs1281634571 395 dbSNP
rs781487124 397 dbSNP
rs1275551400 419 dbSNP
rs1311928575 420 dbSNP
rs988383469 423 dbSNP
rs769792502 424 dbSNP
rs968116357 435 dbSNP
rs1303505062 444 dbSNP
rs137976741 453 dbSNP
rs974934392 463 dbSNP
rs1320492217 468 dbSNP
rs777529977 473 dbSNP
rs1401565775 475 dbSNP
rs1174450584 480 dbSNP
rs1481687437 482 dbSNP
rs1231551938 491 dbSNP
rs188715230 498 dbSNP
rs540372667 501 dbSNP
rs1330138378 502 dbSNP
rs921325363 523 dbSNP
rs1244195923 524 dbSNP
rs1217416361 527 dbSNP
rs934072308 529 dbSNP
rs1259411596 531 dbSNP
rs1029139705 533 dbSNP
rs954778580 535 dbSNP
rs763077912 539 dbSNP
rs1283794165 545 dbSNP
rs1213947235 546 dbSNP
rs1359527349 558 dbSNP
rs1271729842 560 dbSNP
rs1431746040 575 dbSNP
rs911755604 580 dbSNP
rs572084136 589 dbSNP
rs987535903 602 dbSNP
rs555802188 603 dbSNP
rs545884882 604 dbSNP
rs973846593 611 dbSNP
rs898815658 616 dbSNP
rs1422076109 617 dbSNP
rs1187541032 622 dbSNP
rs1183768392 632 dbSNP
rs1242205216 637 dbSNP
rs994478044 638 dbSNP
rs1181394200 645 dbSNP
rs1045126946 646 dbSNP
rs1462237002 646 dbSNP
rs1412220502 652 dbSNP
rs144014646 654 dbSNP
rs931247789 660 dbSNP
rs1305762482 665 dbSNP
rs1156658837 673 dbSNP
rs1214993901 675 dbSNP
rs1054952931 677 dbSNP
rs1003261185 679 dbSNP
rs1454781935 679 dbSNP
rs774272760 681 dbSNP
rs949092191 691 dbSNP
rs956894965 693 dbSNP
rs1009774787 696 dbSNP
rs1046181592 701 dbSNP
rs1360611583 716 dbSNP
rs74730572 725 dbSNP
rs1171541730 726 dbSNP
rs1405090061 736 dbSNP
rs1022579852 738 dbSNP
rs576237505 739 dbSNP
rs968713693 745 dbSNP
rs975401507 750 dbSNP
rs1176164038 755 dbSNP
rs1466372988 760 dbSNP
rs1302142733 764 dbSNP
rs1373591178 767 dbSNP
rs1412977677 770 dbSNP
rs921283926 772 dbSNP
rs1351335938 777 dbSNP
rs1223366188 780 dbSNP
rs1358376259 781 dbSNP
rs955470310 784 dbSNP
rs180683564 785 dbSNP
rs911724532 792 dbSNP
rs940538648 792 dbSNP
rs999190349 797 dbSNP
rs1306348717 801 dbSNP
rs909001396 804 dbSNP
rs971896809 808 dbSNP
rs1032460101 810 dbSNP
rs1280209535 817 dbSNP
rs1485003886 818 dbSNP
rs894037705 824 dbSNP
rs1206660021 825 dbSNP
rs996859023 828 dbSNP
rs1258324352 835 dbSNP
rs1364042577 837 dbSNP
rs375846152 839 dbSNP
rs148171495 848 dbSNP
rs930573074 850 dbSNP
rs1157944164 852 dbSNP
rs954880306 861 dbSNP
rs761041419 862 dbSNP
rs1433513639 867 dbSNP
rs1044709398 869 dbSNP
rs1393181226 872 dbSNP
rs1409531456 874 dbSNP
rs1431624040 874 dbSNP
rs1308567203 875 dbSNP
rs1490182105 877 dbSNP
rs1266500216 880 dbSNP
rs1185361375 881 dbSNP
rs904887926 881 dbSNP
rs1490569324 882 dbSNP
rs1237202595 885 dbSNP
rs1318740947 885 dbSNP
rs939088237 885 dbSNP
rs1296630154 886 dbSNP
rs1223424756 891 dbSNP
rs751197567 891 dbSNP
rs1370059728 892 dbSNP
rs768690362 903 dbSNP
rs544775606 909 dbSNP
rs892628161 909 dbSNP
rs1287858550 911 dbSNP
rs562871051 911 dbSNP
rs973410766 913 dbSNP
rs776799060 922 dbSNP
rs1346333502 933 dbSNP
rs563144810 934 dbSNP
rs780172467 938 dbSNP
rs1022888741 945 dbSNP
rs747912004 949 dbSNP
rs1427176955 950 dbSNP
rs1436674979 955 dbSNP
rs904082068 972 dbSNP
rs1480620040 973 dbSNP
rs1260787766 985 dbSNP
rs1203556640 988 dbSNP
rs1487006315 989 dbSNP
rs1203165682 990 dbSNP
rs1261385429 990 dbSNP
rs997534805 993 dbSNP
rs1248059916 994 dbSNP
rs1285702784 994 dbSNP
rs1488630184 999 dbSNP
rs761762797 1001 dbSNP
rs1363685859 1002 dbSNP
rs1380163154 1002 dbSNP
rs765332672 1002 dbSNP
rs530283078 1005 dbSNP
rs1169499508 1006 dbSNP
rs771868279 1006 dbSNP
rs1403311178 1011 dbSNP
rs1178423434 1013 dbSNP
rs986875162 1014 dbSNP
rs1190844327 1019 dbSNP
rs990752381 1023 dbSNP
rs1392964905 1035 dbSNP
rs1430491386 1038 dbSNP
rs1015650193 1040 dbSNP
rs542519154 1044 dbSNP
rs1459983778 1048 dbSNP
rs1265093429 1049 dbSNP
rs961454717 1051 dbSNP
rs971897701 1051 dbSNP
rs1249941948 1055 dbSNP
rs1230134823 1062 dbSNP
rs1308472324 1066 dbSNP
rs916378285 1068 dbSNP
rs1451473312 1069 dbSNP
rs1379872113 1075 dbSNP
rs1451114532 1075 dbSNP
rs920434272 1086 dbSNP
rs1395738575 1089 dbSNP
rs1166107448 1090 dbSNP
rs1463294000 1093 dbSNP
rs930565405 1095 dbSNP
rs1163105265 1104 dbSNP
rs1443068679 1107 dbSNP
rs560081086 1108 dbSNP
rs1188377393 1110 dbSNP
rs185409061 1113 dbSNP
rs926309206 1124 dbSNP
rs776619624 1130 dbSNP
rs1046296189 1132 dbSNP
rs902255022 1138 dbSNP
rs1351817970 1139 dbSNP
rs1291526792 1141 dbSNP
rs1437536067 1144 dbSNP
rs1356912658 1150 dbSNP
rs533436948 1151 dbSNP
rs190507263 1160 dbSNP
rs545256865 1161 dbSNP
rs570598850 1171 dbSNP
rs1043873097 1179 dbSNP
rs1370925184 1183 dbSNP
rs1302381692 1189 dbSNP
rs1298938308 1191 dbSNP
rs1387366087 1193 dbSNP
rs904042106 1197 dbSNP
rs1164070131 1205 dbSNP
rs1469658806 1209 dbSNP
rs1362143863 1210 dbSNP
rs1388074028 1215 dbSNP
rs531875697 1227 dbSNP
rs1212272895 1229 dbSNP
rs1268623225 1233 dbSNP
rs1220773128 1234 dbSNP
rs1489708385 1235 dbSNP
rs1291489592 1237 dbSNP
rs1321799669 1239 dbSNP
rs1210065306 1242 dbSNP
rs549708880 1251 dbSNP
rs1277322929 1252 dbSNP
rs1029026046 1254 dbSNP
rs568252477 1258 dbSNP
rs1351070815 1259 dbSNP
rs1402817604 1262 dbSNP
rs1050646843 1278 dbSNP
rs891391137 1282 dbSNP
rs1324372994 1284 dbSNP
rs565719623 1287 dbSNP
rs1008190715 1288 dbSNP
rs1160442702 1289 dbSNP
rs1473189238 1290 dbSNP
rs1466059730 1297 dbSNP
rs535350698 1299 dbSNP
rs182267646 1300 dbSNP
rs961423670 1302 dbSNP
rs147286326 1303 dbSNP
rs1415964529 1304 dbSNP
rs1210106584 1315 dbSNP
rs1329263762 1318 dbSNP
rs1462039787 1319 dbSNP
rs1015071233 1323 dbSNP
rs1369390960 1324 dbSNP
rs1164416623 1325 dbSNP
rs1392593342 1332 dbSNP
rs1459125668 1348 dbSNP
rs1319446741 1355 dbSNP
rs763438068 1357 dbSNP
rs1320347773 1361 dbSNP
rs35733780 1370 dbSNP
rs765337382 1388 dbSNP
rs539424674 1391 dbSNP
rs757777116 1392 dbSNP
rs557826365 1394 dbSNP
rs1286483963 1395 dbSNP
rs576201251 1399 dbSNP
rs980708466 1400 dbSNP
rs1027631030 1409 dbSNP
rs773123154 1419 dbSNP
rs990701362 1424 dbSNP
rs916493615 1427 dbSNP
rs1270853832 1433 dbSNP
rs1190143544 1435 dbSNP
rs960615118 1450 dbSNP
rs1242004216 1466 dbSNP
rs970669302 1474 dbSNP
rs1201677851 1485 dbSNP
rs981921131 1491 dbSNP
rs751856387 1492 dbSNP
rs935065917 1496 dbSNP
rs1213829293 1502 dbSNP
rs1337232879 1504 dbSNP
rs1053950468 1508 dbSNP
rs1436101261 1519 dbSNP
rs914880994 1527 dbSNP
rs543506337 1530 dbSNP
rs1189457734 1534 dbSNP
rs754670641 1537 dbSNP
rs945109309 1539 dbSNP
rs1455018686 1543 dbSNP
rs1360298834 1544 dbSNP
rs1170385459 1546 dbSNP
rs1408531693 1551 dbSNP
rs556441061 1555 dbSNP
rs1475552789 1565 dbSNP
rs1043905064 1567 dbSNP
rs766083265 1570 dbSNP
rs932778783 1570 dbSNP
rs1181259909 1571 dbSNP
rs1237939594 1575 dbSNP
rs1415924783 1575 dbSNP
rs1203773688 1576 dbSNP
rs1049925474 1577 dbSNP
rs1229399678 1579 dbSNP
rs1276578748 1579 dbSNP
rs1359037946 1581 dbSNP
rs1312983831 1585 dbSNP
rs1159372610 1587 dbSNP
rs931643597 1593 dbSNP
rs186884887 1597 dbSNP
rs1050093922 1602 dbSNP
rs1298038369 1604 dbSNP
rs1399344244 1606 dbSNP
rs559722189 1608 dbSNP
rs111430637 1611 dbSNP
rs1384282034 1621 dbSNP
rs1376640393 1623 dbSNP
rs1425004051 1624 dbSNP
rs1413896224 1626 dbSNP
rs752283485 1628 dbSNP
rs1037019305 1629 dbSNP
rs1009133731 1637 dbSNP
rs1290971174 1638 dbSNP
rs1205665075 1640 dbSNP
rs191765833 1640 dbSNP
rs1490131447 1648 dbSNP
rs1289813491 1649 dbSNP
rs182485553 1653 dbSNP
rs1306461440 1654 dbSNP
rs1222561603 1655 dbSNP
rs1352908379 1660 dbSNP
rs545784853 1672 dbSNP
rs994891086 1675 dbSNP
rs1278603068 1684 dbSNP
rs185295528 1685 dbSNP
rs1201992007 1688 dbSNP
rs531667896 1692 dbSNP
rs958852534 1695 dbSNP
rs1012920271 1696 dbSNP
rs1279205091 1708 dbSNP
rs1157780134 1712 dbSNP
rs1002407132 1717 dbSNP
rs1033492956 1718 dbSNP
rs1024333459 1722 dbSNP
rs960584289 1722 dbSNP
rs1479949062 1728 dbSNP
rs550262404 1732 dbSNP
rs1266525450 1734 dbSNP
rs190105658 1743 dbSNP
rs1488969339 1745 dbSNP
rs1260188835 1746 dbSNP
rs1255578237 1747 dbSNP
rs529061716 1749 dbSNP
rs923773447 1750 dbSNP
rs966812519 1754 dbSNP
rs547644307 1764 dbSNP
rs989364915 1767 dbSNP
rs1363472787 1768 dbSNP
rs914974141 1768 dbSNP
rs571617169 1774 dbSNP
rs1491354422 1775 dbSNP
rs1491309921 1776 dbSNP
rs1455149905 1778 dbSNP
rs932434874 1783 dbSNP
rs1159736760 1786 dbSNP
rs1469278968 1787 dbSNP
rs1049891994 1792 dbSNP
rs1434717631 1797 dbSNP
rs912763184 1801 dbSNP
rs944252079 1806 dbSNP
rs1037328204 1810 dbSNP
rs1185034133 1817 dbSNP
rs897153762 1823 dbSNP
rs1371803504 1829 dbSNP
rs1248740638 1832 dbSNP
rs1391481043 1839 dbSNP
rs1327715735 1841 dbSNP
rs777392400 1842 dbSNP
rs1322079205 1843 dbSNP
rs1048392379 1844 dbSNP
rs905919565 1844 dbSNP
rs1307315230 1848 dbSNP
rs1001640670 1852 dbSNP
rs1294327659 1858 dbSNP
rs1303950965 1859 dbSNP
rs1320722387 1863 dbSNP
rs1451789723 1864 dbSNP
rs1050037289 1874 dbSNP
rs565970117 1875 dbSNP
rs960566386 1880 dbSNP
rs1484054592 1886 dbSNP
rs944937263 1887 dbSNP
rs1183116222 1888 dbSNP
rs1390829249 1888 dbSNP
rs1250059177 1893 dbSNP
rs1436351769 1901 dbSNP
rs1020793655 1908 dbSNP
rs966653367 1924 dbSNP
rs1253953056 1929 dbSNP
rs1480477701 1934 dbSNP
rs1454115307 1949 dbSNP
rs1172260243 1951 dbSNP
rs1225721836 1953 dbSNP
rs1037022949 1959 dbSNP
rs376695352 1960 dbSNP
rs1297670912 1965 dbSNP
rs148799216 1975 dbSNP
rs561024837 1976 dbSNP
rs531436094 1989 dbSNP
rs930798896 1991 dbSNP
rs1049268745 1993 dbSNP
rs551349057 2002 dbSNP
rs1431834671 2006 dbSNP
rs1371342782 2009 dbSNP
rs1163206661 2010 dbSNP
rs1393857111 2016 dbSNP
rs1388218780 2027 dbSNP
rs1188836682 2029 dbSNP
rs912733905 2035 dbSNP
rs1326173168 2036 dbSNP
rs1281249513 2039 dbSNP
rs569643102 2045 dbSNP
rs142478109 2047 dbSNP
rs1274864392 2057 dbSNP
rs1024281164 2061 dbSNP
rs1221291323 2071 dbSNP
rs1353579687 2074 dbSNP
rs972905066 2075 dbSNP
rs1245428021 2080 dbSNP
rs555460728 2081 dbSNP
rs1286401860 2086 dbSNP
rs1411382167 2088 dbSNP
rs1350886289 2089 dbSNP
rs1302719445 2090 dbSNP
rs549948757 2090 dbSNP
rs1299696775 2092 dbSNP
rs931603278 2093 dbSNP
rs1228232625 2094 dbSNP
rs546388343 2099 dbSNP
rs201695955 2102 dbSNP
rs1473085340 2104 dbSNP
rs386391451 2104 dbSNP
rs80225730 2104 dbSNP
rs34380358 2106 dbSNP
rs573683520 2106 dbSNP
rs1209860872 2110 dbSNP
rs1291367056 2110 dbSNP
rs895910786 2116 dbSNP
rs1274060520 2121 dbSNP
rs1468285411 2129 dbSNP
rs1230160659 2138 dbSNP
rs1329587724 2140 dbSNP
rs1003428667 2146 dbSNP
rs1282473358 2146 dbSNP
rs1013331028 2149 dbSNP
rs1333096965 2150 dbSNP
rs1192194282 2151 dbSNP
rs1031330180 2156 dbSNP
rs1381679993 2158 dbSNP
rs1386553516 2160 dbSNP
rs956691020 2165 dbSNP
rs902399395 2167 dbSNP
rs1191839402 2190 dbSNP
rs989703608 2194 dbSNP
rs1171237037 2196 dbSNP
rs1022157801 2199 dbSNP
rs1370776543 2200 dbSNP
rs1447572282 2202 dbSNP
rs953103980 2204 dbSNP
rs1459015872 2207 dbSNP
rs1199133504 2209 dbSNP
rs1464001158 2214 dbSNP
rs1245728513 2218 dbSNP
rs13430086 2219 dbSNP
rs1393329236 2220 dbSNP
rs1329819999 2222 dbSNP
rs953776039 2233 dbSNP
rs1217215008 2234 dbSNP
rs1346899297 2235 dbSNP
rs1275595947 2242 dbSNP
rs1227962633 2243 dbSNP
rs1363104620 2244 dbSNP
rs1322724952 2245 dbSNP
rs1459658880 2245 dbSNP
rs1322368380 2251 dbSNP
rs985200504 2254 dbSNP
rs1416450717 2261 dbSNP
rs774513213 2269 dbSNP
rs1381517426 2271 dbSNP
rs553988290 2272 dbSNP
rs1019341604 2275 dbSNP
rs911519721 2276 dbSNP
rs965127298 2276 dbSNP
rs972875570 2279 dbSNP
rs1207944554 2289 dbSNP
rs1464975693 2289 dbSNP
rs918777842 2292 dbSNP
rs1324707868 2298 dbSNP
rs1204701332 2299 dbSNP
rs1235245031 2300 dbSNP
rs1340359925 2302 dbSNP
rs1299896248 2303 dbSNP
rs1229177085 2304 dbSNP
rs1274006778 2304 dbSNP
rs944383066 2311 dbSNP
rs971789766 2313 dbSNP
rs1450886565 2314 dbSNP
rs776257125 2318 dbSNP
rs1212194142 2320 dbSNP
rs1368265197 2326 dbSNP
rs547664463 2326 dbSNP
rs1170128691 2329 dbSNP
rs1449470920 2331 dbSNP
rs1486400392 2339 dbSNP
rs927277055 2346 dbSNP
rs1180035513 2357 dbSNP
rs1448601167 2364 dbSNP
rs937307279 2365 dbSNP
rs1237810119 2366 dbSNP
rs1204245103 2374 dbSNP
rs1481965403 2376 dbSNP
rs572404402 2377 dbSNP
rs865980416 2378 dbSNP
rs1206149234 2380 dbSNP
rs1049679418 2386 dbSNP
rs1475884528 2388 dbSNP
rs894658366 2389 dbSNP
rs1230494148 2395 dbSNP
rs182110840 2399 dbSNP
rs1042600702 2402 dbSNP
rs1408346400 2403 dbSNP
rs1352719163 2406 dbSNP
rs902367736 2408 dbSNP
rs1001187743 2417 dbSNP
rs772380728 2433 dbSNP
rs1406998777 2434 dbSNP
rs889711058 2435 dbSNP
rs1045851525 2439 dbSNP
rs564102582 2448 dbSNP
rs1181365655 2449 dbSNP
rs1471452440 2453 dbSNP
rs1006522545 2458 dbSNP
rs1173899122 2458 dbSNP
rs999261744 2462 dbSNP
rs1245029610 2463 dbSNP
rs965097856 2472 dbSNP
rs1452814709 2473 dbSNP
rs1322437498 2475 dbSNP
rs1287002844 2478 dbSNP
rs187646612 2489 dbSNP
rs892364414 2494 dbSNP
rs1010837089 2496 dbSNP
rs111284072 2500 dbSNP
rs562194322 2503 dbSNP
rs1289445059 2509 dbSNP
rs1391583893 2510 dbSNP
rs375596352 2511 dbSNP
rs776763235 2514 dbSNP
rs759466543 2515 dbSNP
rs984701581 2515 dbSNP
rs529408081 2523 dbSNP
rs1309438414 2524 dbSNP
rs958963662 2524 dbSNP
rs992757477 2529 dbSNP
rs1159622497 2532 dbSNP
rs917276751 2532 dbSNP
rs985808572 2540 dbSNP
rs946116778 2541 dbSNP
rs1041844421 2544 dbSNP
rs1018640579 2545 dbSNP
rs1193143490 2549 dbSNP
rs965804228 2554 dbSNP
rs923761183 2557 dbSNP
rs139267363 2562 dbSNP
rs1054032137 2563 dbSNP
rs1171550800 2575 dbSNP
rs1466672577 2576 dbSNP
rs1269143459 2581 dbSNP
rs1486974637 2581 dbSNP
rs1310846993 2583 dbSNP
rs1298660535 2587 dbSNP
rs1210976194 2588 dbSNP
rs1220650176 2593 dbSNP
rs193237044 2594 dbSNP
rs889684518 2598 dbSNP
rs1256116591 2599 dbSNP
rs1319347316 2607 dbSNP
rs1484414219 2612 dbSNP
rs918958713 2614 dbSNP
rs1432779326 2615 dbSNP
rs930861099 2615 dbSNP
rs985077821 2616 dbSNP
rs1040722217 2633 dbSNP
rs149975112 2634 dbSNP
rs769823538 2640 dbSNP
rs566891847 2641 dbSNP
rs184000387 2642 dbSNP
rs948858569 2643 dbSNP
rs1156726536 2646 dbSNP
rs146584630 2648 dbSNP
rs1435338309 2655 dbSNP
rs537029395 2657 dbSNP
rs1249150370 2658 dbSNP
rs1200392499 2659 dbSNP
rs1482471185 2664 dbSNP
rs1312202716 2667 dbSNP
rs188627239 2668 dbSNP
rs764899132 2671 dbSNP
rs934791511 2672 dbSNP
rs1348210316 2674 dbSNP
rs1053503334 2677 dbSNP
rs1296443142 2677 dbSNP
rs893157328 2687 dbSNP
rs1300084547 2689 dbSNP
rs766815671 2692 dbSNP
rs1296137591 2696 dbSNP
rs191997961 2697 dbSNP
rs1223566596 2698 dbSNP
rs1043633938 2702 dbSNP
rs993063778 2703 dbSNP
rs889063992 2710 dbSNP
rs534461278 2721 dbSNP
rs1235587308 2731 dbSNP
rs1280272776 2733 dbSNP
rs967385135 2735 dbSNP
rs1383276351 2741 dbSNP
rs977834004 2746 dbSNP
rs1345073246 2748 dbSNP
rs1206053836 2750 dbSNP
rs1233074188 2752 dbSNP
rs1007342665 2753 dbSNP
rs1343664221 2754 dbSNP
rs1243938801 2755 dbSNP
rs926021412 2755 dbSNP
rs936102858 2757 dbSNP
rs774718967 2772 dbSNP
rs1175261143 2775 dbSNP
rs1053596827 2781 dbSNP
rs1415130625 2781 dbSNP
rs1306351469 2784 dbSNP
rs1431929135 2787 dbSNP
rs1018755572 2800 dbSNP
rs759777744 2803 dbSNP
rs1397260164 2814 dbSNP
rs1162788848 2818 dbSNP
rs911089301 2819 dbSNP
rs1254573366 2821 dbSNP
rs1370661870 2821 dbSNP
rs1472435490 2827 dbSNP
rs942577448 2834 dbSNP
rs966172384 2835 dbSNP
rs1250591111 2836 dbSNP
rs1439236235 2836 dbSNP
rs993273100 2839 dbSNP
rs1208679077 2840 dbSNP
rs1041025168 2848 dbSNP
rs1454559786 2854 dbSNP
rs900833056 2856 dbSNP
rs1323095103 2857 dbSNP
rs1172881077 2858 dbSNP
rs1233840115 2858 dbSNP
rs993808174 2858 dbSNP
rs555613428 2860 dbSNP
rs888172134 2865 dbSNP
rs1411871183 2875 dbSNP
rs1005739379 2877 dbSNP
rs1034461763 2878 dbSNP
rs17692648 2889 dbSNP
rs1172698883 2891 dbSNP
rs572317567 2891 dbSNP
rs1327148603 2907 dbSNP
rs1355333112 2907 dbSNP
rs1014450936 2919 dbSNP
rs1024477166 2927 dbSNP
rs1296684494 2929 dbSNP
rs1373589602 2931 dbSNP
rs1197734446 2933 dbSNP
rs1449320772 2936 dbSNP
rs967608068 2937 dbSNP
rs1254402889 2939 dbSNP
rs1214207708 2940 dbSNP
rs372746787 2951 dbSNP
rs539713927 2959 dbSNP
rs1266183272 2964 dbSNP
rs916164119 2980 dbSNP
rs1225195630 2981 dbSNP
rs1351175026 2982 dbSNP
rs1274436952 2983 dbSNP
rs1303269005 2983 dbSNP
rs1332875285 2984 dbSNP
rs1326740514 2985 dbSNP
rs1434994676 2986 dbSNP
rs1033440528 2997 dbSNP
rs970322337 3000 dbSNP
rs1323141897 3001 dbSNP
rs1401605847 3002 dbSNP
rs1401966549 3005 dbSNP
rs1171612361 3009 dbSNP
rs1369486192 3012 dbSNP
rs957465908 3018 dbSNP
rs1333113840 3019 dbSNP
rs1193654179 3024 dbSNP
rs543656199 3024 dbSNP
rs981594097 3025 dbSNP
rs1217893448 3027 dbSNP
rs755773884 3032 dbSNP
rs934720302 3033 dbSNP
rs1350396304 3034 dbSNP
rs1304459429 3036 dbSNP
rs1053213528 3039 dbSNP
rs1306416744 3040 dbSNP
rs1201933548 3041 dbSNP
rs914525030 3045 dbSNP
rs558405547 3047 dbSNP
rs184548635 3050 dbSNP
rs942546481 3055 dbSNP
rs976582882 3061 dbSNP
rs922488741 3064 dbSNP
rs1192827176 3069 dbSNP
rs1251047401 3070 dbSNP
rs1416535159 3070 dbSNP
rs1376828187 3071 dbSNP
rs1476390351 3072 dbSNP
rs1173915017 3073 dbSNP
rs1187044698 3073 dbSNP
rs1046712692 3074 dbSNP
rs1428488438 3074 dbSNP
rs200762261 3074 dbSNP
rs369508483 3074 dbSNP
rs888132978 3074 dbSNP
rs941117515 3077 dbSNP
rs1185067482 3078 dbSNP
rs1486531734 3079 dbSNP
rs1420248017 3080 dbSNP
rs1204729083 3081 dbSNP
rs151062078 3081 dbSNP
rs1275250247 3082 dbSNP
rs1356530701 3082 dbSNP
rs200393601 3082 dbSNP
rs397986183 3082 dbSNP
rs5835176 3082 dbSNP
rs1168747025 3083 dbSNP
rs1397014717 3086 dbSNP
rs796429720 3087 dbSNP
rs543788769 3088 dbSNP
rs555523525 3089 dbSNP
rs1392911173 3090 dbSNP
rs567870182 3091 dbSNP
rs574031189 3092 dbSNP
rs903406345 3093 dbSNP
rs1212324125 3095 dbSNP
rs1294721342 3097 dbSNP
rs1321232521 3098 dbSNP
rs1335143440 3098 dbSNP
rs1235731229 3099 dbSNP
rs1335873868 3099 dbSNP
rs201354372 3099 dbSNP
rs1288191257 3100 dbSNP
rs1227385170 3103 dbSNP
rs1370650705 3105 dbSNP
rs1299530541 3108 dbSNP
rs1212835163 3109 dbSNP
rs999543127 3112 dbSNP
rs1348816157 3118 dbSNP
rs1323781419 3122 dbSNP
rs1032999309 3126 dbSNP
rs957642576 3128 dbSNP
rs1158075403 3138 dbSNP
rs1471492418 3143 dbSNP
rs1448536536 3145 dbSNP
rs1178021495 3146 dbSNP
rs889011538 3152 dbSNP
rs1488186333 3157 dbSNP
rs1216352947 3163 dbSNP
rs1245098974 3183 dbSNP
rs1007457187 3187 dbSNP
rs1469352872 3188 dbSNP
rs1241480884 3190 dbSNP
rs1226871750 3194 dbSNP
rs1475110189 3195 dbSNP
rs1319137035 3204 dbSNP
rs1191653857 3209 dbSNP
rs1040154147 3213 dbSNP
rs1366246780 3218 dbSNP
rs1300707025 3225 dbSNP
rs1442989728 3225 dbSNP
rs986208536 3227 dbSNP
rs1319849056 3229 dbSNP
rs1451299091 3237 dbSNP
rs1346800274 3243 dbSNP
rs1160064954 3244 dbSNP
rs1432889862 3244 dbSNP
rs1475694358 3244 dbSNP
rs1164482534 3249 dbSNP
rs1423138532 3263 dbSNP
rs901695153 3269 dbSNP
rs993613258 3277 dbSNP
rs541546889 3278 dbSNP
rs1487040009 3280 dbSNP
rs1402828259 3290 dbSNP
rs1311305572 3303 dbSNP
rs1026070627 3304 dbSNP
rs1277759436 3305 dbSNP
rs763759235 3306 dbSNP
rs1005873677 3315 dbSNP
rs1345160428 3315 dbSNP
rs59216363 3322 dbSNP
rs1022667270 3327 dbSNP
rs114710451 3332 dbSNP
rs188578492 3341 dbSNP
rs1363814702 3344 dbSNP
rs563584038 3345 dbSNP
rs983143686 3346 dbSNP
rs956242785 3354 dbSNP
rs909541323 3362 dbSNP
rs1055389369 3385 dbSNP
rs1389682632 3386 dbSNP
rs1232241706 3388 dbSNP
rs1291084686 3389 dbSNP
rs989420776 3399 dbSNP
rs1181577459 3401 dbSNP
rs1277693180 3411 dbSNP
rs1352529686 3411 dbSNP
rs1212641152 3414 dbSNP
rs1347935433 3417 dbSNP
rs1273372289 3423 dbSNP
rs537201850 3424 dbSNP
rs914658204 3424 dbSNP
rs1224173262 3431 dbSNP
rs949818127 3443 dbSNP
rs1415666743 3448 dbSNP
rs1370020916 3449 dbSNP
rs1166283527 3457 dbSNP
rs1463598392 3459 dbSNP
rs1047081 3461 dbSNP
rs1374102170 3468 dbSNP
rs1164724108 3472 dbSNP
rs530754435 3487 dbSNP
rs947480441 3489 dbSNP
rs1445265639 3491 dbSNP
rs775524462 3491 dbSNP
rs1485828822 3506 dbSNP
rs985411294 3508 dbSNP
rs1193502988 3522 dbSNP
rs1481345991 3524 dbSNP
rs1251767795 3525 dbSNP
rs1244034954 3529 dbSNP
rs1045863608 3538 dbSNP
rs1294969808 3540 dbSNP
rs548962924 3545 dbSNP
rs911232518 3547 dbSNP
rs191842811 3548 dbSNP
rs1327103214 3549 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gugUUUAAGCCUAGAUGUCCCAu 5'
             ||| |:   |:|:|||||| 
Target 5' uuaAAACUUUCUUUUGCAGGGUa 3'
1 - 23
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000241416.7 | 3UTR | UUAAAACUUUCUUUUGCAGGGUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.527 4.9e-3 0.568 2.3e-3 23 Click to see details
GSE21687 Ependynoma primary tumors 0.319 5.1e-3 0.401 5.1e-4 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.53 8.1e-3 0.797 1.3e-5 20 Click to see details
GSE27834 Pluripotent stem cells 0.586 8.5e-3 0.524 1.9e-2 16 Click to see details
GSE21032 Prostate cancer 0.243 1.3e-2 0.257 9.5e-3 83 Click to see details
GSE21849 B cell lymphoma 0.408 1.4e-2 0.488 3.6e-3 29 Click to see details
GSE28260 Renal cortex and medulla -0.549 2.6e-2 -0.593 1.6e-2 13 Click to see details
GSE26953 Aortic valvular endothelial cells 0.4 2.6e-2 0.154 2.4e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.318 3.8e-2 0.371 1.8e-2 32 Click to see details
GSE19783 ER+ ER+ breast cancer -0.386 4.6e-2 -0.414 3.5e-2 20 Click to see details
GSE19536 Breast cancer -0.123 1.1e-1 -0.039 3.5e-1 100 Click to see details
GSE28544 Breast cancer 0.251 1.2e-1 0.248 1.2e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.366 1.2e-1 0.217 2.5e-1 12 Click to see details
GSE17306 Multiple myeloma 0.151 1.5e-1 0.159 1.4e-1 49 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.201 1.7e-1 0.131 2.7e-1 25 Click to see details
GSE17498 Multiple myeloma -0.151 1.8e-1 0.069 3.4e-1 40 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.363 1.9e-1 -0.286 2.5e-1 8 Click to see details
GSE14794 Lymphoblastoid cells 0.083 2.2e-1 0.076 2.4e-1 90 Click to see details
GSE19783 ER- ER- breast cancer -0.08 2.4e-1 0.049 3.3e-1 79 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.072 3.7e-1 0.142 2.5e-1 25 Click to see details
GSE38226 Liver fibrosis -0.04 4.3e-1 -0.100 3.3e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.337 0.01 -0.180 0.11 50 Click to see details
KIRC 0.223 0.03 0.164 0.09 68 Click to see details
ESCA -0.547 0.04 -0.500 0.06 11 Click to see details
LUAD 0.471 0.06 0.566 0.03 12 Click to see details
CESC -0.959 0.09 -1.000 0.5 3 Click to see details
BRCA -0.11 0.16 -0.023 0.42 84 Click to see details
STAD 0.174 0.17 0.213 0.12 32 Click to see details
LUSC 0.158 0.17 0.153 0.18 38 Click to see details
BLCA 0.221 0.19 0.207 0.2 18 Click to see details
KIRP 0.155 0.2 0.142 0.22 32 Click to see details
CHOL 0.303 0.21 0.500 0.09 9 Click to see details
UCEC -0.164 0.25 -0.156 0.26 19 Click to see details
COAD 0.266 0.26 0.452 0.13 8 Click to see details
PCPG 0.553 0.31 0.500 0.33 3 Click to see details
KICH -0.072 0.37 -0.040 0.42 25 Click to see details
LIHC -0.041 0.39 0.036 0.4 49 Click to see details
THCA -0.017 0.45 0.021 0.44 59 Click to see details
PAAD 0.042 0.48 0.600 0.2 4 Click to see details
HNSC -0.007 0.48 -0.007 0.48 42 Click to see details
HNSC -0.007 0.48 -0.007 0.48 42 Click to see details
HNSC -0.007 0.48 -0.007 0.48 42 Click to see details
449 hsa-miR-10a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001140 HOXA1 homeobox A1 4 3
MIRT003896 USF2 upstream transcription factor 2, c-fos interacting 4 1
MIRT005454 NCOR2 nuclear receptor corepressor 2 3 1
MIRT005509 MAP3K7 mitogen-activated protein kinase kinase kinase 7 5 1
MIRT005510 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 7 2
MIRT006536 SRSF1 serine and arginine rich splicing factor 1 1 1
MIRT006537 TRA2B transformer 2 beta homolog 3 3
MIRT006972 EPHA4 EPH receptor A4 4 2
MIRT007021 CHL1 cell adhesion molecule L1 like 1 1
MIRT025588 GPR63 G protein-coupled receptor 63 1 1
MIRT025589 BCL2L13 BCL2 like 13 1 1
MIRT025590 CREB5 cAMP responsive element binding protein 5 1 1
MIRT025591 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT025592 OMA1 OMA1 zinc metallopeptidase 1 1
MIRT025593 IER3IP1 immediate early response 3 interacting protein 1 1 1
MIRT025594 RBM17 RNA binding motif protein 17 1 1
MIRT025595 NR1D2 nuclear receptor subfamily 1 group D member 2 1 1
MIRT025596 BAMBI BMP and activin membrane bound inhibitor 1 1
MIRT025597 SNX4 sorting nexin 4 2 4
MIRT025598 SERBP1 SERPINE1 mRNA binding protein 1 1 2
MIRT025599 LHFPL4 LHFPL tetraspan subfamily member 4 1 1
MIRT025600 NOP16 NOP16 nucleolar protein 1 1
MIRT025601 AJUBA ajuba LIM protein 1 1
MIRT025602 MAPK8 mitogen-activated protein kinase 8 1 1
MIRT025603 ZBTB10 zinc finger and BTB domain containing 10 1 1
MIRT025604 TMEM101 transmembrane protein 101 2 4
MIRT025605 YES1 YES proto-oncogene 1, Src family tyrosine kinase 1 1
MIRT025606 DUSP3 dual specificity phosphatase 3 1 1
MIRT025607 PANX1 pannexin 1 1 1
MIRT025608 WEE1 WEE1 G2 checkpoint kinase 1 1
MIRT025609 TLE3 transducin like enhancer of split 3 1 1
MIRT025610 PDPK1 3-phosphoinositide dependent protein kinase 1 1 1
MIRT025611 CMPK1 cytidine/uridine monophosphate kinase 1 2 6
MIRT025612 NDUFB6 NADH:ubiquinone oxidoreductase subunit B6 1 1
MIRT025613 ARPC5 actin related protein 2/3 complex subunit 5 1 1
MIRT025614 PUM2 pumilio RNA binding family member 2 1 1
MIRT025615 GATAD2A GATA zinc finger domain containing 2A 1 1
MIRT025616 ACVR2A activin A receptor type 2A 2 2
MIRT025617 RBM12B RNA binding motif protein 12B 2 5
MIRT025618 THUMPD1 THUMP domain containing 1 1 2
MIRT025619 BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 1 1
MIRT025620 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT025621 XRN1 5'-3' exoribonuclease 1 1 1
MIRT025622 E2F7 E2F transcription factor 7 1 1
MIRT025623 LCA5 LCA5, lebercilin 1 1
MIRT025624 ELOVL2 ELOVL fatty acid elongase 2 1 1
MIRT025625 TFAP2C transcription factor AP-2 gamma 2 3
MIRT025626 TRIM2 tripartite motif containing 2 2 4
MIRT025627 HOXB3 homeobox B3 2 5
MIRT047505 FUS FUS RNA binding protein 1 1
MIRT047506 LMBR1L limb development membrane protein 1 like 1 1
MIRT047507 HSP90AA1 heat shock protein 90 alpha family class A member 1 1 1
MIRT047508 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 1 1
MIRT047509 EXTL3 exostosin like glycosyltransferase 3 1 1
MIRT047510 POLR2A RNA polymerase II subunit A 1 1
MIRT047511 RIOK2 RIO kinase 2 1 1
MIRT047512 C12orf76 chromosome 12 open reading frame 76 1 1
MIRT047513 CCDC151 coiled-coil domain containing 151 1 1
MIRT047514 FAT2 FAT atypical cadherin 2 1 1
MIRT047515 TPI1 triosephosphate isomerase 1 1 1
MIRT047516 BTAF1 B-TFIID TATA-box binding protein associated factor 1 1 1
MIRT047517 MSANTD1 Myb/SANT DNA binding domain containing 1 1 1
MIRT047518 PLA2G4A phospholipase A2 group IVA 1 1
MIRT047519 IGSF1 immunoglobulin superfamily member 1 1 1
MIRT047520 LEMD3 LEM domain containing 3 1 1
MIRT047521 E2F1 E2F transcription factor 1 1 1
MIRT047522 KIF3B kinesin family member 3B 1 1
MIRT047523 GBAS nipsnap homolog 2 1 1
MIRT047524 LIMA1 LIM domain and actin binding 1 1 1
MIRT047525 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT047526 MRC2 mannose receptor C type 2 1 1
MIRT047527 TMEM106B transmembrane protein 106B 1 1
MIRT047528 ZFP30 ZFP30 zinc finger protein 1 1
MIRT047529 AMPD1 adenosine monophosphate deaminase 1 1 1
MIRT047530 SLC2A3 solute carrier family 2 member 3 1 1
MIRT047531 RPL15 ribosomal protein L15 1 1
MIRT047532 AGER advanced glycosylation end-product specific receptor 1 1
MIRT047533 CNTLN centlein 1 1
MIRT047534 C21orf59 chromosome 21 open reading frame 59 1 1
MIRT047535 SEPT9 septin 9 1 1
MIRT047536 COL6A2 collagen type VI alpha 2 chain 1 1
MIRT047537 MLNR motilin receptor 1 1
MIRT047538 RTKN2 rhotekin 2 1 1
MIRT047539 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT047540 CSNK2A1 casein kinase 2 alpha 1 2 3
MIRT047541 AQP12B aquaporin 12B 1 1
MIRT047542 AGBL2 ATP/GTP binding protein like 2 1 1
MIRT047543 GOLGA8A golgin A8 family member A 1 1
MIRT047544 CPED1 cadherin like and PC-esterase domain containing 1 1 1
MIRT047545 HSPA8 heat shock protein family A (Hsp70) member 8 1 1
MIRT047546 SLC41A3 solute carrier family 41 member 3 1 1
MIRT047547 KXD1 KxDL motif containing 1 1 1
MIRT047548 RELN reelin 1 1
MIRT047549 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 1 1
MIRT047550 PTPRT protein tyrosine phosphatase, receptor type T 1 1
MIRT047551 ZC3H18 zinc finger CCCH-type containing 18 1 1
MIRT047552 CYP8B1 cytochrome P450 family 8 subfamily B member 1 1 1
MIRT047553 COL4A3 collagen type IV alpha 3 chain 1 1
MIRT047554 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT047555 MSL3 MSL complex subunit 3 1 1
MIRT047556 TTC7A tetratricopeptide repeat domain 7A 1 1
MIRT047557 COX7B cytochrome c oxidase subunit 7B 1 1
MIRT047558 ZNF318 zinc finger protein 318 1 1
MIRT047559 ACAA1 acetyl-CoA acyltransferase 1 1 1
MIRT047560 IPCEF1 interaction protein for cytohesin exchange factors 1 1 1
MIRT047561 SCAP SREBF chaperone 1 1
MIRT047562 KCTD11 potassium channel tetramerization domain containing 11 2 11
MIRT047563 RIOK3 RIO kinase 3 1 1
MIRT047564 C5 complement C5 1 1
MIRT047565 GLB1L3 galactosidase beta 1 like 3 1 1
MIRT047566 PAPD5 poly(A) RNA polymerase D5, non-canonical 1 1
MIRT047567 RNF123 ring finger protein 123 1 1
MIRT047568 ZNF629 zinc finger protein 629 1 1
MIRT047569 AMMECR1L AMMECR1 like 1 1
MIRT047570 KLHL6 kelch like family member 6 1 1
MIRT047571 SYMPK symplekin 1 1
MIRT047572 NCSTN nicastrin 1 1
MIRT047573 GALNT1 polypeptide N-acetylgalactosaminyltransferase 1 1 1
MIRT047574 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT047575 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 1
MIRT047576 RAB18 RAB18, member RAS oncogene family 1 1
MIRT047577 CUL3 cullin 3 1 1
MIRT047578 MTF2 metal response element binding transcription factor 2 1 1
MIRT047579 ORAI2 ORAI calcium release-activated calcium modulator 2 1 1
MIRT047580 NUP37 nucleoporin 37 1 1
MIRT047581 GPR98 adhesion G protein-coupled receptor V1 1 1
MIRT047582 RUNDC3B RUN domain containing 3B 1 1
MIRT047583 KIF21A kinesin family member 21A 1 1
MIRT047584 FEM1B fem-1 homolog B 1 1
MIRT047585 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT047586 PLA2G4F phospholipase A2 group IVF 1 1
MIRT047587 SNTB2 syntrophin beta 2 1 1
MIRT047588 NUB1 negative regulator of ubiquitin like proteins 1 1 1
MIRT047589 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase 1 1
MIRT047590 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT047591 C11orf63 chromosome 11 open reading frame 63 1 1
MIRT047592 ABCB7 ATP binding cassette subfamily B member 7 1 1
MIRT047593 CHRNA5 cholinergic receptor nicotinic alpha 5 subunit 1 1
MIRT047594 RPS9 ribosomal protein S9 1 1
MIRT047595 DDX42 DEAD-box helicase 42 1 1
MIRT047596 XPO7 exportin 7 1 1
MIRT047597 PYGL glycogen phosphorylase L 1 1
MIRT047598 TGFB3 transforming growth factor beta 3 1 1
MIRT047599 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT047600 PHB2 prohibitin 2 1 1
MIRT047601 ALDH1A2 aldehyde dehydrogenase 1 family member A2 1 1
MIRT047602 SLC3A2 solute carrier family 3 member 2 1 1
MIRT047603 POLR2H RNA polymerase II subunit H 1 1
MIRT047604 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT047605 MOB3C MOB kinase activator 3C 1 1
MIRT047606 MBD1 methyl-CpG binding domain protein 1 1 1
MIRT047607 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT047608 INTS2 integrator complex subunit 2 1 1
MIRT047609 MYEF2 myelin expression factor 2 1 1
MIRT047610 PANK2 pantothenate kinase 2 1 1
MIRT047611 EMB embigin 1 1
MIRT047612 HK1 hexokinase 1 1 1
MIRT047613 UBE2Z ubiquitin conjugating enzyme E2 Z 1 1
MIRT047614 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT047615 HOXA3 homeobox A3 1 1
MIRT047616 NT5DC1 5'-nucleotidase domain containing 1 1 1
MIRT047617 YOD1 YOD1 deubiquitinase 1 1
MIRT047618 APRT adenine phosphoribosyltransferase 1 1
MIRT047619 C2CD2 C2 calcium dependent domain containing 2 1 1
MIRT047620 SHBG sex hormone binding globulin 1 1
MIRT047621 PPP1R12A protein phosphatase 1 regulatory subunit 12A 1 1
MIRT047622 SCD stearoyl-CoA desaturase 1 1
MIRT047623 BCKDK branched chain ketoacid dehydrogenase kinase 1 1
MIRT047624 ETS1 ETS proto-oncogene 1, transcription factor 1 1
MIRT047625 GTF3C2 general transcription factor IIIC subunit 2 1 1
MIRT047626 NOP2 NOP2 nucleolar protein 1 1
MIRT047627 RPS29 ribosomal protein S29 1 1
MIRT047628 LAMC1 laminin subunit gamma 1 1 1
MIRT047629 GNAL G protein subunit alpha L 1 1
MIRT047630 KIAA1147 KIAA1147 1 1
MIRT047631 NACC2 NACC family member 2 1 1
MIRT047632 TMEM179B transmembrane protein 179B 1 1
MIRT047633 ARF3 ADP ribosylation factor 3 1 1
MIRT047634 MCPH1 microcephalin 1 1 1
MIRT047635 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT047636 UBN2 ubinuclein 2 1 1
MIRT047637 ANO6 anoctamin 6 1 1
MIRT047638 NEK7 NIMA related kinase 7 1 1
MIRT047639 EIF4H eukaryotic translation initiation factor 4H 1 1
MIRT047640 MED1 mediator complex subunit 1 1 1
MIRT047641 PTPRG protein tyrosine phosphatase, receptor type G 1 1
MIRT047642 ERMN ermin 1 1
MIRT047643 LYPD6 LY6/PLAUR domain containing 6 1 1
MIRT047644 SLC25A5 solute carrier family 25 member 5 1 1
MIRT047645 EPB41L2 erythrocyte membrane protein band 4.1 like 2 1 1
MIRT047646 ARFGEF1 ADP ribosylation factor guanine nucleotide exchange factor 1 1 1
MIRT047647 UBTF upstream binding transcription factor, RNA polymerase I 1 1
MIRT047648 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 1 1
MIRT047649 KLHL23 kelch like family member 23 1 1
MIRT047650 FGFR1 fibroblast growth factor receptor 1 1 1
MIRT047651 HOXD13 homeobox D13 1 1
MIRT047652 CHFR checkpoint with forkhead and ring finger domains 1 1
MIRT047653 ZNF592 zinc finger protein 592 1 1
MIRT047654 EIF1AD eukaryotic translation initiation factor 1A domain containing 1 1
MIRT047655 RRP1B ribosomal RNA processing 1B 1 1
MIRT047656 UHRF1 ubiquitin like with PHD and ring finger domains 1 1 1
MIRT047657 SORD sorbitol dehydrogenase 1 1
MIRT047658 PPM1G protein phosphatase, Mg2+/Mn2+ dependent 1G 1 1
MIRT047659 SF3B3 splicing factor 3b subunit 3 1 1
MIRT047660 PRPF8 pre-mRNA processing factor 8 1 1
MIRT047661 PRDX2 peroxiredoxin 2 1 1
MIRT047662 HNRNPF heterogeneous nuclear ribonucleoprotein F 1 1
MIRT047663 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT047664 CAB39L calcium binding protein 39 like 1 1
MIRT047665 ATP5F1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1 1 1
MIRT047666 PARL presenilin associated rhomboid like 1 1
MIRT047667 ERLIN1 ER lipid raft associated 1 1 1
MIRT047668 MARS methionyl-tRNA synthetase 1 1
MIRT047669 TRPM7 transient receptor potential cation channel subfamily M member 7 1 1
MIRT047670 DLG4 discs large MAGUK scaffold protein 4 1 1
MIRT047671 WDR74 WD repeat domain 74 1 1
MIRT047672 PWP1 PWP1 homolog, endonuclein 1 1
MIRT047673 RPRD1A regulation of nuclear pre-mRNA domain containing 1A 1 1
MIRT047674 NAP1L1 nucleosome assembly protein 1 like 1 1 1
MIRT047675 CTNND1 catenin delta 1 1 1
MIRT047676 IQCB1 IQ motif containing B1 1 1
MIRT047677 EIF1 eukaryotic translation initiation factor 1 1 1
MIRT047678 CDK19 cyclin dependent kinase 19 1 1
MIRT047679 LRP3 LDL receptor related protein 3 1 1
MIRT047680 UBE2D2 ubiquitin conjugating enzyme E2 D2 1 1
MIRT047681 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT047682 GORASP2 golgi reassembly stacking protein 2 1 1
MIRT047683 DDX54 DEAD-box helicase 54 1 1
MIRT047684 CARHSP1 calcium regulated heat stable protein 1 1 1
MIRT047685 FAM168A family with sequence similarity 168 member A 1 1
MIRT047686 SF3B4 splicing factor 3b subunit 4 1 1
MIRT047687 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 1 1
MIRT047688 PLEKHB2 pleckstrin homology domain containing B2 1 1
MIRT047689 LRFN1 leucine rich repeat and fibronectin type III domain containing 1 1 1
MIRT047690 KIAA0100 KIAA0100 1 1
MIRT047691 DVL1 dishevelled segment polarity protein 1 1 1
MIRT047692 NOMO1 NODAL modulator 1 1 1
MIRT047693 MIS12 MIS12, kinetochore complex component 1 1
MIRT047694 GLOD4 glyoxalase domain containing 4 1 1
MIRT047695 USP11 ubiquitin specific peptidase 11 1 1
MIRT047696 UBE3C ubiquitin protein ligase E3C 1 1
MIRT047697 NT5DC3 5'-nucleotidase domain containing 3 1 1
MIRT047698 SPARC secreted protein acidic and cysteine rich 1 1
MIRT047699 SLC26A2 solute carrier family 26 member 2 1 1
MIRT047700 MED12 mediator complex subunit 12 1 1
MIRT047701 FAM219B family with sequence similarity 219 member B 1 1
MIRT047702 GOSR2 golgi SNAP receptor complex member 2 1 1
MIRT047703 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT047704 PIAS3 protein inhibitor of activated STAT 3 1 1
MIRT047705 ASB1 ankyrin repeat and SOCS box containing 1 1 1
MIRT047706 COL4A2 collagen type IV alpha 2 chain 1 1
MIRT047707 NUP205 nucleoporin 205 1 1
MIRT047708 POLR3A RNA polymerase III subunit A 1 1
MIRT047709 ATG3 autophagy related 3 1 1
MIRT047710 COPA coatomer protein complex subunit alpha 1 1
MIRT047711 CD59 CD59 molecule (CD59 blood group) 1 1
MIRT047712 TENM3 teneurin transmembrane protein 3 1 1
MIRT047713 TUBA1A tubulin alpha 1a 1 1
MIRT047714 LSS lanosterol synthase 1 1
MIRT047715 FASN fatty acid synthase 4 1
MIRT047716 PSMD13 proteasome 26S subunit, non-ATPase 13 1 1
MIRT047717 ZNF618 zinc finger protein 618 1 1
MIRT047718 TSPAN33 tetraspanin 33 1 1
MIRT047719 KANK1 KN motif and ankyrin repeat domains 1 1 1
MIRT047720 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT047721 DPYSL2 dihydropyrimidinase like 2 1 1
MIRT047722 SUPT6H SPT6 homolog, histone chaperone 1 1
MIRT047723 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 1 1
MIRT047724 ACTG1 actin gamma 1 3 2
MIRT047725 PLSCR1 phospholipid scramblase 1 1 1
MIRT047726 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT047727 SFPQ splicing factor proline and glutamine rich 1 1
MIRT047728 VDAC1 voltage dependent anion channel 1 1 1
MIRT047729 ADCY9 adenylate cyclase 9 1 1
MIRT047730 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT047731 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 1 1
MIRT047732 SLC25A13 solute carrier family 25 member 13 1 1
MIRT047733 IGSF9B immunoglobulin superfamily member 9B 1 1
MIRT047734 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047735 MCU mitochondrial calcium uniporter 1 1
MIRT047736 CDK8 cyclin dependent kinase 8 1 1
MIRT047737 CEP128 centrosomal protein 128 1 1
MIRT047738 TRAPPC12 trafficking protein particle complex 12 1 1
MIRT047739 SYNJ1 synaptojanin 1 1 1
MIRT047740 NOB1 NIN1/PSMD8 binding protein 1 homolog 1 1
MIRT047741 AP5S1 adaptor related protein complex 5 sigma 1 subunit 1 1
MIRT047742 RNF213 ring finger protein 213 1 1
MIRT047743 PSMB1 proteasome subunit beta 1 1 1
MIRT047744 BCR BCR, RhoGEF and GTPase activating protein 1 1
MIRT047745 PABPC1 poly(A) binding protein cytoplasmic 1 1 1
MIRT047746 NPTX1 neuronal pentraxin 1 1 1
MIRT047747 PRRC2C proline rich coiled-coil 2C 1 1
MIRT047748 PABPC3 poly(A) binding protein cytoplasmic 3 1 1
MIRT047749 NF2 neurofibromin 2 1 1
MIRT047750 RALBP1 ralA binding protein 1 1 1
MIRT047751 EHD4 EH domain containing 4 1 1
MIRT047752 RLIM ring finger protein, LIM domain interacting 1 1
MIRT076413 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT084600 BCL2L11 BCL2 like 11 3 5
MIRT093335 RAPGEF2 Rap guanine nucleotide exchange factor 2 2 2
MIRT097757 ARSK arylsulfatase family member K 2 2
MIRT099597 ID4 inhibitor of DNA binding 4, HLH protein 2 6
MIRT249192 RAP2A RAP2A, member of RAS oncogene family 2 1
MIRT299201 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT437577 ZFAND5 zinc finger AN1-type containing 5 2 1
MIRT437578 CNST consortin, connexin sorting protein 2 1
MIRT437579 TIAM1 T-cell lymphoma invasion and metastasis 1 2 1
MIRT438258 PTEN phosphatase and tensin homolog 2 2
MIRT438408 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 3 1
MIRT448051 SFRP1 secreted frizzled related protein 1 2 2
MIRT459965 POC1A POC1 centriolar protein A 2 2
MIRT466175 TMED5 transmembrane p24 trafficking protein 5 2 2
MIRT470412 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT475883 H3F3C H3 histone family member 3C 2 10
MIRT475919 H3F3B H3 histone family member 3B 2 8
MIRT493173 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT497272 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT507101 GPCPD1 glycerophosphocholine phosphodiesterase 1 2 2
MIRT508100 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT508628 PLA2G2C phospholipase A2 group IIC 2 2
MIRT510735 SON SON DNA binding protein 2 6
MIRT513973 CNOT6 CCR4-NOT transcription complex subunit 6 2 2
MIRT514262 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT514577 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 4
MIRT515044 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515692 TFPI tissue factor pathway inhibitor 2 2
MIRT515752 ONECUT3 one cut homeobox 3 2 2
MIRT517389 METTL7A methyltransferase like 7A 2 2
MIRT519732 ZNF460 zinc finger protein 460 2 2
MIRT520247 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT520270 URGCP upregulator of cell proliferation 2 2
MIRT522213 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT523700 FHL2 four and a half LIM domains 2 2 4
MIRT523978 DVL3 dishevelled segment polarity protein 3 2 2
MIRT525569 MTRNR2L7 MT-RNR2-like 7 2 6
MIRT525619 MTRNR2L3 MT-RNR2-like 3 2 4
MIRT530223 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT530549 SYNPO synaptopodin 2 2
MIRT531041 ZNF502 zinc finger protein 502 2 2
MIRT532579 GSS glutathione synthetase 2 2
MIRT534840 RAB15 RAB15, member RAS oncogene family 2 2
MIRT535793 MTRNR2L11 MT-RNR2-like 11 2 6
MIRT535811 MTRNR2L10 MT-RNR2-like 10 2 4
MIRT536818 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT539894 IRGQ immunity related GTPase Q 2 2
MIRT540209 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT540951 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541937 ORC1 origin recognition complex subunit 1 2 4
MIRT542195 FUT1 fucosyltransferase 1 (H blood group) 2 6
MIRT542374 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542508 WDR13 WD repeat domain 13 2 2
MIRT542575 ZNF280B zinc finger protein 280B 2 2
MIRT542714 RPS15A ribosomal protein S15a 2 2
MIRT546705 RORA RAR related orphan receptor A 5 4
MIRT549929 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT550162 ZNF223 zinc finger protein 223 2 4
MIRT558566 CRLF3 cytokine receptor like factor 3 2 4
MIRT560945 TPM4 tropomyosin 4 2 4
MIRT574848 CADM1 cell adhesion molecule 1 2 2
MIRT575176 Atg9a autophagy related 9A 2 2
MIRT576664 Fam216a family with sequence similarity 216, member A 2 2
MIRT609434 MTX3 metaxin 3 2 2
MIRT612162 TCF15 transcription factor 15 2 2
MIRT617414 API5 apoptosis inhibitor 5 2 2
MIRT617469 CCS copper chaperone for superoxide dismutase 2 2
MIRT618780 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618835 PHF20 PHD finger protein 20 2 2
MIRT619339 RNF2 ring finger protein 2 2 2
MIRT625244 C6orf89 chromosome 6 open reading frame 89 2 2
MIRT626439 CHDH choline dehydrogenase 2 2
MIRT634929 CHMP1B charged multivesicular body protein 1B 2 2
MIRT635875 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636235 SLC24A4 solute carrier family 24 member 4 2 2
MIRT636641 CHAF1B chromatin assembly factor 1 subunit B 2 2
MIRT640545 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT648661 ALKBH4 alkB homolog 4, lysine demethylase 2 2
MIRT650186 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT650790 GSR glutathione-disulfide reductase 2 2
MIRT652027 TTYH3 tweety family member 3 2 2
MIRT652517 TMEM109 transmembrane protein 109 2 2
MIRT661940 MAVS mitochondrial antiviral signaling protein 2 2
MIRT661951 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT662020 ZNF445 zinc finger protein 445 2 2
MIRT664015 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT664059 KIAA1551 KIAA1551 2 2
MIRT666872 POU2F2 POU class 2 homeobox 2 2 2
MIRT669168 CCNG1 cyclin G1 2 2
MIRT673243 KLHDC8A kelch domain containing 8A 2 2
MIRT680410 SFT2D2 SFT2 domain containing 2 2 2
MIRT680484 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT683577 CARD8 caspase recruitment domain family member 8 2 2
MIRT684398 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT684558 ZNF708 zinc finger protein 708 2 2
MIRT685421 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT686050 SLC5A5 solute carrier family 5 member 5 2 2
MIRT687955 HHIP hedgehog interacting protein 2 2
MIRT688181 FRRS1 ferric chelate reductase 1 2 2
MIRT688303 FAM208A family with sequence similarity 208 member A 2 2
MIRT688900 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT689205 ZNF574 zinc finger protein 574 2 2
MIRT689917 ACOT13 acyl-CoA thioesterase 13 2 2
MIRT692931 EXOSC2 exosome component 2 2 2
MIRT693632 CENPL centromere protein L 2 2
MIRT694762 FZD2 frizzled class receptor 2 2 2
MIRT695373 PHAX phosphorylated adaptor for RNA export 2 2
MIRT696630 WDR77 WD repeat domain 77 2 2
MIRT696690 APOC3 apolipoprotein C3 2 2
MIRT697367 ZNF394 zinc finger protein 394 2 2
MIRT697611 XIAP X-linked inhibitor of apoptosis 2 2
MIRT697737 USP6NL USP6 N-terminal like 2 2
MIRT697788 UBXN7 UBX domain protein 7 2 2
MIRT698361 TMEM127 transmembrane protein 127 2 2
MIRT704519 CNKSR3 CNKSR family member 3 2 2
MIRT704600 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT705849 AHCY adenosylhomocysteinase 2 2
MIRT707093 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT707154 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT707243 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT707356 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT707459 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707503 AXL AXL receptor tyrosine kinase 2 2
MIRT707647 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT707703 FAM118A family with sequence similarity 118 member A 2 2
MIRT707714 CDC6 cell division cycle 6 2 2
MIRT707825 TMEM170A transmembrane protein 170A 2 2
MIRT707966 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT708006 NUDT4 nudix hydrolase 4 2 2
MIRT708035 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT708073 LIX1L limb and CNS expressed 1 like 2 2
MIRT708131 GK5 glycerol kinase 5 (putative) 2 2
MIRT708200 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT708210 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT708940 CRY2 cryptochrome circadian clock 2 2 2
MIRT709199 SAPCD2 suppressor APC domain containing 2 2 2
MIRT714403 FBXO31 F-box protein 31 2 2
MIRT714629 KIAA1143 KIAA1143 2 2
MIRT720741 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT720894 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT723335 DGAT1 diacylglycerol O-acyltransferase 1 2 2
MIRT724452 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT731180 SERPINE1 serpin family E member 1 3 1
MIRT732377 GP1BA glycoprotein Ib platelet alpha subunit 2 1
MIRT733585 SDC1 syndecan 1 3 0
MIRT734393 ARNTL aryl hydrocarbon receptor nuclear translocator like 3 0
MIRT735361 BDNF brain derived neurotrophic factor 4 0
MIRT735799 MAP2K6 mitogen-activated protein kinase kinase 6 3 0
MIRT735868 KRAS KRAS proto-oncogene, GTPase 1 0
MIRT736834 SKA1 spindle and kinetochore associated complex subunit 1 3 0
MIRT737248 LEF1-AS1 LEF1 antisense RNA 1 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-10a RAR-alpha antagonist Ro-41-5253 NULL NULL Northern blot pancreatic cancer 19747919 2009 down-regulated
miR-10a 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-10a Oxaliplatin (L-OHP) approved 5310940 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-10a Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells HT-29 cells 20955366 2011 down-regulated
miR-10a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Microarray acute myeloid leukemia (AML) cell line HL-60 21518431 2011 down-regulated
miR-10a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-10a All-trans-retinoic acid (ATRA) approved 444795 Quantitative real-time PCR regulatory T cells (T(reg) cells) 22544395 2012 up-regulated
miR-10a Glucocorticoid NULL NULL Quantitative real-time PCR Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-10a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-10a Ethanol NULL 702 Microarray fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Northern blot fetal mouse brains 19091803 2009 up-regulated
miR-10a Ethanol NULL 702 Quantitative real-time PCR fetal mouse brains 19091803 2009 up-regulated
miR-10a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-10a Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-10a Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 up-regualted
miR-10a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-10a-5p Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-10a-5p Comfrey NULL 6440495 Microarray rat liver 21370286 2011 down-regulated
miR-10a-5p Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-10a-5p Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-10a-5p Acarbose Approved 444254 Microarray diabetic rats cells 24260283 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-10a Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-10a Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-10a Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-10a Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-10a Tamoxifen 2733525 NSC180973 approved sensitive tissue (ER-positive breast cancer)
hsa-mir-10a Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-10a Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-10a Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-10a-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 resistant
hsa-miR-10a-5p (3aR)-7-[3-[4-[3-[[(3aR)-8-methoxy-10-oxo-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-7-yl]oxy]propyl]piperazin-1-yl]propoxy]-8-methoxy-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-10-one 24202913 NSC726262 resistant
hsa-miR-10a-5p (4z,6z)-4,6-dibenzylidene-2,2-dimethyl-1,3-dioxan-5-one 5387558 NSC624512 resistant
hsa-miR-10a-5p (5e)-5-benzylidene-3-(2,4,5-trichlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470506 NSC702355 resistant
hsa-miR-10a-5p (6e,7r,8r,8as)-8-methyl-6-[(2r)-2-methylhexylidene]-8-phenylmethoxy-1,2,3,5,7,8a-hexahydroindolizin-7-ol 5470307 NSC699382 resistant
hsa-miR-10a-5p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 resistant
hsa-miR-10a-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-[4-(diethylamino)phenyl]prop-2-en-1-one 5471159 NSC709103 resistant
hsa-miR-10a-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 resistant
hsa-miR-10a-5p (e)-2-methyl-1-[2-(2-methyl-1h-indol-3-yl)indolin-1-yl]but-2-en-1-one 5388204 NSC633484 resistant
hsa-miR-10a-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-(cyclohexanecarbonylamino)-3-cyclohexyl-2-hydroxypropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10 383477 NSC671869 resistant
hsa-miR-10a-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-10a-5p [(3s,8r,10r,13s,17e)-10,13-dimethyl-17-(phenylcarbamoyloxyimino)-1,2,3,4,7,8,9,11,12,14,15,16-dodecahydrocyclopenta[a]phenanthren-3-yl] n-phenylcarbamate 9569960 NSC629229 sensitive
hsa-miR-10a-5p [(7S,9E,11S,12R,13S,14R,15R,16R,17S,18S,19E,21Z)-26-[(E)-[(2,4-dinitrophenyl)hydrazinylidene]methyl]-2,15,17,27,29-pentahydroxy-11-methoxy-3,7,12,14,16,18,22-heptamethyl-6,23-dioxo-8,30-dioxa-24-azatetracyclo[23.3.1.14,7.05,28]triaconta-1(29),2,4,9,19,21, 135483937 NSC144126 resistant
hsa-miR-10a-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-cyano-4-(furan-2-yl)-2-oxo-6-phenylpyridin-1-yl]oxan-2-yl]methyl acetate 368873 NSC640212 resistant
hsa-miR-10a-5p [3,4,5-triacetyloxy-6-[3-phenyl-2,4-bis(sulfanylidene)quinazolin-1-yl]oxan-2-yl]methyl acetate 368629 NSC639741 resistant
hsa-miR-10a-5p [4-[[dimethyl(octadecyl)azaniumyl]methyl]phenyl]methyl-dimethyl-octadecylazanium;bromide 361976 NSC625458 resistant
hsa-miR-10a-5p [6-[(E)-(carbamothioylhydrazinylidene)methyl]pyridin-3-yl] acetate 9555726 NSC144055 resistant
hsa-miR-10a-5p 1-(dimethylamino)-4-methyl-4H-pyrido[3,4-g]quinoline-5,10-dione 388892 NSC684118 sensitive
hsa-miR-10a-5p 1-[(2S)-3-[[2,7-di(piperidin-1-yl)-2,3,4a,5,7,7a-hexahydrofuro[3,4-b][1,4]dioxin-3-yl]oxy]oxolan-2-yl]piperidine 253322 NSC76150 resistant
hsa-miR-10a-5p 1-[3-(3,4-dimethoxyphenyl)-2-(2,4-dinitrophenyl)-3,4-dihydropyrazol-5-yl]naphthalen-2-ol 390439 NSC687793 resistant
hsa-miR-10a-5p 1-[7-methyl-8-(3,4,5-trimethoxyphenyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]piperazine 384846 NSC675364 resistant
hsa-miR-10a-5p 10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2,4,6,8,11(19),12,14(18)-heptaene-15,17-dione 399629 NSC710546 sensitive
hsa-miR-10a-5p 1h-pyrimido[4,5-b]quinoline-2,4-dithione 5472868 NSC722222 resistant
hsa-miR-10a-5p 2-(11h-indolo[3,2-c]quinolin-6-ylamino)ethanol NSC736606 sensitive
hsa-miR-10a-5p 2-(2-chlorophenyl)-5,7-dihydroxy-8-(3-hydroxy-1-methylpiperidin-4-yl)chromen-4-one 5466794 NSC642740 resistant
hsa-miR-10a-5p 2-trans-n-buten-1-yl-estradiol 5468334 NSC669229 resistant
hsa-miR-10a-5p 2,5-diphenyl-1h-[1,2,4]triazino[4,3-a]quinoxaline 399102 NSC709518 resistant
hsa-miR-10a-5p 3-(((cyclohexylamino)carbonyl)oxy)-4-methyl-1,3-thiazole-2(3h)-thione 372703 NSC648263 resistant
hsa-miR-10a-5p 3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-phenyl-3,4-dihydropyrazole-2-carbaldehyde 155810020 NSC762559 resistant
hsa-miR-10a-5p 3,3,4,4,4-pentachloro-1-phenylbutan-1-one 405828 NSC723515 sensitive
hsa-miR-10a-5p 4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 374328 NSC651852 resistant
hsa-miR-10a-5p 4-appt 5995211 NSC195327 resistant
hsa-miR-10a-5p 4-methyl-3-[4-[2-[4-(4-methyl-5-sulfanylidene-1h-1,2,4-triazol-3-yl)phenyl]iminohydrazinyl]phenyl]-1h-1,2,4-triazole-5-thione 5472009 NSC715974 resistant
hsa-miR-10a-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 resistant
hsa-miR-10a-5p 5'-chloro-2'-methoxy-3-nitrosalicylanilide 186169 NSC79459 resistant
hsa-miR-10a-5p 5,6-dimethoxy-9-(methylthio)furo[3',4':4,5]cyclopenta[1,2,3-ij]isoquinoline 363754 NSC628946 resistant
hsa-miR-10a-5p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-10a-5p 6-(chloromethyl)-2-oxo-N-pentylchromene-3-carboxamide 402500 NSC716526 sensitive
hsa-miR-10a-5p 6-methoxy-1h-pyrazolo[3,4-b]quinoxalin-3-amine 395806 NSC700694 resistant
hsa-miR-10a-5p 6,7-diacetoxyisoflavan 353129 NSC600289 resistant
hsa-miR-10a-5p 8-[(4-tert-butylphenoxy)methyl]-1,3-dimethyl-7H-purine-2,6-dione 235292 NSC36525 resistant
hsa-miR-10a-5p 8455ab 1549990 NSC24189 resistant
hsa-miR-10a-5p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 resistant
hsa-miR-10a-5p Antibiotic p 168 5477807 NSC356885 resistant
hsa-miR-10a-5p Antineoplastic-656904 376224 NSC656904 resistant
hsa-miR-10a-5p Aquatris(1,3-diphenylpropane-1,3-dionato)neodymium(iii) 24202395 NSC647040 resistant
hsa-miR-10a-5p Bas100 monohydrate 45028404 NSC742554 resistant
hsa-miR-10a-5p Berberine iodide 72350 NSC150446 resistant
hsa-miR-10a-5p Bindschedler's green 73516 NSC7811 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-10a-5p C4, carbonyl, ethyl prodigiosine 135540855 NSC742416 resistant
hsa-miR-10a-5p Cgp 57380 11644425 NSC741567 sensitive
hsa-miR-10a-5p Cinerubin a hcl 5458466 NSC243022 sensitive
hsa-miR-10a-5p Cis-dichlorobis(4-methoxyphenethylamine)platinum(ii) 498558 NSC631305 resistant
hsa-miR-10a-5p Cis-difluorobis(1-phenylhexane-1,3-dionato)titanium(iv) NSC637220 resistant
hsa-miR-10a-5p Cyano-[4-[[[3-(trifluoromethyl)phenyl]methylamino]carbamoyl]pyridin-1-ium-1-yl]boron 6334922 NSC698276 resistant
hsa-miR-10a-5p Cytembena 23663958 NSC104801 resistant
hsa-miR-10a-5p Cytovaricin 5477715 NSC349622 resistant
hsa-miR-10a-5p Diethyl 2-[[4-[[[3-ethoxycarbonyl-7-(trifluoromethyl)quinoxalin-2-yl]amino]methyl]benzoyl]amino]pentanedioate 390810 NSC688812 resistant
hsa-miR-10a-5p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-10a-5p Echinomycin 3197 NSC526417 resistant
hsa-miR-10a-5p Ethyl 2-((4-(2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494007 NSC691084 resistant
hsa-miR-10a-5p Ethyl 2-((4-(6-bromo-2-methyl-4-oxo-3(4h)-quinazolinyl)phenyl)hydrazono)-3-oxobutanoate 135494008 NSC691085 resistant
hsa-miR-10a-5p Ethyl 5-amino-4-(3,4-dihydro-2h-1,5-benzodioxepin-7-ylamino)-2-methylsulfanylthieno[2,3-d]pyrimidine-6-carboxylate 399955 NSC711107 resistant
hsa-miR-10a-5p From combretum caffrum plant 5386397 NSC609397 resistant
hsa-miR-10a-5p Kuc100204 378309 NSC660313 resistant
hsa-miR-10a-5p Lddhtajmmdseme-okkqscsosa-n 6712634 NSC702655 sensitive
hsa-miR-10a-5p Ls-77867 395636 NSC700418 resistant
hsa-miR-10a-5p Methyl (1s,10r)-6-methyl-10-nonyl-7,9,12-triazatricyclo[6.3.1.04,12]dodeca-5,8-diene-5-carboxylate 401693 NSC715423 resistant
hsa-miR-10a-5p Methyl 3-butylsulfanyl-2-[[(e)-3-(6-methyl-2,4-dioxo-1h-pyrimidin-5-yl)prop-2-enoyl]amino]propanoate 5383838 NSC201241 resistant
hsa-miR-10a-5p Mggh 5351153 NSC32946 resistant
hsa-miR-10a-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 resistant
hsa-miR-10a-5p N-[3-bromo-6-oxo-1-(4-phenylpiperidin-1-yl)-4,5-dihydrocyclopenta[c]thiophen-4-yl]-2,2,2-trifluoroacetamide 378804 NSC662123 resistant
hsa-miR-10a-5p NSC657492 NSC657492 sensitive
hsa-miR-10a-5p NSC751830 NSC751830 sensitive
hsa-miR-10a-5p Plumericin 5281545 NSC112152 resistant
hsa-miR-10a-5p Propan-2-yl (1r,9s,12e)-3,4,6-trimethoxy-11-[(4-methoxyphenyl)methyl]-5-methyl-10-oxo-12-[(2,4,5-trimethoxy-3-methylphenyl)methylidene]-11,13-diazatricyclo[7.3.1.02,7]trideca-2(7),3,5-triene-13-carbox 6330789 NSC622075 resistant
hsa-miR-10a-5p Resorufin 69462 NSC12097 resistant
hsa-miR-10a-5p Rhamnazin 5320945 NSC678106 resistant
hsa-miR-10a-5p Roridin a, 8-hydroxy-9b,10b-epoxy- 5458716 NSC327993 resistant
hsa-miR-10a-5p Sb-236687 17892742 NSC756422 sensitive
hsa-miR-10a-5p Sergeolide,desacetyl 125729 NSC364170 resistant
hsa-miR-10a-5p Sodium;4-[[(5s,8ar)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[5,6-f][1,3]benzodioxol-5-yl]amino]benzoic acid 54612576 NSC651853 resistant
hsa-miR-10a-5p Tert-butyl n-[6-[2-[(2-amino-2-oxoethyl)carbamoyl]pyrrolidin-1-yl]-5-(9h-fluoren-9-ylmethoxycarbonylamino)-6-oxohexyl]carbamate 383818 NSC672434 sensitive
hsa-miR-10a-5p Tetra(isobutenyl)antimony bromide NSC651199 resistant
hsa-miR-10a-5p Tributylgermyl 2-acetoxy-2-phenyl-acetate 16683233 NSC645575 resistant
hsa-miR-10a-5p Verrucarin a 9,10-epoxide 5358836 NSC283445 sensitive
hsa-miR-10a-5p Z28714792 2671841 NSC746248 resistant
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-10a-5p Cyclopamine 442972 NSC734950 sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Esophageal Squamous Cell Carcinoma tissue and cell line (TE1, TE5, TE8, TE9, TE10, TE11, TE13)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PaCa-2)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Vinorelbine 44424639 approved resistant High Non-Small Cell Lung Cancer tissue
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-10a-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-10a-5p Cytarabine 6253 NSC287459 approved sensitive Low Acute Myeloid Leukemia tissue and cell line (KG-1a, Kasumi-1, K562, OCI-AML3)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant High Gastric Cancer cell line (SGC7901)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Doxorubicin 31703 NSC123127 approved resistant Low Acute Myeloid Leukemia tissue and cell line (HL-60)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (HepG2, Huh-7)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Small Cell Lung Cancer cell line (H446)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-10a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (U87)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-10a-5p Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-10a-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, H1299)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (W1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (TE1, KYSE450)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3ip1, HeyA8)
hsa-miR-10a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer tissue
hsa-miR-10a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-10a-5p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (A172)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-10a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (HS578T)
hsa-miR-10a-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-10a-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-10a-5p Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-10a-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-10a-5p Methotrexate 126941 NSC740 approved sensitive cell line (HT29)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-10a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-10a-5p Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-10a-5p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-10a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-10a-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-10a-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-10a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission