miRTarBase - #MIRT025973


—
pre-miRNA Information
pre-miRNA hsa-mir-148a   
Genomic Coordinates chr7: 25949919 - 25949986
Description Homo sapiens miR-148a stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-148a-3p
Sequence 44| UCAGUGCACUACAGAACUUUGU |65
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs772747528 2 dbSNP
rs1290582082 8 dbSNP
rs370090919 11 dbSNP
rs771952261 13 dbSNP
rs1249161151 16 dbSNP
rs748063984 19 dbSNP
rs774196394 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RAB1B   
Synonyms -
Description RAB1B, member RAS oncogene family
Transcript NM_030981   
Expression
Putative miRNA Targets on RAB1B
3'UTR of RAB1B
(miRNA target sites are highlighted)		 
>RAB1B|NM_030981|3'UTR
   1 GAGGGGCACATGGAGTGGGACAGGAGGGGGCACCTTCTCCAGATGATGTCCCTGGAGGGGGCAGGAGGTACCTCCCTCTC
  81 CCTCTCCTGGGGCATTTGAGTCTGTGGCTTTGGGGTGTCCTGGGCTCCCCATCTCCTTCTGGCCCATCTGCCTGCTGCCC
 161 TGAGCCCCGGTTCTGTCAGGGTCCCTAAGGGAGGACACTCAGGGCCTGTGGCCAGGCAGGGCGGAGGCCTGCTGTGCTGT
 241 TGCCTCTAGGTGACTTTCCAAGATGCCCCCCTACACACCTTTCTTTGGAACGAGGGCTCTTCTGTCGGTGTCCCTCCCAC
 321 CCCCATGTATGCTGCACTGGGTTCTCTCCTTCTTCTTCCTGCTGTCCTGCCCAAGAACTGAGGGTCTCCCCGGCCTCTAC
 401 TGCCCTGGCTGCAGTCAGTGCCCAGGGCGAGGAATGTGGCCAGGGGATCCAGGACCTGGGATCCAGGGCCCTGGGCTGGA
 481 CCTCAGGACAGGCATGGAGGCCACAGGGGCCCAGCAGCCCACCCTTTCCTCTCCCCACTGCCTCCTCTCCCTTCCTACAC
 561 TCCCAGCTCGAGCCGTCCAGCTGCGGTGGGATCTGAGTATATCTAGGGCGGGTGGGCGGGTAGCAGTGCTGGGCCTGTGT
 641 CTTGAGCCTGGAGGGAGTCTGCTCCTGCCGCCCTCTGCCCTGCCAGAGACAGACCCATGCGCTGCCTGCCCACCGTGCCC
 721 CTTTGTCCCCATGTCAGGCGGAGGCGGAAGGCCCACCGTGCCAGAGGCTGGGCACCAGCCTTAACCCTCACTCTGCTAGC
 801 ACCTCCTCCCTTTCCCCAAGGTAGCACATCTGGCTCACTCCCCACTCCGTCTCTGGAGCCCACCAGGGAAGGCCCTCATC
 881 CCCTGCCGCTACTTCTCTGGGGAATGTGGGTTCCATCCAGGATTGGGGGCCTCTCTGCTCACCCACTCTGCACCCAGGAT
 961 CCTAGTCCCCTGCCCTCTGGCACAGCTGCTTCCTGCAAGAAAGCAAGTCTTTGGTCTCCCTGAGAAGCCATGTCCCTCGT
1041 GCTGTCTCTTGCCTGTCCCACCTGTGCCCTGCCCTCCAGCTTGTATTTAAGTCCCTGGGCTGCCCCCTTGGGGTGCCCCC
1121 CGCTCCCAGGTTCCCCTCTGGTGTCATGTCAGGCATTTTGCAAGGAAAAGCCACTTGGGGAAAGATGGAAAAGGACAAAA
1201 AAAATTAATAAATTTCCATTGGCCCTCGGGTGAGCTGAGGGTTTTTGCAAGGAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uguuucaagACAU-C-ACGUGACu 5'
                   |||| | ||||||| 
Target 5' ccacccccaTGTATGCTGCACTGg 3'
 317 - 340 149.00 -12.90
2 
miRNA  3' uguuucaagacaucACGUGACu 5'
                        |||:||| 
Target 5' cagagacagacccaTGCGCTGc 3'
 684 - 705 124.00 -10.33
3 
miRNA  3' uguuucaaGACAUCACGUGACu 5'
                  || || ||| ||| 
Target 5' tccccggcCTCTACTGCCCTGg 3'
 387 - 408 122.00 -6.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20346802 36 COSMIC
COSN20108413 37 COSMIC
COSN20355809 37 COSMIC
COSN30535499 51 COSMIC
COSN31550942 121 COSMIC
COSN19671596 190 COSMIC
COSN29468846 263 COSMIC
COSN30539161 293 COSMIC
COSN26603921 311 COSMIC
COSN20705740 317 COSMIC
COSN5308360 403 COSMIC
COSN31533342 507 COSMIC
COSN26636259 615 COSMIC
COSN31531661 786 COSMIC
COSN32056480 850 COSMIC
COSN31549741 864 COSMIC
COSN22164339 921 COSMIC
COSN31588381 1068 COSMIC
COSN16127824 1098 COSMIC
COSN16132019 1139 COSMIC
COSN31562817 1205 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1050142977 3 dbSNP
rs753078408 5 dbSNP
rs1313463149 7 dbSNP
rs181942452 11 dbSNP
rs764573010 12 dbSNP
rs751769842 15 dbSNP
rs376404350 19 dbSNP
rs781415786 21 dbSNP
rs750526551 23 dbSNP
rs754919317 24 dbSNP
rs1173116022 25 dbSNP
rs1425893733 26 dbSNP
rs778755174 27 dbSNP
rs748141201 30 dbSNP
rs758133813 31 dbSNP
rs1430695231 32 dbSNP
rs749830211 33 dbSNP
rs148632819 34 dbSNP
rs3831389 34 dbSNP
rs748076054 34 dbSNP
rs1374575578 40 dbSNP
rs369483409 41 dbSNP
rs1275974450 42 dbSNP
rs1369010489 46 dbSNP
rs1246463759 49 dbSNP
rs1231426752 52 dbSNP
rs1215820476 57 dbSNP
rs999078475 58 dbSNP
rs1227103159 60 dbSNP
rs1342156974 61 dbSNP
rs1298771596 66 dbSNP
rs1296583756 69 dbSNP
rs1339889942 72 dbSNP
rs768187801 85 dbSNP
rs556506693 88 dbSNP
rs1230125536 89 dbSNP
rs1438193209 90 dbSNP
rs1035499520 91 dbSNP
rs576606115 93 dbSNP
rs1311056870 118 dbSNP
rs959866346 120 dbSNP
rs142287299 126 dbSNP
rs558948213 128 dbSNP
rs772747879 133 dbSNP
rs1388111981 134 dbSNP
rs767467182 136 dbSNP
rs147898756 137 dbSNP
rs1463037375 139 dbSNP
rs984837687 140 dbSNP
rs540942081 145 dbSNP
rs1275926945 149 dbSNP
rs962295804 150 dbSNP
rs1340414159 152 dbSNP
rs1306096433 153 dbSNP
rs3203695 158 dbSNP
rs1220589935 163 dbSNP
rs972739965 166 dbSNP
rs1247763194 169 dbSNP
rs1448097132 170 dbSNP
rs1169822546 174 dbSNP
rs1433724828 178 dbSNP
rs185769648 181 dbSNP
rs2508657 190 dbSNP
rs1174062218 198 dbSNP
rs1178038696 199 dbSNP
rs1415234517 201 dbSNP
rs7350526 203 dbSNP
rs1361031037 206 dbSNP
rs1189728028 222 dbSNP
rs543582053 223 dbSNP
rs1252647842 224 dbSNP
rs910338790 229 dbSNP
rs563191090 232 dbSNP
rs755989196 241 dbSNP
rs191763879 243 dbSNP
rs1211318459 245 dbSNP
rs1312376753 253 dbSNP
rs1362745778 262 dbSNP
rs1217136890 269 dbSNP
rs1330531282 275 dbSNP
rs368927222 278 dbSNP
rs1288432855 292 dbSNP
rs947043229 293 dbSNP
rs183229926 296 dbSNP
rs1270342385 299 dbSNP
rs1304339414 301 dbSNP
rs902868188 307 dbSNP
rs934560432 308 dbSNP
rs1459029692 311 dbSNP
rs1217174783 313 dbSNP
rs1280119015 317 dbSNP
rs1323673221 320 dbSNP
rs1471881953 323 dbSNP
rs1258922950 326 dbSNP
rs1182982848 327 dbSNP
rs1483099961 330 dbSNP
rs895647704 335 dbSNP
rs1204840043 343 dbSNP
rs1012788163 345 dbSNP
rs1466028553 347 dbSNP
rs373550360 349 dbSNP
rs562970364 349 dbSNP
rs186183603 352 dbSNP
rs1326499321 358 dbSNP
rs528104608 361 dbSNP
rs1195791167 371 dbSNP
rs1228835948 380 dbSNP
rs1378092404 383 dbSNP
rs1300936871 386 dbSNP
rs1006734801 390 dbSNP
rs79035573 392 dbSNP
rs1189767601 393 dbSNP
rs1431506985 398 dbSNP
rs1166032961 400 dbSNP
rs567925841 413 dbSNP
rs1470375084 414 dbSNP
rs1412070479 421 dbSNP
rs1190971301 423 dbSNP
rs962361899 426 dbSNP
rs972303388 427 dbSNP
rs1158274479 429 dbSNP
rs1030579569 434 dbSNP
rs1458562853 437 dbSNP
rs1318710193 449 dbSNP
rs1349152840 451 dbSNP
rs1433815447 456 dbSNP
rs1276299104 461 dbSNP
rs543341979 465 dbSNP
rs1222217754 470 dbSNP
rs1321114747 472 dbSNP
rs1312610988 473 dbSNP
rs1230382953 477 dbSNP
rs1365696419 485 dbSNP
rs1297076447 486 dbSNP
rs954870544 492 dbSNP
rs1211230448 494 dbSNP
rs556785308 500 dbSNP
rs1227279367 505 dbSNP
rs1457831741 506 dbSNP
rs1348688671 510 dbSNP
rs986293537 513 dbSNP
rs761386377 515 dbSNP
rs570270289 516 dbSNP
rs947135268 524 dbSNP
rs1307326777 525 dbSNP
rs1426441730 530 dbSNP
rs1327719808 534 dbSNP
rs1351974398 543 dbSNP
rs978924487 544 dbSNP
rs1488097094 545 dbSNP
rs924258848 546 dbSNP
rs1289451607 550 dbSNP
rs1285392281 551 dbSNP
rs113221195 552 dbSNP
rs1342533916 553 dbSNP
rs1273654261 554 dbSNP
rs1225508664 558 dbSNP
rs1219622867 560 dbSNP
rs1386242361 561 dbSNP
rs1365608675 562 dbSNP
rs1310328195 565 dbSNP
rs1430956754 566 dbSNP
rs554483561 570 dbSNP
rs539086882 571 dbSNP
rs559118363 575 dbSNP
rs1480763895 576 dbSNP
rs1181562864 581 dbSNP
rs1199172447 583 dbSNP
rs572440198 585 dbSNP
rs948516452 586 dbSNP
rs1044226983 591 dbSNP
rs888292100 600 dbSNP
rs1193908125 606 dbSNP
rs990732476 606 dbSNP
rs916534773 610 dbSNP
rs970639860 614 dbSNP
rs879368971 618 dbSNP
rs1016765360 619 dbSNP
rs897823516 622 dbSNP
rs993939686 625 dbSNP
rs1282099656 629 dbSNP
rs780104234 636 dbSNP
rs1403388839 638 dbSNP
rs1030530174 642 dbSNP
rs1465240789 644 dbSNP
rs1426588851 645 dbSNP
rs954984313 657 dbSNP
rs986366140 666 dbSNP
rs1280697281 670 dbSNP
rs1179603571 671 dbSNP
rs1443870395 681 dbSNP
rs1256597772 682 dbSNP
rs1200085312 684 dbSNP
rs1356035064 688 dbSNP
rs1460193311 689 dbSNP
rs1017700380 696 dbSNP
rs1294146526 698 dbSNP
rs969293851 699 dbSNP
rs978530559 700 dbSNP
rs1204786844 701 dbSNP
rs1249670698 702 dbSNP
rs1334001109 710 dbSNP
rs924386834 712 dbSNP
rs112770037 714 dbSNP
rs992518122 715 dbSNP
rs916937130 716 dbSNP
rs1471649980 721 dbSNP
rs948589581 725 dbSNP
rs1473773796 728 dbSNP
rs554125192 731 dbSNP
rs1385698141 736 dbSNP
rs1442970418 739 dbSNP
rs1044342562 740 dbSNP
rs909678653 741 dbSNP
rs1282256110 744 dbSNP
rs1037783415 746 dbSNP
rs191429393 746 dbSNP
rs574674023 747 dbSNP
rs543394674 758 dbSNP
rs1367835317 759 dbSNP
rs1299284802 761 dbSNP
rs1051694312 766 dbSNP
rs890471896 773 dbSNP
rs1007725286 778 dbSNP
rs1043243 781 dbSNP
rs1446532300 782 dbSNP
rs1406992872 785 dbSNP
rs1391409659 787 dbSNP
rs1017849782 792 dbSNP
rs1422467219 800 dbSNP
rs1391802060 805 dbSNP
rs968903563 808 dbSNP
rs754226030 809 dbSNP
rs141611198 810 dbSNP
rs1341511395 819 dbSNP
rs955958684 828 dbSNP
rs1196460655 837 dbSNP
rs1220921268 840 dbSNP
rs1289742168 840 dbSNP
rs371962546 841 dbSNP
rs11227443 842 dbSNP
rs992590155 844 dbSNP
rs1360896228 846 dbSNP
rs1185416688 848 dbSNP
rs11227444 849 dbSNP
rs1448700948 850 dbSNP
rs1186230062 852 dbSNP
rs1422677865 854 dbSNP
rs982146038 858 dbSNP
rs1169050765 859 dbSNP
rs1409585714 866 dbSNP
rs773289564 872 dbSNP
rs1174566973 874 dbSNP
rs1478369152 875 dbSNP
rs1268275681 876 dbSNP
rs1197887504 878 dbSNP
rs1484354993 888 dbSNP
rs545456928 889 dbSNP
rs1204938976 892 dbSNP
rs1461995947 893 dbSNP
rs1270383283 895 dbSNP
rs1043248 898 dbSNP
rs1345031302 914 dbSNP
rs1282165683 915 dbSNP
rs1171465487 918 dbSNP
rs1403016451 920 dbSNP
rs9666374 923 dbSNP
rs1352313447 926 dbSNP
rs1308378980 929 dbSNP
rs1441160764 931 dbSNP
rs1352568369 932 dbSNP
rs969715034 934 dbSNP
rs11227445 940 dbSNP
rs1399515170 942 dbSNP
rs1468668231 943 dbSNP
rs1177154499 946 dbSNP
rs559008240 949 dbSNP
rs909823480 962 dbSNP
rs1434865427 970 dbSNP
rs528200348 972 dbSNP
rs1211799215 981 dbSNP
rs11227446 982 dbSNP
rs765896653 983 dbSNP
rs1221198158 986 dbSNP
rs1330648157 993 dbSNP
rs1288855090 996 dbSNP
rs1223160811 1009 dbSNP
rs1370903468 1014 dbSNP
rs941191142 1019 dbSNP
rs1037298467 1021 dbSNP
rs1449001229 1023 dbSNP
rs918447367 1030 dbSNP
rs548163601 1032 dbSNP
rs1328440525 1035 dbSNP
rs1389479826 1036 dbSNP
rs568002463 1039 dbSNP
rs929365530 1040 dbSNP
rs1182858726 1047 dbSNP
rs17411313 1049 dbSNP
rs1205462622 1052 dbSNP
rs1242101621 1054 dbSNP
rs17411320 1057 dbSNP
rs1201411930 1059 dbSNP
rs530376239 1060 dbSNP
rs17414987 1066 dbSNP
rs1051807369 1067 dbSNP
rs374788736 1067 dbSNP
rs17414994 1068 dbSNP
rs1214967274 1071 dbSNP
rs1315105723 1074 dbSNP
rs1314568929 1077 dbSNP
rs1464243708 1088 dbSNP
rs1381793472 1092 dbSNP
rs1313111373 1093 dbSNP
rs576195345 1096 dbSNP
rs1366022892 1100 dbSNP
rs34247845 1110 dbSNP
rs1288429502 1112 dbSNP
rs753228636 1113 dbSNP
rs1007547522 1116 dbSNP
rs145468882 1122 dbSNP
rs570233366 1123 dbSNP
rs1197811346 1124 dbSNP
rs1181300694 1126 dbSNP
rs1032228003 1129 dbSNP
rs1261788635 1130 dbSNP
rs1185469702 1131 dbSNP
rs1484624045 1136 dbSNP
rs564876428 1139 dbSNP
rs778018639 1141 dbSNP
rs1375417981 1142 dbSNP
rs34038114 1154 dbSNP
rs1358374403 1158 dbSNP
rs1289407799 1162 dbSNP
rs1481140482 1170 dbSNP
rs1179128519 1172 dbSNP
rs1043303 1174 dbSNP
rs956239561 1178 dbSNP
rs1407512724 1180 dbSNP
rs1369849850 1182 dbSNP
rs1294572769 1187 dbSNP
rs1457000103 1188 dbSNP
rs1013972998 1197 dbSNP
rs1024101255 1198 dbSNP
rs1431219637 1203 dbSNP
rs1169331993 1205 dbSNP
rs1387644993 1205 dbSNP
rs969705188 1220 dbSNP
rs751595254 1224 dbSNP
rs1382985269 1228 dbSNP
rs35154090 1228 dbSNP
rs1268842081 1229 dbSNP
rs979794225 1239 dbSNP
rs1300914580 1241 dbSNP
rs1266485328 1254 dbSNP
rs757421195 1255 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38974 Chronic obstructive pulmonary disease -0.8 8.0e-7 -0.838 8.6e-8 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.677 5.2e-4 -0.850 1.0e-6 20 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.745 1.1e-2 0.683 2.1e-2 9 Click to see details
GSE38226 Liver fibrosis 0.48 1.4e-2 0.456 1.9e-2 21 Click to see details
GSE28544 Breast cancer -0.443 1.5e-2 -0.323 6.2e-2 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.435 1.7e-2 0.165 2.2e-1 24 Click to see details
GSE28260 Renal cortex and medulla 0.471 5.2e-2 0.445 6.4e-2 13 Click to see details
GSE27834 Pluripotent stem cells 0.418 5.4e-2 0.362 8.4e-2 16 Click to see details
GSE17306 Multiple myeloma -0.173 1.2e-1 -0.117 2.1e-1 49 Click to see details
GSE21032 Prostate cancer 0.125 1.3e-1 0.214 2.6e-2 83 Click to see details
GSE21687 Ependynoma primary tumors -0.135 1.4e-1 -0.185 7.2e-2 64 Click to see details
GSE19350 CNS germ cell tumors -0.279 1.9e-1 -0.180 2.9e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer 0.196 2.0e-1 0.030 4.5e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.15 2.1e-1 -0.164 1.8e-1 32 Click to see details
GSE21849 B cell lymphoma -0.112 2.8e-1 -0.139 2.4e-1 29 Click to see details
GSE19536 Breast cancer 0.048 3.2e-1 0.069 2.5e-1 100 Click to see details
GSE14794 Lymphoblastoid cells 0.048 3.3e-1 0.098 1.8e-1 90 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.031 4.4e-1 0.027 4.5e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.016 4.7e-1 0.119 2.9e-1 23 Click to see details
GSE19783 ER- ER- breast cancer 0.004 4.9e-1 0.045 3.5e-1 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.404 0 -0.366 0 49 Click to see details
BRCA -0.273 0.01 -0.276 0.01 84 Click to see details
CHOL -0.702 0.02 -0.683 0.02 9 Click to see details
COAD 0.721 0.02 0.476 0.12 8 Click to see details
HNSC -0.286 0.03 -0.226 0.08 42 Click to see details
STAD 0.285 0.06 0.277 0.06 32 Click to see details
LUSC -0.195 0.12 -0.198 0.12 38 Click to see details
KIRP 0.181 0.16 0.215 0.12 32 Click to see details
KICH -0.184 0.19 -0.051 0.4 25 Click to see details
ESCA -0.293 0.19 -0.409 0.11 11 Click to see details
PRAD 0.126 0.19 0.147 0.15 50 Click to see details
BLCA 0.17 0.25 0.011 0.48 18 Click to see details
THCA -0.089 0.25 -0.093 0.24 59 Click to see details
PCPG -0.573 0.31 -0.500 0.33 3 Click to see details
PAAD 0.354 0.32 0.800 0.1 4 Click to see details
UCEC -0.072 0.38 -0.151 0.27 19 Click to see details
CESC 0.301 0.4 0.500 0.33 3 Click to see details
LUAD -0.049 0.44 -0.063 0.42 12 Click to see details
KIRC 0.004 0.49 0.047 0.35 68 Click to see details
KIRC 0.004 0.49 0.047 0.35 68 Click to see details
KIRC 0.004 0.49 0.047 0.35 68 Click to see details
205 hsa-miR-148a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000020 DNMT1 DNA methyltransferase 1 7 7
MIRT000297 HLA-G major histocompatibility complex, class I, G 2 1
MIRT000298 TGIF2 TGFB induced factor homeobox 2 3 2
MIRT000955 DNMT3B DNA methyltransferase 3 beta 5 2
MIRT003998 NR1I2 nuclear receptor subfamily 1 group I member 2 7 2
MIRT004504 RPS6KA5 ribosomal protein S6 kinase A5 4 1
MIRT005898 CCKBR cholecystokinin B receptor 4 3
MIRT006859 IRS1 insulin receptor substrate 1 2 1
MIRT006946 ACVR1 activin A receptor type 1 2 2
MIRT006975 BCL2 BCL2, apoptosis regulator 1 1
MIRT007017 TMED7 transmembrane p24 trafficking protein 7 1 1
MIRT025970 GPATCH8 G-patch domain containing 8 1 1
MIRT025971 TMEM14A transmembrane protein 14A 1 1
MIRT025972 ANP32A acidic nuclear phosphoprotein 32 family member A 1 1
MIRT025973 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT025974 HSP90B1 heat shock protein 90 beta family member 1 1 1
MIRT025975 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT025976 CYCS cytochrome c, somatic 1 1
MIRT025977 ADARB1 adenosine deaminase, RNA specific B1 1 1
MIRT025978 CBX3 chromobox 3 1 1
MIRT025979 UQCRQ ubiquinol-cytochrome c reductase complex III subunit VII 1 1
MIRT025980 SPRY2 sprouty RTK signaling antagonist 2 1 1
MIRT025981 PAN3 PAN3 poly(A) specific ribonuclease subunit 1 1
MIRT025982 KANSL1 KAT8 regulatory NSL complex subunit 1 1 1
MIRT025983 GAS1 growth arrest specific 1 2 6
MIRT025984 PTPN4 protein tyrosine phosphatase, non-receptor type 4 1 1
MIRT025985 ZNF92 zinc finger protein 92 1 1
MIRT025986 RAB10 RAB10, member RAS oncogene family 1 1
MIRT025987 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 3
MIRT025988 HCCS holocytochrome c synthase 1 1
MIRT025989 WAPAL WAPL cohesin release factor 1 1
MIRT025990 MPP5 membrane palmitoylated protein 5 1 1
MIRT025991 ZNF490 zinc finger protein 490 1 1
MIRT025992 RAB12 RAB12, member RAS oncogene family 2 3
MIRT025993 GNB5 G protein subunit beta 5 1 1
MIRT025994 SNAPIN SNAP associated protein 2 3
MIRT025995 PSMD9 proteasome 26S subunit, non-ATPase 9 1 1
MIRT025996 TRIM59 tripartite motif containing 59 1 1
MIRT025997 DYNLL2 dynein light chain LC8-type 2 1 1
MIRT025998 SECISBP2L SECIS binding protein 2 like 2 6
MIRT025999 LYSMD1 LysM domain containing 1 1 1
MIRT026000 PBXIP1 PBX homeobox interacting protein 1 2 2
MIRT026001 MTMR9 myotubularin related protein 9 1 1
MIRT026002 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 1 1
MIRT026003 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT026004 LBR lamin B receptor 1 1
MIRT026005 KIAA1549 KIAA1549 1 1
MIRT026006 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 1 1
MIRT026007 CDK19 cyclin dependent kinase 19 2 3
MIRT026008 RAB34 RAB34, member RAS oncogene family 2 3
MIRT026009 ARRDC3 arrestin domain containing 3 1 1
MIRT026010 PRNP prion protein 2 1
MIRT026011 HOXC8 homeobox C8 4 1
MIRT026012 TMEM9B TMEM9 domain family member B 1 1
MIRT026013 RASSF8 Ras association domain family member 8 1 1
MIRT026014 BTBD3 BTB domain containing 3 2 12
MIRT026015 TNRC6A trinucleotide repeat containing 6A 2 3
MIRT026016 SESTD1 SEC14 and spectrin domain containing 1 1 1
MIRT026017 CDC25B cell division cycle 25B 3 1
MIRT048023 MRPL45 mitochondrial ribosomal protein L45 1 1
MIRT048024 DENR density regulated re-initiation and release factor 1 1
MIRT048025 APPBP2 amyloid beta precursor protein binding protein 2 1 1
MIRT048026 SLC2A3 solute carrier family 2 member 3 1 1
MIRT048027 PTPN23 protein tyrosine phosphatase, non-receptor type 23 1 1
MIRT048028 VPS41 VPS41, HOPS complex subunit 1 1
MIRT048029 MSL3 MSL complex subunit 3 1 1
MIRT048030 AMELX amelogenin, X-linked 1 1
MIRT048031 OR2C3 olfactory receptor family 2 subfamily C member 3 1 1
MIRT048032 SLC25A3 solute carrier family 25 member 3 1 1
MIRT048033 APC APC, WNT signaling pathway regulator 1 1
MIRT048034 GOLIM4 golgi integral membrane protein 4 1 1
MIRT048035 MYCBP2 MYC binding protein 2, E3 ubiquitin protein ligase 1 1
MIRT048036 RPS17 ribosomal protein S17 1 1
MIRT048037 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT048038 WDTC1 WD and tetratricopeptide repeats 1 1 1
MIRT048039 HMGB1 high mobility group box 1 1 1
MIRT048040 MAP3K4 mitogen-activated protein kinase kinase kinase 4 4 2
MIRT048041 USP38 ubiquitin specific peptidase 38 1 1
MIRT048042 NONO non-POU domain containing octamer binding 1 1
MIRT048043 CCNI cyclin I 1 1
MIRT048044 AURKB aurora kinase B 1 1
MIRT052917 MMP7 matrix metallopeptidase 7 4 1
MIRT053185 WNT10B Wnt family member 10B 4 1
MIRT053199 MYC MYC proto-oncogene, bHLH transcription factor 2 1
MIRT053475 CDKN1B cyclin dependent kinase inhibitor 1B 4 5
MIRT053477 SERPINE1 serpin family E member 1 3 1
MIRT053478 ITGB8 integrin subunit beta 8 5 3
MIRT053479 VAV2 vav guanine nucleotide exchange factor 2 3 1
MIRT053480 ITGA5 integrin subunit alpha 5 3 1
MIRT053483 ROCK1 Rho associated coiled-coil containing protein kinase 1 6 3
MIRT053518 RUNX3 runt related transcription factor 3 2 1
MIRT053560 SMAD2 SMAD family member 2 3 1
MIRT054115 UNKL unkempt family like zinc finger 1 1
MIRT054388 MET MET proto-oncogene, receptor tyrosine kinase 3 1
MIRT057492 CEP55 centrosomal protein 55 2 4
MIRT062708 MLEC malectin 2 4
MIRT084562 BCL2L11 BCL2 like 11 2 1
MIRT105304 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT130076 TXNIP thioredoxin interacting protein 4 4
MIRT138426 KIF2C kinesin family member 2C 2 2
MIRT152411 ARID3A AT-rich interaction domain 3A 2 2
MIRT155749 SIK1 salt inducible kinase 1 2 6
MIRT210293 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT218522 HLA-A major histocompatibility complex, class I, A 2 2
MIRT222270 CCT6A chaperonin containing TCP1 subunit 6A 2 2
MIRT270936 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT280554 GLRX5 glutaredoxin 5 2 2
MIRT281136 PDIA3 protein disulfide isomerase family A member 3 3 1
MIRT296526 STX16 syntaxin 16 2 2
MIRT301572 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT347400 CEBPG CCAAT/enhancer binding protein gamma 2 2
MIRT382244 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT399584 RBM38 RNA binding motif protein 38 2 2
MIRT437409 MAFB MAF bZIP transcription factor B 1 1
MIRT438088 ERRFI1 ERBB receptor feedback inhibitor 1 2 1
MIRT438751 S1PR1 sphingosine-1-phosphate receptor 1 3 3
MIRT438752 USP4 ubiquitin specific peptidase 4 3 1
MIRT453164 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT456196 ZDHHC6 zinc finger DHHC-type containing 6 2 2
MIRT458103 TTLL1 tubulin tyrosine ligase like 1 2 2
MIRT459958 POC1A POC1 centriolar protein A 2 2
MIRT461329 MRPS27 mitochondrial ribosomal protein S27 2 2
MIRT462848 B4GALT7 beta-1,4-galactosyltransferase 7 2 2
MIRT463247 ZIC5 Zic family member 5 2 2
MIRT464041 WASL Wiskott-Aldrich syndrome like 2 2
MIRT466869 STX6 syntaxin 6 2 2
MIRT467697 SLC38A2 solute carrier family 38 member 2 2 4
MIRT468920 RPS6KA4 ribosomal protein S6 kinase A4 2 2
MIRT469506 RCC2 regulator of chromosome condensation 2 2 2
MIRT469815 RAB14 RAB14, member RAS oncogene family 2 2
MIRT470329 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT473770 MAP3K9 mitogen-activated protein kinase kinase kinase 9 5 3
MIRT477363 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT478215 DDX6 DEAD-box helicase 6 2 2
MIRT479812 CCNA2 cyclin A2 2 6
MIRT484939 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485432 KLF6 Kruppel like factor 6 9 3
MIRT485645 DICER1 dicer 1, ribonuclease III 2 4
MIRT487938 HLA-C major histocompatibility complex, class I, C 3 2
MIRT488937 ETV7 ETS variant 7 2 2
MIRT492821 PATL1 PAT1 homolog 1, processing body mRNA decay factor 2 2
MIRT496749 PDIK1L PDLIM1 interacting kinase 1 like 2 2
MIRT497883 SLC12A7 solute carrier family 12 member 7 2 2
MIRT500918 STARD13 StAR related lipid transfer domain containing 13 2 4
MIRT503176 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT505102 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 2
MIRT505256 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT511220 LNPEP leucyl and cystinyl aminopeptidase 2 4
MIRT513209 RFT1 RFT1 homolog 2 2
MIRT513617 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT522804 KPNA4 karyopherin subunit alpha 4 2 4
MIRT525443 RBM23 RNA binding motif protein 23 2 2
MIRT530302 AKAP17A A-kinase anchoring protein 17A 2 2
MIRT531689 MYO3A myosin IIIA 2 2
MIRT537300 FZD5 frizzled class receptor 5 2 2
MIRT541199 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT544732 NDRG1 N-myc downstream regulated 1 2 2
MIRT549174 BMP3 bone morphogenetic protein 3 2 2
MIRT549231 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT551864 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT559687 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT561658 RNF219 ring finger protein 219 2 2
MIRT561856 NPTX1 neuronal pentraxin 1 2 2
MIRT565733 SESN3 sestrin 3 2 2
MIRT566568 OTUD4 OTU deubiquitinase 4 2 2
MIRT567186 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT567834 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT574794 FAM104A family with sequence similarity 104 member A 2 2
MIRT576772 Tmem127 transmembrane protein 127 2 2
MIRT610545 WNT2B Wnt family member 2B 2 4
MIRT613042 FOXP1 forkhead box P1 2 2
MIRT615073 COLEC12 collectin subfamily member 12 2 2
MIRT617481 AP5B1 adaptor related protein complex 5 beta 1 subunit 2 2
MIRT622753 PHACTR2 phosphatase and actin regulator 2 2 2
MIRT625516 PPAPDC1A phospholipid phosphatase 4 2 2
MIRT628641 ABLIM1 actin binding LIM protein 1 2 2
MIRT630234 SORD sorbitol dehydrogenase 2 2
MIRT635946 PLA2G12A phospholipase A2 group XIIA 2 2
MIRT646776 IL23R interleukin 23 receptor 2 2
MIRT648163 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT653244 SOS2 SOS Ras/Rho guanine nucleotide exchange factor 2 5 2
MIRT661182 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT693234 KIAA0907 KIAA0907 2 4
MIRT693776 VGLL2 vestigial like family member 2 2 2
MIRT702589 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT715175 DTX4 deltex E3 ubiquitin ligase 4 2 2
MIRT722871 FAM212B family with sequence similarity 212 member B 2 2
MIRT723139 YPEL1 yippee like 1 2 2
MIRT723186 OVOL1 ovo like transcriptional repressor 1 2 2
MIRT732353 WNT1 Wnt family member 1 3 1
MIRT732362 STAT3 signal transducer and activator of transcription 3 3 1
MIRT734547 HNRNPK heterogeneous nuclear ribonucleoprotein K 2 0
MIRT734935 CXCR4 C-X-C motif chemokine receptor 4 1 0
MIRT736034 ITGA9 integrin subunit alpha 9 3 0
MIRT736105 PTEN phosphatase and tensin homolog 5 1
MIRT736114 IL15 interleukin 15 2 0
MIRT736501 AKT1 AKT serine/threonine kinase 1 1 0
MIRT737228 PCGEM1 PCGEM1, prostate-specific transcript (non-protein coding) 2 0
MIRT737363 UBAP2 ubiquitin associated protein 2 3 0
MIRT737364 FOXK2 forkhead box K2 3 0
MIRT755397 WNT10A Wnt family member 10A 2 1
MIRT755440 LDLR low density lipoprotein receptor 1 1
MIRT756258 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 3 1
MIRT756289 SLC7A11 solute carrier family 7 member 11 2 1
MIRT756402 CNTN4 contactin 4 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-148a Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-148a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
miR-148a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-148a Bilobalide NULL 73581 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Bilobalide NULL 73581 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-148a Daidzein NULL 5281708 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Dexamethasone approved 5743 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-148a Paclitaxel approved 36314 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Vinblastine approved 13342 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 down-regulated
miR-148a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-148a 5a-dihydrotestosterone (DHT) NULL 15 Quantitative real-time PCR LNCaP cells 22266859 2012 up-regulated
miR-148a Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miR-148a Celecoxib approved 2662 Microarray gastric cancer cells. 23001726 2013 up-regulated
miR-148a Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miR-148a 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 up-regulated
miR-148a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-148a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer tissue
hsa-mir-148a Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer tissue
hsa-mir-148a Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-148a Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-148a Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-148a Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-148a Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-148a-3p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-148a-3p (2,3-dihydroxyphenyl)-[1-[(4-fluorophenyl)methyl]-4-hydroxyindol-3-yl]methanone 42624812 NSC746053 sensitive
hsa-miR-148a-3p (2E)-2-[(2-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516827 NSC639520 sensitive
hsa-miR-148a-3p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-148a-3p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-148a-3p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 resistant
hsa-miR-148a-3p (4z,5z)-1-[(e)-(2-hydroxyphenyl)methyleneamino]-3-phenyl-4,5-bis(phenylimino)imidazolidine-2-thione 135509182 NSC671409 resistant
hsa-miR-148a-3p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-148a-3p (E)-1-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54612660 NSC741738 resistant
hsa-miR-148a-3p (e)-3-chloro-2-(3,4-dimethoxyphenyl)-3-(3,4-dipropoxyphenyl)prop-2-enal 3004402 NSC650594 sensitive
hsa-miR-148a-3p (e)-but-2-enedioic acid;1-(7,8,9,10-tetrahydrophenanthridin-6-yl)piperidin-4-amine 5471308 NSC710333 sensitive
hsa-miR-148a-3p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-methylphenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351426 NSC670225 sensitive
hsa-miR-148a-3p .beta.-d-glucopyranose, 2,3-o-(diethylstannylene)- 16683462 NSC306911 sensitive
hsa-miR-148a-3p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 sensitive
hsa-miR-148a-3p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-148a-3p [1,1,1,3,3,3-hexafluoro-2-(quinolin-2-ylmethyl)propan-2-yl] acetate 379602 NSC664303 sensitive
hsa-miR-148a-3p [2-(4-methoxyphenyl)-2-oxoethyl] (2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[[(2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[2-(4-methoxyphenyl)-2-oxoethoxy]-3-oxopropyl]diselanyl]propanoate 45029327 NSC746149 resistant
hsa-miR-148a-3p [4-[[2-(1h-indol-2-yl)-1,3-dioxolan-2-yl]methyl]-1-piperidyl]-phenyl-methanone 398268 NSC707982 sensitive
hsa-miR-148a-3p [7-fluoro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-(furan-2-yl)methanone 23635646 NSC736443 sensitive
hsa-miR-148a-3p [acetyl(diphenyl)[?]yl] acetate 363302 NSC628121 sensitive
hsa-miR-148a-3p 1-((4-methylene-5-oxo-2-phenyltetrahydro-2-furanyl)methyl)dihydro-2,4(1h,3h)-pyrimidinedione 381497 NSC668253 sensitive
hsa-miR-148a-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 sensitive
hsa-miR-148a-3p 1-[(1e)-2,3,3-trichloro-1-[chloro(nitro)methylene]allyl]piperidine 3004947 NSC665087 sensitive
hsa-miR-148a-3p 1-[(4-fluorophenyl)amino]-2,3-propanopyrido[1,2-a]benzimidazole-4-carbonitrile 395404 NSC699940 resistant
hsa-miR-148a-3p 1-cyclohexyl-3-[(e)-(6-methyl-2-pyridyl)methyleneamino]thiourea 9571907 NSC670782 sensitive
hsa-miR-148a-3p 12-(3,5-ditert-butyl-4-hydroxyphenyl)-1,4,7,10,13,16-hexaoxacyclooctadecane-2,9-dione 386885 NSC679743 resistant
hsa-miR-148a-3p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 resistant
hsa-miR-148a-3p 17-methyl-13,14,17-triazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,8,11(16),14-heptaen-12-one 403909 NSC719502 resistant
hsa-miR-148a-3p 2-(2-naphthyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 388200 NSC682768 resistant
hsa-miR-148a-3p 2-(2-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468909 NSC679021 sensitive
hsa-miR-148a-3p 2-(2,4-dichlorobenzyl)-3,5,6-trimethyl-2h-indazole-7-carbonitrile 367590 NSC637422 resistant
hsa-miR-148a-3p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-148a-3p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepine-6-thione 4998423 NSC684481 resistant
hsa-miR-148a-3p 2-(3-methylbutylsulfanyl)naphthalene-1,4-dione 315743 NSC241494 sensitive
hsa-miR-148a-3p 2-(3-phenyl-4,5-bis(phenylimino)-1,3-thiazolidin-2-ylidene)malononitrile 383253 NSC671367 sensitive
hsa-miR-148a-3p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 sensitive
hsa-miR-148a-3p 2-(4-isothiocyanatophenyl)sulfanylacetic acid 345648 NSC403376 sensitive
hsa-miR-148a-3p 2-(6-ethenyl-4-hydroxy-6-methyl-3-methylidene-2-oxo-4,5,7,7a-tetrahydro-3aH-1-benzofuran-7-yl)prop-2-enal 495207 NSC645991 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]-1-(2-nitrophenyl)prop-2-en-1-one 411522 NSC34821 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]-1-(2,5-dimethylphenyl)prop-2-en-1-one 436059 NSC382001 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]cyclopentan-1-one 244760 NSC621888 sensitive
hsa-miR-148a-3p 2-[(z)-2-(benzenesulfonyl)-2-(5-nitrofuran-2-yl)ethenyl]-5-nitrofuran 6072945 NSC291049 sensitive
hsa-miR-148a-3p 2-[(Z)-2-[3-[3-methoxy-5-(trifluoromethyl)phenyl]-1,2,4-triazol-1-yl]ethenyl]-1,3,4-oxadiazole 57524026 NSC757569 sensitive
hsa-miR-148a-3p 2-[5-[4-[5-[4-(6-morpholin-4-yl-1H-benzimidazol-2-yl)phenoxy]pentyl]piperazin-1-yl]pentyl]benzo[de]isoquinoline-1,3-dione 44219118 NSC743432 sensitive
hsa-miR-148a-3p 2-acetamido-6-methyl-8-hydroxy-1,4-naphthaquinone 377214 NSC658450 sensitive
hsa-miR-148a-3p 2-amino-6-[4-[[4,6-bis(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-4-(4-methoxyphenyl)pyridine-3-carbonitrile 45028694 NSC743853 sensitive
hsa-miR-148a-3p 2-nitro-1-phenylpropan-1-ol 226118 NSC16258 sensitive
hsa-miR-148a-3p 2,3-bis(naphthalen-2-ylsulfanyl)naphthalene-1,4-dione 312602 NSC222722 sensitive
hsa-miR-148a-3p 2,5,9,12-tetrathiabicyclo[11.4.0]heptadeca-1(13),14,16-triene-15,16-dicarbonitrile 387185 NSC680721 resistant
hsa-miR-148a-3p 2,6-bis(4-morpholinylmethyl)cyclohexanone,dihydrochloride NSC38535 sensitive
hsa-miR-148a-3p 2,6-bis[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 358899 NSC619042 sensitive
hsa-miR-148a-3p 3-(3-chloro-4-methoxyphenyl)-N-[2-(dimethylamino)ethyl]-4-pyridin-4-ylpyrazole-1-carboxamide 60147896 NSC752885 resistant
hsa-miR-148a-3p 3-(4-chlorophenyl)-6-(5-nitrofuran-2-yl)-7H-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine 364212 NSC629974 sensitive
hsa-miR-148a-3p 3-[2-[(3,5-dichlorophenyl)amino]thiazol-4-yl]chromen-2-one 395985 NSC701109 resistant
hsa-miR-148a-3p 3-[2-[[5-[(4-bromophenyl)diazenyl]-2-hydroxyphenyl]-phenylsulfanylmethyl]hydrazinyl]-3-oxo-n-phenylpropanamide 377943 NSC659611 sensitive
hsa-miR-148a-3p 3-bromo-1-oxo-2-phenylthiochromen-4-one 5472015 NSC715997 sensitive
hsa-miR-148a-3p 3-chloro-4-methyl-7-((2-methyl-4-methylene-5-oxotetrahydro-2-furanyl)methoxy)-2h-chromen-2-one 381507 NSC668263 sensitive
hsa-miR-148a-3p 3-deazaneplanocin, hydrochloride 358176 NSC617989 sensitive
hsa-miR-148a-3p 4-(1-(4-aminophenyl)-3,4-diphenyl-1h-1.lambda.~4~-thien-1-yl)phenylamine 392992 NSC694234 resistant
hsa-miR-148a-3p 4-(2-(((6-bromo-1,3-benzodioxol-5-yl)methyl)amino)ethyl)phenol 290548 NSC154572 sensitive
hsa-miR-148a-3p 4-(2-azidophenothiazin-10-yl)-N,N-dimethylbutan-1-amine;oxalic acid 385933 NSC677395 sensitive
hsa-miR-148a-3p 4-[3-(4-chlorophenyl)-5-(2,5-dimethoxyphenyl)pyrazol-1-yl]benzenesulfonamide 24204421 NSC731805 sensitive
hsa-miR-148a-3p 4-amino-2-(4-chloroanilino)-5-(4-chlorobenzoyl)-n-phenyl-1h-pyrrole-3-carbothioamide 5472776 NSC721531 resistant
hsa-miR-148a-3p 4-amino-3,5-dichloro-n-(3-(4-(2-methoxyphenyl)-1-piperazinyl)propyl)benzamide 379857 NSC664993 sensitive
hsa-miR-148a-3p 4-morpholinecarbodithioic acid, antimony complex NSC625498 sensitive
hsa-miR-148a-3p 5-[2-(4-methoxyphenyl)ethyl]-1,2,3-dimethoxy benzene NSC631356 sensitive
hsa-miR-148a-3p 5,6,11,12-tetramethyl-5,5a,6,11,11a,12-hexahydroquinoxalino[2,3-b]quinoxaline 365519 NSC633207 sensitive
hsa-miR-148a-3p 5,7-dihydroquinolino[3,2-d][1]benzazepine-6-thione 3005168 NSC679092 resistant
hsa-miR-148a-3p 6-(3-azidopropyl)-2,3-dimethoxy-5,11-dioxoindeno[1,2-c]isoquinoline-9-carbonitrile 17755511 NSC734749 resistant
hsa-miR-148a-3p 7-chloro-5-hydroxy-2-methoxy-2,4-dimethyl-1H-benzo[e][1]benzofuran-6,9-dione 359534 NSC620517 sensitive
hsa-miR-148a-3p 7-hydroxystaurosporine 5351376 NSC638646 resistant
hsa-miR-148a-3p 8-{[(3as)-2-methylhexahydro-1h-pyrrolo[1,2-c][1,3,2]diazaphosphol-1-yl]oxy}quinoline 402496 NSC716522 sensitive
hsa-miR-148a-3p 8-fluoro-11-methyl-1h-benzo[a]carbazole-1,4(11h)-dione 381772 NSC668844 sensitive
hsa-miR-148a-3p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 sensitive
hsa-miR-148a-3p 9-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386894 NSC679796 sensitive
hsa-miR-148a-3p 9-isobutyl-6-(((2-methyl-1-naphthyl)methyl)thio)-9h-purin-2-amine 244996 NSC56452 sensitive
hsa-miR-148a-3p 9h-purine, 2-amino-6-(2,4-dichlorobenzylthio)-9-isobutyl- 240896 NSC47786 sensitive
hsa-miR-148a-3p Ab01327238-02 6892730 NSC670969 sensitive
hsa-miR-148a-3p Acetamide, n-(2-mercaptoethyl)-, benzoate (6ci, 7ci) 281604 NSC134459 sensitive
hsa-miR-148a-3p Aj-131/36477019 384476 NSC674278 resistant
hsa-miR-148a-3p Aspiculamycin hcl 5458423 NSC200692 resistant
hsa-miR-148a-3p Auranofin 6333901 NSC321521 sensitive
hsa-miR-148a-3p Baccharin 5358645 NSC269757 sensitive
hsa-miR-148a-3p Benzene, 1,1'-[(1,3-butadiene-1,4-diyl)sulfonyl]bis 5468033 NSC662781 sensitive
hsa-miR-148a-3p Caracemide 54747 NSC253272 sensitive
hsa-miR-148a-3p Cbmicro_021216 812842 NSC707055 sensitive
hsa-miR-148a-3p Chimaphilin 101211 NSC400245 sensitive
hsa-miR-148a-3p Cis-amminedichloro(4-methoxyphenethylamine)platinum(ii) 498559 NSC631306 sensitive
hsa-miR-148a-3p Compactin 2854 NSC281245 resistant
hsa-miR-148a-3p Copper;(ne,3z)-n-[1-(6-methylpyridazin-3-yl)ethylidene]-3-azabicyclo[3.2.2]nonane-3-carbohydrazonothioate 9578854 NSC633271 sensitive
hsa-miR-148a-3p Cyanocycline a 100158 NSC349644 sensitive
hsa-miR-148a-3p Cycloalkannin 133408 NSC301457 sensitive
hsa-miR-148a-3p Cyclopentanone, 2,5-bis[(trimethylamino)methyl]-, iodide 360925 NSC623639 sensitive
hsa-miR-148a-3p Cytembena 23663958 NSC104801 sensitive
hsa-miR-148a-3p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-148a-3p Dasatinib 3062316 NSC732517 approved resistant
hsa-miR-148a-3p Dibutyl(bis((3-(2-fluorophenyl)acryloyl)oxy))stannane 16683204 NSC643860 sensitive
hsa-miR-148a-3p Dichloroallyl lawsone 277767 NSC126771 sensitive
hsa-miR-148a-3p Dichlorodipropyltin 93562 NSC92618 sensitive
hsa-miR-148a-3p Dichloroiron;(NE,1E)-N-(1-pyridin-2-ylethylidene)azepane-1-carbohydrazonothioate 9578789 NSC338304 sensitive
hsa-miR-148a-3p Diethyl 2-[[4-(3-phenylquinoxalin-2-yl)oxybenzoyl]amino]pentanedioate 390812 NSC688814 resistant
hsa-miR-148a-3p Diketocoriolin b 294475 NSC163027 sensitive
hsa-miR-148a-3p Enhydrin a 5359029 NSC294601 sensitive
hsa-miR-148a-3p Entinostat 4261 NSC706995 sensitive
hsa-miR-148a-3p Ethanone, 1-(2-pyrimidinyl)-, (2-benzoxazolyl)hydrazone 9572051 NSC693639 sensitive
hsa-miR-148a-3p Ethyl 3-[[5-[(e)-3-methoxy-3-oxoprop-1-enyl]-1h-imidazol-4-yl]diazenyl]benzoate 135436270 NSC716679 sensitive
hsa-miR-148a-3p Ethyl 3-benzyl-2-methyl-4,5-dioxobenzo[e]indole-1-carboxylate 406008 NSC723888 sensitive
hsa-miR-148a-3p Ethyl 7-(3,4-difluorophenyl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399952 NSC711104 resistant
hsa-miR-148a-3p Gold(1+), bis(trimethylphosphine)-, chloride 6333886 NSC313985 sensitive
hsa-miR-148a-3p Gtpl8141 44478401 NSC752203 resistant
hsa-miR-148a-3p Gw410563a 10425574 NSC756225 resistant
hsa-miR-148a-3p Gw559768x 9927432 NSC756251 resistant
hsa-miR-148a-3p Gw612286x 9822610 NSC756278 resistant
hsa-miR-148a-3p Gw643971x 135778715 NSC756297 resistant
hsa-miR-148a-3p Insariotoxin 6711181 NSC138780 sensitive
hsa-miR-148a-3p Isodonol 317640 NSC250682 sensitive
hsa-miR-148a-3p J7x181m78y 395460 NSC700023 resistant
hsa-miR-148a-3p Ldn-211904 46175113 NSC751644 resistant
hsa-miR-148a-3p Ls-123342 5469111 NSC683328 sensitive
hsa-miR-148a-3p Methyl 1-[[N-[(3-methoxycarbonyl-5-methylpyrazol-1-yl)methyl]anilino]methyl]-5-methylpyrazole-3-carboxylate 404564 NSC720860 sensitive
hsa-miR-148a-3p Methyl 2-[(2e)-2-[(2,6-dichlorophenyl)methylidene]hydrazinyl]-5-(3,4,5-trimethoxyphenyl)-1h-pyrrole-3-carboxylate 45029264 NSC745940 resistant
hsa-miR-148a-3p Methyl N-[(E)-1-pyridin-2-ylethylideneamino]carbamodithioate 5947235 NSC251190 sensitive
hsa-miR-148a-3p Methylene blue 6099 NSC617593 approved sensitive
hsa-miR-148a-3p N'-[1-(1-benzothiophen-2-yl)cyclohexyl]-n-methylpropane-1,3-diamine;(e)-but-2-enedioic acid 54611499 NSC708074 sensitive
hsa-miR-148a-3p N-(((2-methoxy-5-(trifluoromethyl)anilino)carbonyl)oxy)butanimidoyl chloride 9556202 NSC672059 sensitive
hsa-miR-148a-3p N-(2-((((4-methoxyphenyl)diazenyl)carbonyl)amino)-4-methylpentanoyl)phenylalanine 386436 NSC678404 sensitive
hsa-miR-148a-3p N-(2,5-dimethylphenyl)-2-(3-oxo-4H-1,4-benzothiazin-2-yl)acetamide 366111 NSC634398 resistant
hsa-miR-148a-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 sensitive
hsa-miR-148a-3p N-(4-methoxyphenyl)-3-[4-[(4-methylphenyl)diazenyl]-3,5-diphenylpyrazol-1-yl]-3-oxopropanamide 367846 NSC637921 resistant
hsa-miR-148a-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 sensitive
hsa-miR-148a-3p N-[(e)-(5-chloro-2-hydroxyphenyl)methylideneamino]-2-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968273 NSC747459 sensitive
hsa-miR-148a-3p N-[2-(1H-indol-3-yl)ethyl]-1,1-dioxo-2-(3-propan-2-yloxyphenyl)-4H-pyrido[4,3-e][1,2,4]thiadiazin-3-imine 135426715 NSC710895 sensitive
hsa-miR-148a-3p N-[4-[2-(2,4-dinitrophenyl)-3-(3-ethoxy-4-hydroxyphenyl)-3,4-dihydropyrazol-5-yl]phenyl]-2-methyl-5-nitrobenzenesulfonamide 402369 NSC716281 resistant
hsa-miR-148a-3p N-[4-[hydroxy(methyl)amino]-6-(propylamino)-1,3,5-triazin-2-yl]-n-methylhydroxylamine 45029482 NSC746928 sensitive
hsa-miR-148a-3p N,N'-bis(3-aminopropyl)-N,N'-dibenzylbutane-1,4-diamine;2,2,2-trifluoroacetic acid 389631 NSC685976 resistant
hsa-miR-148a-3p N,N-dimethyl-4-[(Z)-(6-methylindolo[1,2-b]indazol-6-ium-11-ylidene)methyl]aniline;trifluoromethanesulfonate 5471987 NSC715775 sensitive
hsa-miR-148a-3p Navan 941650 NSC108165 sensitive
hsa-miR-148a-3p Neuro_000327 16683203 NSC643859 sensitive
hsa-miR-148a-3p NSC600301 NSC600301 sensitive
hsa-miR-148a-3p NSC607281 NSC607281 sensitive
hsa-miR-148a-3p NSC621335 NSC621335 sensitive
hsa-miR-148a-3p NSC621339 NSC621339 sensitive
hsa-miR-148a-3p NSC625496 NSC625496 sensitive
hsa-miR-148a-3p NSC641052 NSC641052 sensitive
hsa-miR-148a-3p NSC716032 NSC716032 sensitive
hsa-miR-148a-3p Oridonin (thiol adduct of) 432952 NSC319730 sensitive
hsa-miR-148a-3p Oxin 1923 NSC2039 approved sensitive
hsa-miR-148a-3p Phenol, 4,4'-(5,5'-biisoxazole-3,3'-diyl)bis- 386651 NSC679108 sensitive
hsa-miR-148a-3p Physalin f 433531 NSC661115 sensitive
hsa-miR-148a-3p Pmp (van) 72508 NSC1906 sensitive
hsa-miR-148a-3p Pyrazino[1,2-a]benzimidazole, 1,3-diphenyl- 384474 NSC674276 resistant
hsa-miR-148a-3p Quinolin-8-yl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402508 NSC716535 sensitive
hsa-miR-148a-3p Sergeolide,desacetyl 125729 NSC364170 sensitive
hsa-miR-148a-3p Staurosporine 5459111 NSC618487 resistant
hsa-miR-148a-3p Stk386853 5291187 NSC65628 sensitive
hsa-miR-148a-3p Streptovaricin b 135443622 NSC156215 sensitive
hsa-miR-148a-3p Tetraplatin 13920603 NSC363812 sensitive
hsa-miR-148a-3p Trimethyl-[(1-oxo-3,4-dihydro-2H-naphthalen-2-yl)methyl]azanium;iodide 375929 NSC656280 sensitive
hsa-miR-148a-3p U-22265 265952 NSC102810 sensitive
hsa-miR-148a-3p Ver a 5351232 NSC126728 sensitive
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3)
hsa-miR-148a-3p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Adenocarcinoma cell line (OE19)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Adenocarcinoma cell line (OE19)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant Low Squamous Cell Carcinoma cell line (SCC-11)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-148a-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-148a-3p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-148a-3p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (22Rv1, DU-145, PC-3,22Rv1RD, DU-145RD, PC-3RD)
hsa-miR-148a-3p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (PC-3)
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-148a-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (PANC-1, MIA-PaCa-2)
hsa-miR-148a-3p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive Low ER-Positive Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Renal Cell Cancer cell line (Caki)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (BGC823, SGC7901)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7C)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Adenocarcinoma cell line (MCF-7, MDA-MB-231)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Adenocarcinoma cell line (MCF-7, MDA-MB-231)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (VCaP-R)
hsa-miR-148a-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Colorectal Cancer cell line (SW480)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKVO3ip1, HeyA8)
hsa-miR-148a-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-CC, MCF-7-TT, MCF-7-21)
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly19, RIVA, SU DHL-8, U2932)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1, PANC-1)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-148a-3p Bromocriptine 31101 NSC169774 approved sensitive Low Prolactinoma tissue
hsa-miR-148a-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-148a-3p Cyclophosphamide 2907 NSC26271 approved resistant High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-148a-3p Rhamnetin 5281691 NSC19802 sensitive Low Hepatocellular Carcinoma cell line (MHCC97-H, HepG2)
hsa-miR-148a-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa, SiHa)
hsa-miR-148a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (A375)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-148a-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-148a-3p Ribavirin+Pegylated IFNa-2b sensitive tissue (chronic hepatitis C)
hsa-miR-148a-3p Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-miR-148a-3p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-148a-3p Testosterone+Letrozole sensitive cell line (MCF-7)
hsa-miR-148a-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-148a-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-148a-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-148a-3p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-148a-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR1)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-148a-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-148a-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission