miRTarBase - #MIRT025970


—
pre-miRNA Information
pre-miRNA hsa-mir-148a   
Genomic Coordinates chr7: 25949919 - 25949986
Description Homo sapiens miR-148a stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-148a-3p
Sequence 44| UCAGUGCACUACAGAACUUUGU |65
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs772747528 2 dbSNP
rs1290582082 8 dbSNP
rs370090919 11 dbSNP
rs771952261 13 dbSNP
rs1249161151 16 dbSNP
rs748063984 19 dbSNP
rs774196394 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GPATCH8   
Synonyms GPATC8, KIAA0553
Description G-patch domain containing 8
Transcript NM_001002909   
Expression
Putative miRNA Targets on GPATCH8
3'UTR of GPATCH8
(miRNA target sites are highlighted)		 
>GPATCH8|NM_001002909|3'UTR
   1 GTTGGGGGATGGGATCCTAGGTAGGGCCAGGGGAGGAGACCCATAAATGTTCCCTTGGGGGTGTTGAGCCATTAATACCA
  81 GCAAGTAGAAGCTGGGATGGGCAGTGTCTGACAGCCAAAGAATTGAGTTTTGGCTTGCAGGGGTGGGTTTAGATTTGAAG
 161 TTTGCTTTCAGTTTACTATCAGGGATTTCTTTTTCCTGTCCTCCTCTCAATTTGTCCCTCCCTCTTCTGTGTTTCTAAGC
 241 TAGGGAACACCAGTAAGTGCTACCCACCCCTCTGCAGCAACATCTCCAAACTGTCAAGTTTAGATAATCCCCTCCTCCCT
 321 CTGCTTTTTTCCTCTGCTCTTCCCTTCTGTAAATTTTAAAACATTTTCCTCCCCTCTGGCCAGTGGGTTGTCACCAGAGC
 401 ACTTGCTGTGGGCCCATCTGGTCTTGCCTTCTCAGCGCCACAGGGAAGGCCAAGCTGTTCTAGTGGTGGAAGTGCCACCA
 481 TTTTGGGGTAGTATCTTTGACCATCTTTGGTGACGTTACGTTATCCCAGGTGAGGTGGAAAGCGTCTCACCTGGAACCTG
 561 ATATAACTCAGGCTGCAATTCCATCCAGTTCCCACATCAACGGAGCCACACATTTGGCACTGTTATCTTGGTATCCCTCA
 641 TCCCAGAAGAGGCATCTCCATATCCCAGAAAAGAAGATCCTATCATGAATAAAAGCTGTATGGCCCAGAGAGGAGCTCAT
 721 GTGTCTAAAGTGAAGGGTATATTTTCTTCTGTTGTGTTGATGTTTCCTTCTTAATTTATAGGATTTTTTTAATGTAAAAA
 801 ATTGCACTGAACTCTATAAACGTAAATGCTGCTTTTTGTAGCTCATATAAAAAAGGTTCCATATTTGTAGTATACTGCAA
 881 TAATATTTTTTACATCCAGCTCTTTAAGTGATCCTCGTTCTGGTGGCTTTGTGTAAATATGTTTGCCCTAGTTGAATTAA
 961 GAAACTCTAAAGGTTATAAAATGAAAACAAAAAATAAAATATTTGTTTTCTGCTAGATGCAAAACTGACTAAGCATGTAT
1041 ATTTTACCAAACTTATGTATTTTTTGAAGTTATGAACTATAAAATGTTAAAACATTTTTTGCTGGGACAAAATGTTAAGT
1121 AATTTGCAGTATGTAGTGCCCCCAGTATTGGGATTTTTGAGCTAATGGGCAGCAGTCAGCTGGGGGCTTCTGAGGGATGC
1201 TCATCTTTAACAGTCTCCCTCATGTACTTTTGCTGTTTTACACAGAGAAACAGGTAGACCCCACAGAGGAGAAGGAGGGG
1281 ATTCAACAGCTTTATTGTCTGGAAGCAGTGAGATTTGGTGATTGTCTGGGGGGATTCCTGGGTTTCCCTGGGTACCTTGT
1361 TCCAGGCAGTCAGTCCATTTGCCTTCCTAGTACTTAGCCCCCTCTGACAATTTTTTTTTTAATGTGCCTTTTGGGTTGGT
1441 AGAAACGGAAGTAGAAGTAGGCTGGAGGATGAGTTGGGACAGTCTTCCTTTTGTTGGGAGGTGAGCACATTTACAGATAT
1521 TTTGCTTCATAGTTTCCATGCCCTCTGCCCAGCTCAGTTTAGACAGTAAACGTTCCTTGTTTCTTTTCTCCCATGACACT
1601 GACAAGAGGAATTACCACCTCAGCCTCTTTTGCCCCTCTTCTTGCCTTTCACCCAGGCTCTCAGCCCTAATTAACACACT
1681 GACCCAAAGGTGCTTGTGTTGCAGGTCCCATCTCCTTTGATGAGGTTAACAATTCCCACTTTGGCATTTTCCTAACTATT
1761 CGTGTGGCTAGAATTGGTTGGTTGGTCACTTGACAAGAAAAACCATACTTACCTGGGCCAAGGCTCTGTTCCTGCCTTCG
1841 CAAATTCTCAAAAGAGTAAAGTTTATGAAAAGAAAGTGGCAGGCAAACACAACTCTTGACTGCCCTCCCACCCTCCTACC
1921 TGTTCAGTACTCATCTGATTCAGAAGCATCACTTCTTGGATAACTAGCACTGGAAAAATGAAATCATCTGTGTAAGTGAA
2001 GGGACTCATTTTTCTTTGCTTTCAGCCCATGTAAATAAATAATACAGTATTAACATTTTCGTGCTGCTTCCCATTAGCTT
2081 GTAGATTGAGCCATACTCTGGCTGCCTCTTTGCCTTCCTAGGGGCATTTTCTTTAACTTCCAGAATAGTGATTTTAAAAG
2161 TAAAAATAAAAATAAACCTTACTTACAAGCATAACAGATTGTATTTAACTTTATCACATATGATAGAGATATATATGCTG
2241 TAAAATGAGGGAAAGGAACTTTCTAATAAACCAATGATTTGTGGAAACTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugUUUCAAGACAUCACGUGACu 5'
            || ||     | ||||||| 
Target 5' ttAATGTAAAAAATTGCACTGa 3'
 789 - 810 144.00 -11.00
2 
miRNA  3' ugUUUCAAG------ACAUCACGUGACu 5'
            ||:||||      |||||| :|||| 
Target 5' aaAAGGTTCCATATTTGTAGTATACTGc 3'
 851 - 878 130.00 -15.90
3 
miRNA  3' uguuucaagacaucaCGUGACu 5'
                         |||||| 
Target 5' ggagccacacatttgGCACTGt 3'
 602 - 623 120.00 -9.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30448569 52 COSMIC
COSN30171871 105 COSMIC
COSN19658672 122 COSMIC
COSN30165209 125 COSMIC
COSN31507905 133 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs993326628 2 dbSNP
rs1395797854 6 dbSNP
rs762547138 8 dbSNP
rs1391505636 9 dbSNP
rs1467615794 11 dbSNP
rs1203092995 12 dbSNP
rs1165141003 13 dbSNP
rs867103452 14 dbSNP
rs775141892 21 dbSNP
rs1411795246 23 dbSNP
rs769229037 26 dbSNP
rs1473752335 29 dbSNP
rs200128147 31 dbSNP
rs1363693652 32 dbSNP
rs781177916 35 dbSNP
rs370530987 36 dbSNP
rs770824294 38 dbSNP
rs1434983818 41 dbSNP
rs369498242 43 dbSNP
rs1326480776 50 dbSNP
rs1267355137 52 dbSNP
rs569257493 53 dbSNP
rs758281471 57 dbSNP
rs530207828 58 dbSNP
rs561838924 60 dbSNP
rs748910017 62 dbSNP
rs779343082 64 dbSNP
rs1343848694 66 dbSNP
rs777431073 79 dbSNP
rs1388033844 80 dbSNP
rs1222344269 84 dbSNP
rs1008034749 86 dbSNP
rs1187890956 87 dbSNP
rs1459325581 95 dbSNP
rs914585691 98 dbSNP
rs755094128 103 dbSNP
rs1477485711 104 dbSNP
rs755892990 110 dbSNP
rs753911891 112 dbSNP
rs1463132059 113 dbSNP
rs766876139 114 dbSNP
rs1209253818 117 dbSNP
rs889136557 120 dbSNP
rs1454472286 128 dbSNP
rs1403844840 131 dbSNP
rs1336055463 138 dbSNP
rs1276227792 139 dbSNP
rs955972576 140 dbSNP
rs761043111 141 dbSNP
rs1386936029 142 dbSNP
rs750958709 143 dbSNP
rs1327181464 146 dbSNP
rs767815210 147 dbSNP
rs1390287557 148 dbSNP
rs762174859 153 dbSNP
rs1364513491 154 dbSNP
rs1321340789 157 dbSNP
rs971628239 160 dbSNP
rs1437901024 170 dbSNP
rs1404614850 173 dbSNP
rs1228654136 184 dbSNP
rs765260389 189 dbSNP
rs1156421532 198 dbSNP
rs1052164970 203 dbSNP
rs567097021 207 dbSNP
rs1012672645 208 dbSNP
rs1273795313 209 dbSNP
rs1489418781 211 dbSNP
rs1415337602 214 dbSNP
rs1427734868 217 dbSNP
rs1173921683 223 dbSNP
rs887491268 224 dbSNP
rs775123608 227 dbSNP
rs769494701 250 dbSNP
rs755532852 251 dbSNP
rs1472502093 252 dbSNP
rs1465872788 255 dbSNP
rs1241806075 256 dbSNP
rs78265957 262 dbSNP
rs1235598538 263 dbSNP
rs1209372458 264 dbSNP
rs550971153 265 dbSNP
rs192580684 267 dbSNP
rs1280526817 270 dbSNP
rs529039919 272 dbSNP
rs1293408574 275 dbSNP
rs1052674676 281 dbSNP
rs993145064 284 dbSNP
rs1409836002 287 dbSNP
rs1341799550 291 dbSNP
rs770507690 295 dbSNP
rs754278869 296 dbSNP
rs1227629205 299 dbSNP
rs1313119172 303 dbSNP
rs1323479464 304 dbSNP
rs1037682963 309 dbSNP
rs1377081356 309 dbSNP
rs1284083720 314 dbSNP
rs746862751 315 dbSNP
rs1264753169 319 dbSNP
rs1361239970 323 dbSNP
rs75756764 324 dbSNP
rs547168928 325 dbSNP
rs528704127 326 dbSNP
rs560253877 332 dbSNP
rs1189157314 344 dbSNP
rs1450748271 349 dbSNP
rs1416445213 359 dbSNP
rs545144890 363 dbSNP
rs1164701911 365 dbSNP
rs561561599 372 dbSNP
rs914638007 373 dbSNP
rs1473106927 374 dbSNP
rs1429895905 375 dbSNP
rs1238979648 380 dbSNP
rs915580703 382 dbSNP
rs1380355735 393 dbSNP
rs1314288783 394 dbSNP
rs1202836892 398 dbSNP
rs1482615099 399 dbSNP
rs1275543312 402 dbSNP
rs1207602972 407 dbSNP
rs1319953607 408 dbSNP
rs990130623 409 dbSNP
rs1408813683 411 dbSNP
rs1229363650 413 dbSNP
rs562535266 415 dbSNP
rs959693689 418 dbSNP
rs1409521629 427 dbSNP
rs1351520944 433 dbSNP
rs1308207964 434 dbSNP
rs188060173 436 dbSNP
rs760944572 437 dbSNP
rs971938344 443 dbSNP
rs1272547691 444 dbSNP
rs573927607 445 dbSNP
rs555380310 449 dbSNP
rs1482490980 451 dbSNP
rs1419872215 455 dbSNP
rs1181622069 457 dbSNP
rs779946357 460 dbSNP
rs1472121674 463 dbSNP
rs1249258991 466 dbSNP
rs1252302488 467 dbSNP
rs1451844408 471 dbSNP
rs773060282 487 dbSNP
rs1487652743 488 dbSNP
rs767294512 497 dbSNP
rs1016482958 498 dbSNP
rs1222322971 502 dbSNP
rs1323585193 504 dbSNP
rs1023228689 505 dbSNP
rs1266737496 509 dbSNP
rs1228341876 510 dbSNP
rs991292019 515 dbSNP
rs1290637019 519 dbSNP
rs1247475483 520 dbSNP
rs761495097 533 dbSNP
rs1392766707 535 dbSNP
rs768083579 536 dbSNP
rs1292599553 540 dbSNP
rs540000623 542 dbSNP
rs750965213 543 dbSNP
rs1396076582 544 dbSNP
rs1007650951 550 dbSNP
rs1456687443 553 dbSNP
rs774033168 557 dbSNP
rs1412398284 561 dbSNP
rs1027393300 563 dbSNP
rs572719339 564 dbSNP
rs764838408 572 dbSNP
rs759072706 573 dbSNP
rs1290765455 575 dbSNP
rs776369178 578 dbSNP
rs1489477447 586 dbSNP
rs372057729 587 dbSNP
rs1246316393 591 dbSNP
rs1030407376 600 dbSNP
rs1465796815 601 dbSNP
rs768025834 605 dbSNP
rs1018574950 610 dbSNP
rs885757 611 dbSNP
rs885758 612 dbSNP
rs1231445178 614 dbSNP
rs1311981261 621 dbSNP
rs1293410808 622 dbSNP
rs760296741 626 dbSNP
rs1426879590 628 dbSNP
rs1052705429 639 dbSNP
rs1372516075 640 dbSNP
rs749284246 642 dbSNP
rs1434276736 644 dbSNP
rs1402736478 646 dbSNP
rs1049905206 649 dbSNP
rs1389362965 658 dbSNP
rs1458560461 659 dbSNP
rs1290565289 661 dbSNP
rs932801118 662 dbSNP
rs1376878743 665 dbSNP
rs773009678 674 dbSNP
rs1455774935 687 dbSNP
rs1388391705 695 dbSNP
rs893247991 698 dbSNP
rs775282622 700 dbSNP
rs1218883792 703 dbSNP
rs769685097 705 dbSNP
rs768034898 713 dbSNP
rs879921893 719 dbSNP
rs1483103261 721 dbSNP
rs1257008659 723 dbSNP
rs948245694 725 dbSNP
rs1349684696 727 dbSNP
rs772184433 734 dbSNP
rs1226954266 735 dbSNP
rs747917493 737 dbSNP
rs184802403 739 dbSNP
rs992579603 741 dbSNP
rs1473485940 746 dbSNP
rs1401196657 759 dbSNP
rs1303276508 760 dbSNP
rs1201788395 766 dbSNP
rs1436798864 770 dbSNP
rs1405855352 772 dbSNP
rs1489930076 773 dbSNP
rs915807351 781 dbSNP
rs991349566 790 dbSNP
rs1348236126 791 dbSNP
rs755179686 791 dbSNP
rs1366725600 792 dbSNP
rs1168201236 797 dbSNP
rs1205584338 801 dbSNP
rs1450123064 802 dbSNP
rs751926618 804 dbSNP
rs1374887783 805 dbSNP
rs1435764508 809 dbSNP
rs764413825 812 dbSNP
rs1423790130 813 dbSNP
rs1352549261 816 dbSNP
rs768592358 821 dbSNP
rs749410501 822 dbSNP
rs971969376 826 dbSNP
rs1271989118 834 dbSNP
rs963231086 838 dbSNP
rs1357438923 840 dbSNP
rs1204029351 845 dbSNP
rs536960858 846 dbSNP
rs1342224240 854 dbSNP
rs145310816 856 dbSNP
rs1242507420 860 dbSNP
rs533958974 873 dbSNP
rs986403161 877 dbSNP
rs1313357537 883 dbSNP
rs1416320291 886 dbSNP
rs567921280 893 dbSNP
rs756147407 896 dbSNP
rs372813786 898 dbSNP
rs746021383 914 dbSNP
rs557366304 915 dbSNP
rs535483665 916 dbSNP
rs192968633 917 dbSNP
rs1410788080 918 dbSNP
rs1457833352 920 dbSNP
rs546340018 921 dbSNP
rs1369494639 922 dbSNP
rs1167744928 926 dbSNP
rs1008542743 937 dbSNP
rs955839975 939 dbSNP
rs1028516522 940 dbSNP
rs1251608591 940 dbSNP
rs148844931 941 dbSNP
rs1438111857 950 dbSNP
rs528669072 952 dbSNP
rs1252027387 956 dbSNP
rs1207489940 959 dbSNP
rs779099307 960 dbSNP
rs1355042863 962 dbSNP
rs187337402 964 dbSNP
rs1235086664 965 dbSNP
rs752093968 966 dbSNP
rs374419419 973 dbSNP
rs757841956 973 dbSNP
rs1343614293 982 dbSNP
rs1287538291 983 dbSNP
rs1410666529 994 dbSNP
rs1202624253 995 dbSNP
rs548169366 995 dbSNP
rs1178707834 1002 dbSNP
rs764394790 1002 dbSNP
rs1337815723 1004 dbSNP
rs1321846422 1005 dbSNP
rs1235731462 1022 dbSNP
rs780225432 1031 dbSNP
rs999351878 1031 dbSNP
rs1386218282 1033 dbSNP
rs1030971914 1037 dbSNP
rs1001117245 1041 dbSNP
rs950067814 1043 dbSNP
rs904142744 1047 dbSNP
rs1416585782 1048 dbSNP
rs915864890 1053 dbSNP
rs1436489773 1055 dbSNP
rs778019612 1055 dbSNP
rs371861723 1056 dbSNP
rs1045314907 1057 dbSNP
rs1160441702 1069 dbSNP
rs1183253459 1070 dbSNP
rs753425838 1072 dbSNP
rs1055718293 1073 dbSNP
rs930508774 1076 dbSNP
rs1196340963 1078 dbSNP
rs1012861050 1079 dbSNP
rs920436082 1086 dbSNP
rs1248170242 1087 dbSNP
rs896635917 1088 dbSNP
rs766113266 1092 dbSNP
rs971896011 1093 dbSNP
rs1253144219 1094 dbSNP
rs756549462 1101 dbSNP
rs183442963 1102 dbSNP
rs772885894 1105 dbSNP
rs754437748 1106 dbSNP
rs1378464563 1110 dbSNP
rs1352580266 1122 dbSNP
rs938405670 1123 dbSNP
rs1273262169 1125 dbSNP
rs1232869427 1132 dbSNP
rs766783789 1133 dbSNP
rs767163653 1137 dbSNP
rs1458036868 1138 dbSNP
rs1035947712 1141 dbSNP
rs1323157240 1144 dbSNP
rs941698323 1145 dbSNP
rs1387076723 1146 dbSNP
rs1380095956 1150 dbSNP
rs1330801043 1159 dbSNP
rs1388468940 1161 dbSNP
rs909149541 1162 dbSNP
rs1331132038 1164 dbSNP
rs371782273 1166 dbSNP
rs1288580931 1173 dbSNP
rs986046058 1184 dbSNP
rs1240813969 1187 dbSNP
rs1337842627 1189 dbSNP
rs1402759238 1193 dbSNP
rs533086533 1194 dbSNP
rs1170426056 1196 dbSNP
rs1322571967 1199 dbSNP
rs997056225 1201 dbSNP
rs1403507416 1202 dbSNP
rs774440476 1222 dbSNP
rs562338757 1223 dbSNP
rs749176137 1226 dbSNP
rs544150537 1227 dbSNP
rs1447147867 1233 dbSNP
rs1247269455 1238 dbSNP
rs957582511 1249 dbSNP
rs956733992 1256 dbSNP
rs1216451999 1261 dbSNP
rs1428790439 1263 dbSNP
rs756590008 1265 dbSNP
rs903290384 1270 dbSNP
rs1410451764 1271 dbSNP
rs1276290597 1272 dbSNP
rs1453647576 1275 dbSNP
rs1200086844 1288 dbSNP
rs192512074 1297 dbSNP
rs1000903815 1298 dbSNP
rs1305912251 1304 dbSNP
rs561617530 1305 dbSNP
rs1045808792 1306 dbSNP
rs1226184318 1307 dbSNP
rs968066195 1312 dbSNP
rs775566598 1315 dbSNP
rs1024332772 1318 dbSNP
rs770107270 1319 dbSNP
rs1357757182 1322 dbSNP
rs540159966 1324 dbSNP
rs1387945052 1325 dbSNP
rs572680991 1326 dbSNP
rs1344467674 1327 dbSNP
rs1014710989 1328 dbSNP
rs766113388 1329 dbSNP
rs1375615824 1330 dbSNP
rs1314856332 1332 dbSNP
rs557567368 1333 dbSNP
rs1265890980 1334 dbSNP
rs1455546681 1334 dbSNP
rs757352480 1341 dbSNP
rs1389038351 1349 dbSNP
rs930561086 1351 dbSNP
rs540302167 1362 dbSNP
rs1235505159 1367 dbSNP
rs896661278 1368 dbSNP
rs1184848363 1373 dbSNP
rs1056523641 1390 dbSNP
rs1418794896 1394 dbSNP
rs758554667 1394 dbSNP
rs1485878845 1399 dbSNP
rs1282688018 1401 dbSNP
rs1203306101 1402 dbSNP
rs1244858062 1403 dbSNP
rs1341517253 1403 dbSNP
rs1273855347 1408 dbSNP
rs1216826095 1410 dbSNP
rs1377704197 1411 dbSNP
rs940524940 1413 dbSNP
rs1364622927 1420 dbSNP
rs1370919506 1421 dbSNP
rs750617614 1421 dbSNP
rs765540121 1421 dbSNP
rs1284140406 1422 dbSNP
rs1390550655 1423 dbSNP
rs1415714164 1424 dbSNP
rs1357796155 1426 dbSNP
rs1314282427 1427 dbSNP
rs112724419 1434 dbSNP
rs931692459 1435 dbSNP
rs1353408088 1438 dbSNP
rs778317561 1446 dbSNP
rs1002581559 1447 dbSNP
rs749942391 1449 dbSNP
rs1231336490 1461 dbSNP
rs758674790 1466 dbSNP
rs1480543645 1470 dbSNP
rs989076933 1477 dbSNP
rs1411450613 1494 dbSNP
rs957636312 1500 dbSNP
rs897619589 1509 dbSNP
rs753154316 1510 dbSNP
rs187567430 1513 dbSNP
rs1180253601 1514 dbSNP
rs779541210 1519 dbSNP
rs537489505 1520 dbSNP
rs755748909 1531 dbSNP
rs1470316900 1536 dbSNP
rs1206643587 1539 dbSNP
rs1320008812 1541 dbSNP
rs1289746891 1546 dbSNP
rs1234468408 1547 dbSNP
rs941723019 1554 dbSNP
rs1337383957 1556 dbSNP
rs1286915867 1564 dbSNP
rs1314244838 1565 dbSNP
rs1407598030 1566 dbSNP
rs1372083416 1571 dbSNP
rs1366037113 1572 dbSNP
rs908852611 1576 dbSNP
rs967569385 1578 dbSNP
rs1050783708 1579 dbSNP
rs1024855829 1580 dbSNP
rs1211318596 1587 dbSNP
rs750824617 1590 dbSNP
rs145537920 1591 dbSNP
rs1460225360 1594 dbSNP
rs1298395642 1598 dbSNP
rs762215401 1606 dbSNP
rs894536010 1606 dbSNP
rs750119243 1608 dbSNP
rs767957402 1616 dbSNP
rs866093714 1618 dbSNP
rs1325111873 1619 dbSNP
rs1461929918 1623 dbSNP
rs767075918 1625 dbSNP
rs1419758723 1626 dbSNP
rs923099435 1628 dbSNP
rs1034370883 1632 dbSNP
rs1156757404 1633 dbSNP
rs761409961 1635 dbSNP
rs1408903426 1636 dbSNP
rs1417000554 1644 dbSNP
rs751540757 1649 dbSNP
rs1176274094 1650 dbSNP
rs1360716221 1650 dbSNP
rs1487520782 1655 dbSNP
rs557182307 1657 dbSNP
rs535806687 1660 dbSNP
rs1268466535 1663 dbSNP
rs899112577 1668 dbSNP
rs1266793070 1669 dbSNP
rs762636968 1674 dbSNP
rs761603593 1676 dbSNP
rs1307202652 1680 dbSNP
rs940556914 1684 dbSNP
rs1364835554 1686 dbSNP
rs1203422864 1689 dbSNP
rs1302144993 1690 dbSNP
rs1441528712 1692 dbSNP
rs1396524206 1693 dbSNP
rs769507905 1700 dbSNP
rs924053658 1703 dbSNP
rs1345593689 1705 dbSNP
rs112471632 1710 dbSNP
rs1051998568 1713 dbSNP
rs1431703847 1714 dbSNP
rs1394541978 1715 dbSNP
rs1194273966 1724 dbSNP
rs931744985 1725 dbSNP
rs968472816 1732 dbSNP
rs553678621 1736 dbSNP
rs1246680537 1742 dbSNP
rs1412678032 1744 dbSNP
rs1458770902 1745 dbSNP
rs1208673841 1752 dbSNP
rs1486384869 1754 dbSNP
rs1344687954 1757 dbSNP
rs1437215812 1758 dbSNP
rs770993057 1762 dbSNP
rs368133857 1764 dbSNP
rs1217489182 1770 dbSNP
rs1343872506 1780 dbSNP
rs1310136704 1782 dbSNP
rs1279180432 1786 dbSNP
rs1234298725 1787 dbSNP
rs1443937425 1788 dbSNP
rs796643443 1790 dbSNP
rs1295254926 1794 dbSNP
rs1381632029 1797 dbSNP
rs1289353325 1800 dbSNP
rs1331612328 1804 dbSNP
rs747147869 1810 dbSNP
rs1290484907 1812 dbSNP
rs1284103275 1815 dbSNP
rs936327876 1819 dbSNP
rs568923129 1820 dbSNP
rs1464367589 1831 dbSNP
rs1375002186 1832 dbSNP
rs1221657387 1836 dbSNP
rs1174526695 1839 dbSNP
rs551890058 1840 dbSNP
rs1388451587 1843 dbSNP
rs1432806805 1850 dbSNP
rs1193060568 1851 dbSNP
rs1470998978 1854 dbSNP
rs1429694348 1855 dbSNP
rs1260607971 1859 dbSNP
rs1156753401 1861 dbSNP
rs1264285685 1861 dbSNP
rs1407151368 1861 dbSNP
rs1180424480 1865 dbSNP
rs960951132 1868 dbSNP
rs1035232877 1869 dbSNP
rs1406097563 1871 dbSNP
rs1485552487 1874 dbSNP
rs1279115337 1875 dbSNP
rs1360546302 1877 dbSNP
rs1364003736 1879 dbSNP
rs1211189188 1882 dbSNP
rs535371881 1888 dbSNP
rs754382178 1892 dbSNP
rs1349396000 1900 dbSNP
rs926238185 1902 dbSNP
rs977705500 1903 dbSNP
rs1244375004 1905 dbSNP
rs1226604022 1907 dbSNP
rs182637174 1918 dbSNP
rs968001165 1920 dbSNP
rs1024491189 1924 dbSNP
rs775489270 1925 dbSNP
rs1014644523 1926 dbSNP
rs1307943441 1927 dbSNP
rs778119729 1932 dbSNP
rs1394023482 1936 dbSNP
rs1354601953 1938 dbSNP
rs1313688496 1941 dbSNP
rs1416898999 1947 dbSNP
rs1005939946 1948 dbSNP
rs1221278844 1950 dbSNP
rs1018357 1955 dbSNP
rs1439406638 1957 dbSNP
rs1359387190 1964 dbSNP
rs1368782062 1969 dbSNP
rs552848418 1972 dbSNP
rs14977 1976 dbSNP
rs958803884 1992 dbSNP
rs772673963 1995 dbSNP
rs1163329961 2001 dbSNP
rs1034423247 2002 dbSNP
rs1383504387 2003 dbSNP
rs1258720910 2005 dbSNP
rs1424023268 2006 dbSNP
rs1169481672 2008 dbSNP
rs1188188777 2013 dbSNP
rs1486487842 2016 dbSNP
rs1247792531 2017 dbSNP
rs764576709 2018 dbSNP
rs765355306 2028 dbSNP
rs774112681 2030 dbSNP
rs748630793 2039 dbSNP
rs1405793549 2040 dbSNP
rs759100375 2043 dbSNP
rs1450852066 2044 dbSNP
rs887447847 2046 dbSNP
rs763725094 2055 dbSNP
rs755308375 2059 dbSNP
rs762353311 2060 dbSNP
rs140718505 2061 dbSNP
rs568895402 2064 dbSNP
rs1292273659 2067 dbSNP
rs901790366 2079 dbSNP
rs1423824046 2090 dbSNP
rs756816661 2093 dbSNP
rs1167627775 2100 dbSNP
rs769620858 2117 dbSNP
rs1193910825 2125 dbSNP
rs1471815801 2127 dbSNP
rs1015298060 2135 dbSNP
rs1040303542 2145 dbSNP
rs1180670679 2147 dbSNP
rs1437880568 2151 dbSNP
rs1004808695 2156 dbSNP
rs1442749905 2156 dbSNP
rs935177722 2160 dbSNP
rs1444148749 2166 dbSNP
rs1211737090 2167 dbSNP
rs1390678525 2172 dbSNP
rs745765168 2175 dbSNP
rs1375050772 2177 dbSNP
rs751168416 2177 dbSNP
rs1273751772 2179 dbSNP
rs773861720 2187 dbSNP
rs1167513288 2189 dbSNP
rs979527502 2191 dbSNP
rs1215262249 2197 dbSNP
rs532156150 2199 dbSNP
rs946788544 2204 dbSNP
rs1240091094 2209 dbSNP
rs1337583645 2214 dbSNP
rs1299375166 2219 dbSNP
rs1372017592 2220 dbSNP
rs900289576 2221 dbSNP
rs763911152 2225 dbSNP
rs1053465158 2227 dbSNP
rs1328552235 2228 dbSNP
rs1224827548 2230 dbSNP
rs936386541 2231 dbSNP
rs923639440 2232 dbSNP
rs1384756064 2233 dbSNP
rs1225104896 2235 dbSNP
rs776432226 2236 dbSNP
rs1157596360 2237 dbSNP
rs1042418692 2242 dbSNP
rs916572559 2247 dbSNP
rs990876004 2255 dbSNP
rs1263981849 2256 dbSNP
rs1365014378 2260 dbSNP
rs946339676 2262 dbSNP
rs1220685579 2266 dbSNP
rs1191143701 2272 dbSNP
rs917473717 2274 dbSNP
rs960983322 2288 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.559 5.2e-3 0.686 4.2e-4 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.422 3.2e-2 -0.256 1.4e-1 20 Click to see details
GSE28260 Renal cortex and medulla -0.495 4.3e-2 -0.489 4.5e-2 13 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.596 4.5e-2 0.400 1.4e-1 9 Click to see details
GSE19783 ER- ER- breast cancer -0.181 5.5e-2 -0.154 8.8e-2 79 Click to see details
GSE14794 Lymphoblastoid cells -0.155 7.2e-2 -0.179 4.6e-2 90 Click to see details
GSE19536 Breast cancer -0.132 9.5e-2 -0.120 1.2e-1 100 Click to see details
GSE19350 CNS germ cell tumors -0.395 1.0e-1 -0.247 2.2e-1 12 Click to see details
GSE32688 Pancreatic cancer -0.211 1.2e-1 -0.363 2.1e-2 32 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.236 1.3e-1 0.218 1.5e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.284 1.4e-1 0.253 1.7e-1 16 Click to see details
GSE38226 Liver fibrosis -0.238 1.5e-1 0.011 4.8e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.211 1.6e-1 0.165 2.2e-1 25 Click to see details
GSE21687 Ependynoma primary tumors 0.121 1.7e-1 0.092 2.3e-1 64 Click to see details
GSE28544 Breast cancer -0.158 2.3e-1 -0.024 4.6e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.138 2.6e-1 -0.170 2.1e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.108 3.1e-1 0.085 3.5e-1 23 Click to see details
GSE21849 B cell lymphoma 0.075 3.5e-1 0.181 1.7e-1 29 Click to see details
GSE21032 Prostate cancer -0.023 4.2e-1 -0.087 2.2e-1 83 Click to see details
GSE17498 Multiple myeloma -0.029 4.3e-1 -0.005 4.9e-1 40 Click to see details
GSE17306 Multiple myeloma 0.02 4.5e-1 -0.082 2.9e-1 49 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP -0.546 0 -0.545 0 32 Click to see details
STAD -0.491 0 -0.614 0 32 Click to see details
CHOL 0.708 0.02 0.767 0.01 9 Click to see details
LIHC -0.27 0.03 -0.072 0.31 49 Click to see details
LUAD -0.551 0.03 -0.497 0.05 12 Click to see details
ESCA -0.533 0.05 -0.345 0.15 11 Click to see details
KIRC -0.196 0.05 -0.152 0.11 68 Click to see details
KICH 0.25 0.11 0.256 0.11 25 Click to see details
UCEC 0.281 0.12 0.205 0.2 19 Click to see details
LUSC -0.167 0.16 -0.099 0.28 38 Click to see details
COAD 0.385 0.17 0.667 0.04 8 Click to see details
PAAD -0.602 0.2 -0.800 0.1 4 Click to see details
BRCA -0.088 0.21 -0.011 0.46 84 Click to see details
THCA 0.084 0.26 0.064 0.32 59 Click to see details
PCPG 0.319 0.4 -0.500 0.33 3 Click to see details
BLCA -0.016 0.47 0.015 0.48 18 Click to see details
PRAD -0.007 0.48 -0.056 0.35 50 Click to see details
HNSC -0.006 0.48 -0.025 0.44 42 Click to see details
CESC -0.008 0.5 -0.500 0.33 3 Click to see details
CESC -0.008 0.5 -0.500 0.33 3 Click to see details
CESC -0.008 0.5 -0.500 0.33 3 Click to see details
205 hsa-miR-148a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000020 DNMT1 DNA methyltransferase 1 7 7
MIRT000297 HLA-G major histocompatibility complex, class I, G 2 1
MIRT000298 TGIF2 TGFB induced factor homeobox 2 3 2
MIRT000955 DNMT3B DNA methyltransferase 3 beta 5 2
MIRT003998 NR1I2 nuclear receptor subfamily 1 group I member 2 7 2
MIRT004504 RPS6KA5 ribosomal protein S6 kinase A5 4 1
MIRT005898 CCKBR cholecystokinin B receptor 4 3
MIRT006859 IRS1 insulin receptor substrate 1 2 1
MIRT006946 ACVR1 activin A receptor type 1 2 2
MIRT006975 BCL2 BCL2, apoptosis regulator 1 1
MIRT007017 TMED7 transmembrane p24 trafficking protein 7 1 1
MIRT025970 GPATCH8 G-patch domain containing 8 1 1
MIRT025971 TMEM14A transmembrane protein 14A 1 1
MIRT025972 ANP32A acidic nuclear phosphoprotein 32 family member A 1 1
MIRT025973 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT025974 HSP90B1 heat shock protein 90 beta family member 1 1 1
MIRT025975 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT025976 CYCS cytochrome c, somatic 1 1
MIRT025977 ADARB1 adenosine deaminase, RNA specific B1 1 1
MIRT025978 CBX3 chromobox 3 1 1
MIRT025979 UQCRQ ubiquinol-cytochrome c reductase complex III subunit VII 1 1
MIRT025980 SPRY2 sprouty RTK signaling antagonist 2 1 1
MIRT025981 PAN3 PAN3 poly(A) specific ribonuclease subunit 1 1
MIRT025982 KANSL1 KAT8 regulatory NSL complex subunit 1 1 1
MIRT025983 GAS1 growth arrest specific 1 2 6
MIRT025984 PTPN4 protein tyrosine phosphatase, non-receptor type 4 1 1
MIRT025985 ZNF92 zinc finger protein 92 1 1
MIRT025986 RAB10 RAB10, member RAS oncogene family 1 1
MIRT025987 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 3
MIRT025988 HCCS holocytochrome c synthase 1 1
MIRT025989 WAPAL WAPL cohesin release factor 1 1
MIRT025990 MPP5 membrane palmitoylated protein 5 1 1
MIRT025991 ZNF490 zinc finger protein 490 1 1
MIRT025992 RAB12 RAB12, member RAS oncogene family 2 3
MIRT025993 GNB5 G protein subunit beta 5 1 1
MIRT025994 SNAPIN SNAP associated protein 2 3
MIRT025995 PSMD9 proteasome 26S subunit, non-ATPase 9 1 1
MIRT025996 TRIM59 tripartite motif containing 59 1 1
MIRT025997 DYNLL2 dynein light chain LC8-type 2 1 1
MIRT025998 SECISBP2L SECIS binding protein 2 like 2 6
MIRT025999 LYSMD1 LysM domain containing 1 1 1
MIRT026000 PBXIP1 PBX homeobox interacting protein 1 2 2
MIRT026001 MTMR9 myotubularin related protein 9 1 1
MIRT026002 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 1 1
MIRT026003 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT026004 LBR lamin B receptor 1 1
MIRT026005 KIAA1549 KIAA1549 1 1
MIRT026006 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 1 1
MIRT026007 CDK19 cyclin dependent kinase 19 2 3
MIRT026008 RAB34 RAB34, member RAS oncogene family 2 3
MIRT026009 ARRDC3 arrestin domain containing 3 1 1
MIRT026010 PRNP prion protein 2 1
MIRT026011 HOXC8 homeobox C8 4 1
MIRT026012 TMEM9B TMEM9 domain family member B 1 1
MIRT026013 RASSF8 Ras association domain family member 8 1 1
MIRT026014 BTBD3 BTB domain containing 3 2 12
MIRT026015 TNRC6A trinucleotide repeat containing 6A 2 3
MIRT026016 SESTD1 SEC14 and spectrin domain containing 1 1 1
MIRT026017 CDC25B cell division cycle 25B 3 1
MIRT048023 MRPL45 mitochondrial ribosomal protein L45 1 1
MIRT048024 DENR density regulated re-initiation and release factor 1 1
MIRT048025 APPBP2 amyloid beta precursor protein binding protein 2 1 1
MIRT048026 SLC2A3 solute carrier family 2 member 3 1 1
MIRT048027 PTPN23 protein tyrosine phosphatase, non-receptor type 23 1 1
MIRT048028 VPS41 VPS41, HOPS complex subunit 1 1
MIRT048029 MSL3 MSL complex subunit 3 1 1
MIRT048030 AMELX amelogenin, X-linked 1 1
MIRT048031 OR2C3 olfactory receptor family 2 subfamily C member 3 1 1
MIRT048032 SLC25A3 solute carrier family 25 member 3 1 1
MIRT048033 APC APC, WNT signaling pathway regulator 1 1
MIRT048034 GOLIM4 golgi integral membrane protein 4 1 1
MIRT048035 MYCBP2 MYC binding protein 2, E3 ubiquitin protein ligase 1 1
MIRT048036 RPS17 ribosomal protein S17 1 1
MIRT048037 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT048038 WDTC1 WD and tetratricopeptide repeats 1 1 1
MIRT048039 HMGB1 high mobility group box 1 1 1
MIRT048040 MAP3K4 mitogen-activated protein kinase kinase kinase 4 4 2
MIRT048041 USP38 ubiquitin specific peptidase 38 1 1
MIRT048042 NONO non-POU domain containing octamer binding 1 1
MIRT048043 CCNI cyclin I 1 1
MIRT048044 AURKB aurora kinase B 1 1
MIRT052917 MMP7 matrix metallopeptidase 7 4 1
MIRT053185 WNT10B Wnt family member 10B 4 1
MIRT053199 MYC MYC proto-oncogene, bHLH transcription factor 2 1
MIRT053475 CDKN1B cyclin dependent kinase inhibitor 1B 4 5
MIRT053477 SERPINE1 serpin family E member 1 3 1
MIRT053478 ITGB8 integrin subunit beta 8 5 3
MIRT053479 VAV2 vav guanine nucleotide exchange factor 2 3 1
MIRT053480 ITGA5 integrin subunit alpha 5 3 1
MIRT053483 ROCK1 Rho associated coiled-coil containing protein kinase 1 6 3
MIRT053518 RUNX3 runt related transcription factor 3 2 1
MIRT053560 SMAD2 SMAD family member 2 3 1
MIRT054115 UNKL unkempt family like zinc finger 1 1
MIRT054388 MET MET proto-oncogene, receptor tyrosine kinase 3 1
MIRT057492 CEP55 centrosomal protein 55 2 4
MIRT062708 MLEC malectin 2 4
MIRT084562 BCL2L11 BCL2 like 11 2 1
MIRT105304 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT130076 TXNIP thioredoxin interacting protein 4 4
MIRT138426 KIF2C kinesin family member 2C 2 2
MIRT152411 ARID3A AT-rich interaction domain 3A 2 2
MIRT155749 SIK1 salt inducible kinase 1 2 6
MIRT210293 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT218522 HLA-A major histocompatibility complex, class I, A 2 2
MIRT222270 CCT6A chaperonin containing TCP1 subunit 6A 2 2
MIRT270936 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT280554 GLRX5 glutaredoxin 5 2 2
MIRT281136 PDIA3 protein disulfide isomerase family A member 3 3 1
MIRT296526 STX16 syntaxin 16 2 2
MIRT301572 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT347400 CEBPG CCAAT/enhancer binding protein gamma 2 2
MIRT382244 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT399584 RBM38 RNA binding motif protein 38 2 2
MIRT437409 MAFB MAF bZIP transcription factor B 1 1
MIRT438088 ERRFI1 ERBB receptor feedback inhibitor 1 2 1
MIRT438751 S1PR1 sphingosine-1-phosphate receptor 1 3 3
MIRT438752 USP4 ubiquitin specific peptidase 4 3 1
MIRT453164 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT456196 ZDHHC6 zinc finger DHHC-type containing 6 2 2
MIRT458103 TTLL1 tubulin tyrosine ligase like 1 2 2
MIRT459958 POC1A POC1 centriolar protein A 2 2
MIRT461329 MRPS27 mitochondrial ribosomal protein S27 2 2
MIRT462848 B4GALT7 beta-1,4-galactosyltransferase 7 2 2
MIRT463247 ZIC5 Zic family member 5 2 2
MIRT464041 WASL Wiskott-Aldrich syndrome like 2 2
MIRT466869 STX6 syntaxin 6 2 2
MIRT467697 SLC38A2 solute carrier family 38 member 2 2 4
MIRT468920 RPS6KA4 ribosomal protein S6 kinase A4 2 2
MIRT469506 RCC2 regulator of chromosome condensation 2 2 2
MIRT469815 RAB14 RAB14, member RAS oncogene family 2 2
MIRT470329 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT473770 MAP3K9 mitogen-activated protein kinase kinase kinase 9 5 3
MIRT477363 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT478215 DDX6 DEAD-box helicase 6 2 2
MIRT479812 CCNA2 cyclin A2 2 6
MIRT484939 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485432 KLF6 Kruppel like factor 6 9 3
MIRT485645 DICER1 dicer 1, ribonuclease III 2 4
MIRT487938 HLA-C major histocompatibility complex, class I, C 3 2
MIRT488937 ETV7 ETS variant 7 2 2
MIRT492821 PATL1 PAT1 homolog 1, processing body mRNA decay factor 2 2
MIRT496749 PDIK1L PDLIM1 interacting kinase 1 like 2 2
MIRT497883 SLC12A7 solute carrier family 12 member 7 2 2
MIRT500918 STARD13 StAR related lipid transfer domain containing 13 2 4
MIRT503176 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT505102 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 2
MIRT505256 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT511220 LNPEP leucyl and cystinyl aminopeptidase 2 4
MIRT513209 RFT1 RFT1 homolog 2 2
MIRT513617 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT522804 KPNA4 karyopherin subunit alpha 4 2 4
MIRT525443 RBM23 RNA binding motif protein 23 2 2
MIRT530302 AKAP17A A-kinase anchoring protein 17A 2 2
MIRT531689 MYO3A myosin IIIA 2 2
MIRT537300 FZD5 frizzled class receptor 5 2 2
MIRT541199 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT544732 NDRG1 N-myc downstream regulated 1 2 2
MIRT549174 BMP3 bone morphogenetic protein 3 2 2
MIRT549231 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT551864 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT559687 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT561658 RNF219 ring finger protein 219 2 2
MIRT561856 NPTX1 neuronal pentraxin 1 2 2
MIRT565733 SESN3 sestrin 3 2 2
MIRT566568 OTUD4 OTU deubiquitinase 4 2 2
MIRT567186 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT567834 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT574794 FAM104A family with sequence similarity 104 member A 2 2
MIRT576772 Tmem127 transmembrane protein 127 2 2
MIRT610545 WNT2B Wnt family member 2B 2 4
MIRT613042 FOXP1 forkhead box P1 2 2
MIRT615073 COLEC12 collectin subfamily member 12 2 2
MIRT617481 AP5B1 adaptor related protein complex 5 beta 1 subunit 2 2
MIRT622753 PHACTR2 phosphatase and actin regulator 2 2 2
MIRT625516 PPAPDC1A phospholipid phosphatase 4 2 2
MIRT628641 ABLIM1 actin binding LIM protein 1 2 2
MIRT630234 SORD sorbitol dehydrogenase 2 2
MIRT635946 PLA2G12A phospholipase A2 group XIIA 2 2
MIRT646776 IL23R interleukin 23 receptor 2 2
MIRT648163 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT653244 SOS2 SOS Ras/Rho guanine nucleotide exchange factor 2 5 2
MIRT661182 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT693234 KIAA0907 KIAA0907 2 4
MIRT693776 VGLL2 vestigial like family member 2 2 2
MIRT702589 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT715175 DTX4 deltex E3 ubiquitin ligase 4 2 2
MIRT722871 FAM212B family with sequence similarity 212 member B 2 2
MIRT723139 YPEL1 yippee like 1 2 2
MIRT723186 OVOL1 ovo like transcriptional repressor 1 2 2
MIRT732353 WNT1 Wnt family member 1 3 1
MIRT732362 STAT3 signal transducer and activator of transcription 3 3 1
MIRT734547 HNRNPK heterogeneous nuclear ribonucleoprotein K 2 0
MIRT734935 CXCR4 C-X-C motif chemokine receptor 4 1 0
MIRT736034 ITGA9 integrin subunit alpha 9 3 0
MIRT736105 PTEN phosphatase and tensin homolog 5 1
MIRT736114 IL15 interleukin 15 2 0
MIRT736501 AKT1 AKT serine/threonine kinase 1 1 0
MIRT737228 PCGEM1 PCGEM1, prostate-specific transcript (non-protein coding) 2 0
MIRT737363 UBAP2 ubiquitin associated protein 2 3 0
MIRT737364 FOXK2 forkhead box K2 3 0
MIRT755397 WNT10A Wnt family member 10A 2 1
MIRT755440 LDLR low density lipoprotein receptor 1 1
MIRT756258 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 3 1
MIRT756289 SLC7A11 solute carrier family 7 member 11 2 1
MIRT756402 CNTN4 contactin 4 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-148a Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-148a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
miR-148a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-148a Bilobalide NULL 73581 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Bilobalide NULL 73581 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-148a Daidzein NULL 5281708 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Dexamethasone approved 5743 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-148a Paclitaxel approved 36314 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Vinblastine approved 13342 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 down-regulated
miR-148a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-148a 5a-dihydrotestosterone (DHT) NULL 15 Quantitative real-time PCR LNCaP cells 22266859 2012 up-regulated
miR-148a Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miR-148a Celecoxib approved 2662 Microarray gastric cancer cells. 23001726 2013 up-regulated
miR-148a Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miR-148a 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 up-regulated
miR-148a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-148a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer tissue
hsa-mir-148a Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer tissue
hsa-mir-148a Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-148a Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-148a Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-148a Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-148a Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-148a-3p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-148a-3p (2,3-dihydroxyphenyl)-[1-[(4-fluorophenyl)methyl]-4-hydroxyindol-3-yl]methanone 42624812 NSC746053 sensitive
hsa-miR-148a-3p (2E)-2-[(2-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516827 NSC639520 sensitive
hsa-miR-148a-3p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-148a-3p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-148a-3p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 resistant
hsa-miR-148a-3p (4z,5z)-1-[(e)-(2-hydroxyphenyl)methyleneamino]-3-phenyl-4,5-bis(phenylimino)imidazolidine-2-thione 135509182 NSC671409 resistant
hsa-miR-148a-3p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-148a-3p (E)-1-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54612660 NSC741738 resistant
hsa-miR-148a-3p (e)-3-chloro-2-(3,4-dimethoxyphenyl)-3-(3,4-dipropoxyphenyl)prop-2-enal 3004402 NSC650594 sensitive
hsa-miR-148a-3p (e)-but-2-enedioic acid;1-(7,8,9,10-tetrahydrophenanthridin-6-yl)piperidin-4-amine 5471308 NSC710333 sensitive
hsa-miR-148a-3p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-methylphenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351426 NSC670225 sensitive
hsa-miR-148a-3p .beta.-d-glucopyranose, 2,3-o-(diethylstannylene)- 16683462 NSC306911 sensitive
hsa-miR-148a-3p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 sensitive
hsa-miR-148a-3p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-148a-3p [1,1,1,3,3,3-hexafluoro-2-(quinolin-2-ylmethyl)propan-2-yl] acetate 379602 NSC664303 sensitive
hsa-miR-148a-3p [2-(4-methoxyphenyl)-2-oxoethyl] (2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[[(2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[2-(4-methoxyphenyl)-2-oxoethoxy]-3-oxopropyl]diselanyl]propanoate 45029327 NSC746149 resistant
hsa-miR-148a-3p [4-[[2-(1h-indol-2-yl)-1,3-dioxolan-2-yl]methyl]-1-piperidyl]-phenyl-methanone 398268 NSC707982 sensitive
hsa-miR-148a-3p [7-fluoro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-(furan-2-yl)methanone 23635646 NSC736443 sensitive
hsa-miR-148a-3p [acetyl(diphenyl)[?]yl] acetate 363302 NSC628121 sensitive
hsa-miR-148a-3p 1-((4-methylene-5-oxo-2-phenyltetrahydro-2-furanyl)methyl)dihydro-2,4(1h,3h)-pyrimidinedione 381497 NSC668253 sensitive
hsa-miR-148a-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 sensitive
hsa-miR-148a-3p 1-[(1e)-2,3,3-trichloro-1-[chloro(nitro)methylene]allyl]piperidine 3004947 NSC665087 sensitive
hsa-miR-148a-3p 1-[(4-fluorophenyl)amino]-2,3-propanopyrido[1,2-a]benzimidazole-4-carbonitrile 395404 NSC699940 resistant
hsa-miR-148a-3p 1-cyclohexyl-3-[(e)-(6-methyl-2-pyridyl)methyleneamino]thiourea 9571907 NSC670782 sensitive
hsa-miR-148a-3p 12-(3,5-ditert-butyl-4-hydroxyphenyl)-1,4,7,10,13,16-hexaoxacyclooctadecane-2,9-dione 386885 NSC679743 resistant
hsa-miR-148a-3p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 resistant
hsa-miR-148a-3p 17-methyl-13,14,17-triazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,8,11(16),14-heptaen-12-one 403909 NSC719502 resistant
hsa-miR-148a-3p 2-(2-naphthyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 388200 NSC682768 resistant
hsa-miR-148a-3p 2-(2-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468909 NSC679021 sensitive
hsa-miR-148a-3p 2-(2,4-dichlorobenzyl)-3,5,6-trimethyl-2h-indazole-7-carbonitrile 367590 NSC637422 resistant
hsa-miR-148a-3p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-148a-3p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepine-6-thione 4998423 NSC684481 resistant
hsa-miR-148a-3p 2-(3-methylbutylsulfanyl)naphthalene-1,4-dione 315743 NSC241494 sensitive
hsa-miR-148a-3p 2-(3-phenyl-4,5-bis(phenylimino)-1,3-thiazolidin-2-ylidene)malononitrile 383253 NSC671367 sensitive
hsa-miR-148a-3p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 sensitive
hsa-miR-148a-3p 2-(4-isothiocyanatophenyl)sulfanylacetic acid 345648 NSC403376 sensitive
hsa-miR-148a-3p 2-(6-ethenyl-4-hydroxy-6-methyl-3-methylidene-2-oxo-4,5,7,7a-tetrahydro-3aH-1-benzofuran-7-yl)prop-2-enal 495207 NSC645991 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]-1-(2-nitrophenyl)prop-2-en-1-one 411522 NSC34821 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]-1-(2,5-dimethylphenyl)prop-2-en-1-one 436059 NSC382001 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]cyclopentan-1-one 244760 NSC621888 sensitive
hsa-miR-148a-3p 2-[(z)-2-(benzenesulfonyl)-2-(5-nitrofuran-2-yl)ethenyl]-5-nitrofuran 6072945 NSC291049 sensitive
hsa-miR-148a-3p 2-[(Z)-2-[3-[3-methoxy-5-(trifluoromethyl)phenyl]-1,2,4-triazol-1-yl]ethenyl]-1,3,4-oxadiazole 57524026 NSC757569 sensitive
hsa-miR-148a-3p 2-[5-[4-[5-[4-(6-morpholin-4-yl-1H-benzimidazol-2-yl)phenoxy]pentyl]piperazin-1-yl]pentyl]benzo[de]isoquinoline-1,3-dione 44219118 NSC743432 sensitive
hsa-miR-148a-3p 2-acetamido-6-methyl-8-hydroxy-1,4-naphthaquinone 377214 NSC658450 sensitive
hsa-miR-148a-3p 2-amino-6-[4-[[4,6-bis(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-4-(4-methoxyphenyl)pyridine-3-carbonitrile 45028694 NSC743853 sensitive
hsa-miR-148a-3p 2-nitro-1-phenylpropan-1-ol 226118 NSC16258 sensitive
hsa-miR-148a-3p 2,3-bis(naphthalen-2-ylsulfanyl)naphthalene-1,4-dione 312602 NSC222722 sensitive
hsa-miR-148a-3p 2,5,9,12-tetrathiabicyclo[11.4.0]heptadeca-1(13),14,16-triene-15,16-dicarbonitrile 387185 NSC680721 resistant
hsa-miR-148a-3p 2,6-bis(4-morpholinylmethyl)cyclohexanone,dihydrochloride NSC38535 sensitive
hsa-miR-148a-3p 2,6-bis[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 358899 NSC619042 sensitive
hsa-miR-148a-3p 3-(3-chloro-4-methoxyphenyl)-N-[2-(dimethylamino)ethyl]-4-pyridin-4-ylpyrazole-1-carboxamide 60147896 NSC752885 resistant
hsa-miR-148a-3p 3-(4-chlorophenyl)-6-(5-nitrofuran-2-yl)-7H-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine 364212 NSC629974 sensitive
hsa-miR-148a-3p 3-[2-[(3,5-dichlorophenyl)amino]thiazol-4-yl]chromen-2-one 395985 NSC701109 resistant
hsa-miR-148a-3p 3-[2-[[5-[(4-bromophenyl)diazenyl]-2-hydroxyphenyl]-phenylsulfanylmethyl]hydrazinyl]-3-oxo-n-phenylpropanamide 377943 NSC659611 sensitive
hsa-miR-148a-3p 3-bromo-1-oxo-2-phenylthiochromen-4-one 5472015 NSC715997 sensitive
hsa-miR-148a-3p 3-chloro-4-methyl-7-((2-methyl-4-methylene-5-oxotetrahydro-2-furanyl)methoxy)-2h-chromen-2-one 381507 NSC668263 sensitive
hsa-miR-148a-3p 3-deazaneplanocin, hydrochloride 358176 NSC617989 sensitive
hsa-miR-148a-3p 4-(1-(4-aminophenyl)-3,4-diphenyl-1h-1.lambda.~4~-thien-1-yl)phenylamine 392992 NSC694234 resistant
hsa-miR-148a-3p 4-(2-(((6-bromo-1,3-benzodioxol-5-yl)methyl)amino)ethyl)phenol 290548 NSC154572 sensitive
hsa-miR-148a-3p 4-(2-azidophenothiazin-10-yl)-N,N-dimethylbutan-1-amine;oxalic acid 385933 NSC677395 sensitive
hsa-miR-148a-3p 4-[3-(4-chlorophenyl)-5-(2,5-dimethoxyphenyl)pyrazol-1-yl]benzenesulfonamide 24204421 NSC731805 sensitive
hsa-miR-148a-3p 4-amino-2-(4-chloroanilino)-5-(4-chlorobenzoyl)-n-phenyl-1h-pyrrole-3-carbothioamide 5472776 NSC721531 resistant
hsa-miR-148a-3p 4-amino-3,5-dichloro-n-(3-(4-(2-methoxyphenyl)-1-piperazinyl)propyl)benzamide 379857 NSC664993 sensitive
hsa-miR-148a-3p 4-morpholinecarbodithioic acid, antimony complex NSC625498 sensitive
hsa-miR-148a-3p 5-[2-(4-methoxyphenyl)ethyl]-1,2,3-dimethoxy benzene NSC631356 sensitive
hsa-miR-148a-3p 5,6,11,12-tetramethyl-5,5a,6,11,11a,12-hexahydroquinoxalino[2,3-b]quinoxaline 365519 NSC633207 sensitive
hsa-miR-148a-3p 5,7-dihydroquinolino[3,2-d][1]benzazepine-6-thione 3005168 NSC679092 resistant
hsa-miR-148a-3p 6-(3-azidopropyl)-2,3-dimethoxy-5,11-dioxoindeno[1,2-c]isoquinoline-9-carbonitrile 17755511 NSC734749 resistant
hsa-miR-148a-3p 7-chloro-5-hydroxy-2-methoxy-2,4-dimethyl-1H-benzo[e][1]benzofuran-6,9-dione 359534 NSC620517 sensitive
hsa-miR-148a-3p 7-hydroxystaurosporine 5351376 NSC638646 resistant
hsa-miR-148a-3p 8-{[(3as)-2-methylhexahydro-1h-pyrrolo[1,2-c][1,3,2]diazaphosphol-1-yl]oxy}quinoline 402496 NSC716522 sensitive
hsa-miR-148a-3p 8-fluoro-11-methyl-1h-benzo[a]carbazole-1,4(11h)-dione 381772 NSC668844 sensitive
hsa-miR-148a-3p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 sensitive
hsa-miR-148a-3p 9-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386894 NSC679796 sensitive
hsa-miR-148a-3p 9-isobutyl-6-(((2-methyl-1-naphthyl)methyl)thio)-9h-purin-2-amine 244996 NSC56452 sensitive
hsa-miR-148a-3p 9h-purine, 2-amino-6-(2,4-dichlorobenzylthio)-9-isobutyl- 240896 NSC47786 sensitive
hsa-miR-148a-3p Ab01327238-02 6892730 NSC670969 sensitive
hsa-miR-148a-3p Acetamide, n-(2-mercaptoethyl)-, benzoate (6ci, 7ci) 281604 NSC134459 sensitive
hsa-miR-148a-3p Aj-131/36477019 384476 NSC674278 resistant
hsa-miR-148a-3p Aspiculamycin hcl 5458423 NSC200692 resistant
hsa-miR-148a-3p Auranofin 6333901 NSC321521 sensitive
hsa-miR-148a-3p Baccharin 5358645 NSC269757 sensitive
hsa-miR-148a-3p Benzene, 1,1'-[(1,3-butadiene-1,4-diyl)sulfonyl]bis 5468033 NSC662781 sensitive
hsa-miR-148a-3p Caracemide 54747 NSC253272 sensitive
hsa-miR-148a-3p Cbmicro_021216 812842 NSC707055 sensitive
hsa-miR-148a-3p Chimaphilin 101211 NSC400245 sensitive
hsa-miR-148a-3p Cis-amminedichloro(4-methoxyphenethylamine)platinum(ii) 498559 NSC631306 sensitive
hsa-miR-148a-3p Compactin 2854 NSC281245 resistant
hsa-miR-148a-3p Copper;(ne,3z)-n-[1-(6-methylpyridazin-3-yl)ethylidene]-3-azabicyclo[3.2.2]nonane-3-carbohydrazonothioate 9578854 NSC633271 sensitive
hsa-miR-148a-3p Cyanocycline a 100158 NSC349644 sensitive
hsa-miR-148a-3p Cycloalkannin 133408 NSC301457 sensitive
hsa-miR-148a-3p Cyclopentanone, 2,5-bis[(trimethylamino)methyl]-, iodide 360925 NSC623639 sensitive
hsa-miR-148a-3p Cytembena 23663958 NSC104801 sensitive
hsa-miR-148a-3p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-148a-3p Dasatinib 3062316 NSC732517 approved resistant
hsa-miR-148a-3p Dibutyl(bis((3-(2-fluorophenyl)acryloyl)oxy))stannane 16683204 NSC643860 sensitive
hsa-miR-148a-3p Dichloroallyl lawsone 277767 NSC126771 sensitive
hsa-miR-148a-3p Dichlorodipropyltin 93562 NSC92618 sensitive
hsa-miR-148a-3p Dichloroiron;(NE,1E)-N-(1-pyridin-2-ylethylidene)azepane-1-carbohydrazonothioate 9578789 NSC338304 sensitive
hsa-miR-148a-3p Diethyl 2-[[4-(3-phenylquinoxalin-2-yl)oxybenzoyl]amino]pentanedioate 390812 NSC688814 resistant
hsa-miR-148a-3p Diketocoriolin b 294475 NSC163027 sensitive
hsa-miR-148a-3p Enhydrin a 5359029 NSC294601 sensitive
hsa-miR-148a-3p Entinostat 4261 NSC706995 sensitive
hsa-miR-148a-3p Ethanone, 1-(2-pyrimidinyl)-, (2-benzoxazolyl)hydrazone 9572051 NSC693639 sensitive
hsa-miR-148a-3p Ethyl 3-[[5-[(e)-3-methoxy-3-oxoprop-1-enyl]-1h-imidazol-4-yl]diazenyl]benzoate 135436270 NSC716679 sensitive
hsa-miR-148a-3p Ethyl 3-benzyl-2-methyl-4,5-dioxobenzo[e]indole-1-carboxylate 406008 NSC723888 sensitive
hsa-miR-148a-3p Ethyl 7-(3,4-difluorophenyl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399952 NSC711104 resistant
hsa-miR-148a-3p Gold(1+), bis(trimethylphosphine)-, chloride 6333886 NSC313985 sensitive
hsa-miR-148a-3p Gtpl8141 44478401 NSC752203 resistant
hsa-miR-148a-3p Gw410563a 10425574 NSC756225 resistant
hsa-miR-148a-3p Gw559768x 9927432 NSC756251 resistant
hsa-miR-148a-3p Gw612286x 9822610 NSC756278 resistant
hsa-miR-148a-3p Gw643971x 135778715 NSC756297 resistant
hsa-miR-148a-3p Insariotoxin 6711181 NSC138780 sensitive
hsa-miR-148a-3p Isodonol 317640 NSC250682 sensitive
hsa-miR-148a-3p J7x181m78y 395460 NSC700023 resistant
hsa-miR-148a-3p Ldn-211904 46175113 NSC751644 resistant
hsa-miR-148a-3p Ls-123342 5469111 NSC683328 sensitive
hsa-miR-148a-3p Methyl 1-[[N-[(3-methoxycarbonyl-5-methylpyrazol-1-yl)methyl]anilino]methyl]-5-methylpyrazole-3-carboxylate 404564 NSC720860 sensitive
hsa-miR-148a-3p Methyl 2-[(2e)-2-[(2,6-dichlorophenyl)methylidene]hydrazinyl]-5-(3,4,5-trimethoxyphenyl)-1h-pyrrole-3-carboxylate 45029264 NSC745940 resistant
hsa-miR-148a-3p Methyl N-[(E)-1-pyridin-2-ylethylideneamino]carbamodithioate 5947235 NSC251190 sensitive
hsa-miR-148a-3p Methylene blue 6099 NSC617593 approved sensitive
hsa-miR-148a-3p N'-[1-(1-benzothiophen-2-yl)cyclohexyl]-n-methylpropane-1,3-diamine;(e)-but-2-enedioic acid 54611499 NSC708074 sensitive
hsa-miR-148a-3p N-(((2-methoxy-5-(trifluoromethyl)anilino)carbonyl)oxy)butanimidoyl chloride 9556202 NSC672059 sensitive
hsa-miR-148a-3p N-(2-((((4-methoxyphenyl)diazenyl)carbonyl)amino)-4-methylpentanoyl)phenylalanine 386436 NSC678404 sensitive
hsa-miR-148a-3p N-(2,5-dimethylphenyl)-2-(3-oxo-4H-1,4-benzothiazin-2-yl)acetamide 366111 NSC634398 resistant
hsa-miR-148a-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 sensitive
hsa-miR-148a-3p N-(4-methoxyphenyl)-3-[4-[(4-methylphenyl)diazenyl]-3,5-diphenylpyrazol-1-yl]-3-oxopropanamide 367846 NSC637921 resistant
hsa-miR-148a-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 sensitive
hsa-miR-148a-3p N-[(e)-(5-chloro-2-hydroxyphenyl)methylideneamino]-2-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968273 NSC747459 sensitive
hsa-miR-148a-3p N-[2-(1H-indol-3-yl)ethyl]-1,1-dioxo-2-(3-propan-2-yloxyphenyl)-4H-pyrido[4,3-e][1,2,4]thiadiazin-3-imine 135426715 NSC710895 sensitive
hsa-miR-148a-3p N-[4-[2-(2,4-dinitrophenyl)-3-(3-ethoxy-4-hydroxyphenyl)-3,4-dihydropyrazol-5-yl]phenyl]-2-methyl-5-nitrobenzenesulfonamide 402369 NSC716281 resistant
hsa-miR-148a-3p N-[4-[hydroxy(methyl)amino]-6-(propylamino)-1,3,5-triazin-2-yl]-n-methylhydroxylamine 45029482 NSC746928 sensitive
hsa-miR-148a-3p N,N'-bis(3-aminopropyl)-N,N'-dibenzylbutane-1,4-diamine;2,2,2-trifluoroacetic acid 389631 NSC685976 resistant
hsa-miR-148a-3p N,N-dimethyl-4-[(Z)-(6-methylindolo[1,2-b]indazol-6-ium-11-ylidene)methyl]aniline;trifluoromethanesulfonate 5471987 NSC715775 sensitive
hsa-miR-148a-3p Navan 941650 NSC108165 sensitive
hsa-miR-148a-3p Neuro_000327 16683203 NSC643859 sensitive
hsa-miR-148a-3p NSC600301 NSC600301 sensitive
hsa-miR-148a-3p NSC607281 NSC607281 sensitive
hsa-miR-148a-3p NSC621335 NSC621335 sensitive
hsa-miR-148a-3p NSC621339 NSC621339 sensitive
hsa-miR-148a-3p NSC625496 NSC625496 sensitive
hsa-miR-148a-3p NSC641052 NSC641052 sensitive
hsa-miR-148a-3p NSC716032 NSC716032 sensitive
hsa-miR-148a-3p Oridonin (thiol adduct of) 432952 NSC319730 sensitive
hsa-miR-148a-3p Oxin 1923 NSC2039 approved sensitive
hsa-miR-148a-3p Phenol, 4,4'-(5,5'-biisoxazole-3,3'-diyl)bis- 386651 NSC679108 sensitive
hsa-miR-148a-3p Physalin f 433531 NSC661115 sensitive
hsa-miR-148a-3p Pmp (van) 72508 NSC1906 sensitive
hsa-miR-148a-3p Pyrazino[1,2-a]benzimidazole, 1,3-diphenyl- 384474 NSC674276 resistant
hsa-miR-148a-3p Quinolin-8-yl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402508 NSC716535 sensitive
hsa-miR-148a-3p Sergeolide,desacetyl 125729 NSC364170 sensitive
hsa-miR-148a-3p Staurosporine 5459111 NSC618487 resistant
hsa-miR-148a-3p Stk386853 5291187 NSC65628 sensitive
hsa-miR-148a-3p Streptovaricin b 135443622 NSC156215 sensitive
hsa-miR-148a-3p Tetraplatin 13920603 NSC363812 sensitive
hsa-miR-148a-3p Trimethyl-[(1-oxo-3,4-dihydro-2H-naphthalen-2-yl)methyl]azanium;iodide 375929 NSC656280 sensitive
hsa-miR-148a-3p U-22265 265952 NSC102810 sensitive
hsa-miR-148a-3p Ver a 5351232 NSC126728 sensitive
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3)
hsa-miR-148a-3p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Adenocarcinoma cell line (OE19)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Adenocarcinoma cell line (OE19)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant Low Squamous Cell Carcinoma cell line (SCC-11)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-148a-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-148a-3p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-148a-3p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (22Rv1, DU-145, PC-3,22Rv1RD, DU-145RD, PC-3RD)
hsa-miR-148a-3p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (PC-3)
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-148a-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (PANC-1, MIA-PaCa-2)
hsa-miR-148a-3p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive Low ER-Positive Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Renal Cell Cancer cell line (Caki)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (BGC823, SGC7901)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7C)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Adenocarcinoma cell line (MCF-7, MDA-MB-231)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Adenocarcinoma cell line (MCF-7, MDA-MB-231)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (VCaP-R)
hsa-miR-148a-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Colorectal Cancer cell line (SW480)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKVO3ip1, HeyA8)
hsa-miR-148a-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-CC, MCF-7-TT, MCF-7-21)
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly19, RIVA, SU DHL-8, U2932)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1, PANC-1)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-148a-3p Bromocriptine 31101 NSC169774 approved sensitive Low Prolactinoma tissue
hsa-miR-148a-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-148a-3p Cyclophosphamide 2907 NSC26271 approved resistant High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-148a-3p Rhamnetin 5281691 NSC19802 sensitive Low Hepatocellular Carcinoma cell line (MHCC97-H, HepG2)
hsa-miR-148a-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa, SiHa)
hsa-miR-148a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (A375)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-148a-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-148a-3p Ribavirin+Pegylated IFNa-2b sensitive tissue (chronic hepatitis C)
hsa-miR-148a-3p Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-miR-148a-3p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-148a-3p Testosterone+Letrozole sensitive cell line (MCF-7)
hsa-miR-148a-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-148a-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-148a-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-148a-3p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-148a-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR1)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-148a-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-148a-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission