miRTarBase - #MIRT025986


—
pre-miRNA Information
pre-miRNA hsa-mir-148a   
Genomic Coordinates chr7: 25949919 - 25949986
Description Homo sapiens miR-148a stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-148a-3p
Sequence 44| UCAGUGCACUACAGAACUUUGU |65
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs772747528 2 dbSNP
rs1290582082 8 dbSNP
rs370090919 11 dbSNP
rs771952261 13 dbSNP
rs1249161151 16 dbSNP
rs748063984 19 dbSNP
rs774196394 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RAB10   
Synonyms -
Description RAB10, member RAS oncogene family
Transcript NM_016131   
Expression
Putative miRNA Targets on RAB10
3'UTR of RAB10
(miRNA target sites are highlighted)		 
>RAB10|NM_016131|3'UTR
   1 GCATTCTCCTGTTCCATCAGTTGCCATCCACTACCCCGTTTTCTCTTCTTGCTGCAAAATAAACCACTCTGTCCATTTTT
  81 AACTCTAAACAGATATTTTTGTTTCTCATCTTAACTATCCAAGCCACCTATTTTATTTGTTCTTTCATCTGTGACTGCTT
 161 GCTGACTTTATCATAATTTTCTTCAAACAAAAAAATGTATAGAAAAATCATGTCTGTGAGTTCATTTTTAAATGTACTTG
 241 CTCAGCTCAACTGCATTTCAGTTGTATTATAGTCCAGTTCTTATCAACATTAAAACCTATAGCAATCATTTCAAATCTAT
 321 TCTGCAAATTGTATAAGAATAAAGTTAGAATTAACAATTTTATTTTGTACAACAGTGGAATTTTCTGTCATGGATAATGT
 401 GCTTGAGTCCCTATAATCTATAGACATGTGATAGCAAAAGAAACAAACAAAAGCCAGGAAAACACTCATTTTCGCCTTGA
 481 ATATGTAAATGGGATTAATTTTGTCCTGTGCCTTATGTGGAAAGGAACTTCTTTGGTTTTCCTTTTTTGTTCTGGTGGAA
 561 GCATGTGCAGGAGACATATCATCCAAACATAAACCATTAAAATGTTTGTGGTTTGCTTGGCTGTAATTTTCAAAGTAGTT
 641 AATTGAGGACAAAGGGTAATGCAGAAGTGATAGCTTTGGTTTGCTGAGTCTTGTTTTAAGTGGCCTTGATATTTAAAACT
 721 ATTCCTGCCACCATTTCTTCTCCTTGGCCACTTCTTCCTTGCGTCTCCCTGCATGCTGCTTTATTTGCTTCTCCCTCCCC
 801 AACCACCTCATGGTATATTTAAGAGTGAAAGGGACAAACTAGTAGGTTTGTCAAGTTTAATATAAAGCACTGATGTAACT
 881 TGCTAGGTAAACGGAAAGATAAGTTCTAACTGCCTACTATCCAATGTCAGTTAATTGGTGTCTTCCCCCCTCATTTGCTC
 961 TCTTCCCTAAAATGTGTCCCAGATGCCTTCATTTGCTGTTTTACTTCTATGTTCTGCTTTTCCTCCTCTCTTTGTTCCCT
1041 TCCTGTCTATCCATTGAGTTTATGAAATGGAAGAGTTAACTGCATGCACTAGTGTTTGGAGGGTGTTGTGGTTTGTCTTT
1121 CTAATTAGGTGTATAGCCTATTCACTTTCCTAGAATAAATCTCTTAACCTAAATTTGAGTAGTCTGCATTTTGGCAACTC
1201 CTCTAGCAGCTTGGTAGCCTAGTACAGGTTGTTTTTTTAAAAAAGGAAAAGCAGGAAGGAGGAGTGAATTTTATTAACAT
1281 GTTTGCCAAATGTATTGAGATTTGGCCTCTGAAGAACACTTTTTCAGTGTTAAGTTTCTTTACCTTAAGATTCAGAAATA
1361 CTTTAGAATATTATTAATTTTAAGTCCTGTCTTTACATCCTTTTGGAAAACTTGTATTACCATGGGTTTGGAAAAAGGAC
1441 AACGAAAGGCTTTTCATGTAAAGATAAGATCTTTAGCTATCTCTAACCCTGTCCTTTTTTCACTGCATTTTTTCTAGTTT
1521 TGCTTCATTGCTTATCATTAGGATAGGGTAAGTGAAGTTTGCTATGCTGCTAGCATCCTAAGATGATACCTTTGTTGAAA
1601 GAATTGTGAATAGCATGATTCATTTCTAGCAGAGGCTGAGTTTAGGACAGCAGCTTCCATTGAGAAGTCTTTCTGTGTCG
1681 TGAATAGCATTTTAATGACCTCTTGGCTCACATAAGCAAACAACATAGGGACGTATCTGCTATGAAAATCCACAAATTTT
1761 TCAGATAGTGCCCTAAAAACAATTTTATATGCCTCACTGGTTGTTATTCTTAGGTTATTCCCACACTTGACTTTATCATT
1841 GTTTACTACTAGTAAAAAGCAGCATTGCCAAATAATCCCTAATTTTCCACTAAAAATATAATGAAATGATGTTAAGCTTT
1921 TTGAAAAGTTTAGGTTAAACCTACTGTTGTTAGATTAATGTATTTGTTGCTTCCCTTTATCTGGAATGTGGCATTAGCTT
2001 TTTTATTTTAACCCTCTTTAATTCTTATTCAATTCCATGACTTAAGGTTGGAGAGCTAAACACTGGGATTTTTGGATAAC
2081 AGACTGACAGTTTTGCATAATTATAATCGGCATTGTACATAGAAAGGATATGGCTACCTTTTGTTAAATCTGCACTTTCT
2161 AAATATCAAAAAAGGGAAATGAAGTATAAATCAATTTTTGTATAATCTGTTTGAAACATGAGTTTTATTTGCTTAATATT
2241 AGGGCTTTGCCCCTTTTCTGTAAGTCTCTTGGGATCCTGTGTAGAAGCTGTTCTCATTAAACACCAAACAGTTAAGTCCA
2321 TTCTCTGGTACTAGCTACAAATTCGGTTTCATATTCTACTTAACAATTTAAATAAACTGAAATATTTCTAGATGGTCTAC
2401 TTCTGTTCATATAAAAACAAAACTTGATTTCCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugUUUCAA--GACAUCACGUGAcu 5'
            |:||||  ||| | ||||||  
Target 5' gaAGAGTTAACTGCA-TGCACTag 3'
 1070 - 1092 145.00 -12.00
2 
miRNA  3' uguUUCAAG--ACAUCACGUGACu 5'
             |||||:  | ||  |||||| 
Target 5' gtcAAGTTTAATATAAAGCACTGa 3'
 850 - 873 133.00 -10.74
3 
miRNA  3' ugUUUCAAGACAUC--ACGUGAcu 5'
            ||| ||  ||||  ||||:|  
Target 5' ctAAATTTGAGTAGTCTGCATTtt 3'
 1169 - 1192 130.00 -6.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30448918 10 COSMIC
COSN31505302 24 COSMIC
COSN30140544 39 COSMIC
COSN31493534 60 COSMIC
COSN31540169 70 COSMIC
COSN30125980 121 COSMIC
COSN29252075 202 COSMIC
COSN26034832 244 COSMIC
COSN6177136 270 COSMIC
COSN31519516 339 COSMIC
COSN31540595 482 COSMIC
COSN7051804 508 COSMIC
COSN28628417 542 COSMIC
COSN31513369 662 COSMIC
COSN30545046 713 COSMIC
COSN24298644 856 COSMIC
COSN31583221 1058 COSMIC
COSN31527582 1162 COSMIC
COSN26033813 1237 COSMIC
COSN17943091 1251 COSMIC
COSN27468551 1300 COSMIC
COSN31609671 1315 COSMIC
COSN30174370 1339 COSMIC
COSN32065434 1369 COSMIC
COSN28428641 1513 COSMIC
COSN30174580 1527 COSMIC
COSN26649299 1531 COSMIC
COSN31607161 1602 COSMIC
COSN31592896 1723 COSMIC
COSN26596429 1756 COSMIC
COSN31531970 2090 COSMIC
COSN30173165 2277 COSMIC
COSN31561408 2289 COSMIC
COSN26642856 2296 COSMIC
COSN30173137 2296 COSMIC
rs142787485 267 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774344763 4 dbSNP
rs1331133253 6 dbSNP
rs746364791 9 dbSNP
rs772775405 11 dbSNP
rs775933068 15 dbSNP
rs867671492 16 dbSNP
rs761137629 25 dbSNP
rs377740486 26 dbSNP
rs371382505 27 dbSNP
rs1432140667 33 dbSNP
rs761417161 34 dbSNP
rs764786819 35 dbSNP
rs377461983 38 dbSNP
rs370145200 39 dbSNP
rs1383298271 49 dbSNP
rs766316364 53 dbSNP
rs968317891 64 dbSNP
rs1016416685 65 dbSNP
rs1325733722 74 dbSNP
rs979284702 76 dbSNP
rs561289040 94 dbSNP
rs1353107089 102 dbSNP
rs1292288076 109 dbSNP
rs899319754 112 dbSNP
rs1296271102 118 dbSNP
rs964564269 123 dbSNP
rs1355058672 124 dbSNP
rs11542971 126 dbSNP
rs1172831567 129 dbSNP
rs1277323137 131 dbSNP
rs996369924 132 dbSNP
rs975396496 147 dbSNP
rs1340964872 149 dbSNP
rs1425819016 152 dbSNP
rs1248805892 166 dbSNP
rs1229428371 167 dbSNP
rs922580677 167 dbSNP
rs1481212668 170 dbSNP
rs933988382 171 dbSNP
rs1212438557 181 dbSNP
rs983306259 183 dbSNP
rs1028071778 189 dbSNP
rs1272035942 189 dbSNP
rs140479291 189 dbSNP
rs953963695 195 dbSNP
rs1304527290 197 dbSNP
rs986450153 211 dbSNP
rs141400709 212 dbSNP
rs1354975485 217 dbSNP
rs1333273287 220 dbSNP
rs6705 221 dbSNP
rs1165787003 234 dbSNP
rs1459591768 236 dbSNP
rs1362293734 237 dbSNP
rs1158749337 238 dbSNP
rs955962193 242 dbSNP
rs1487091093 249 dbSNP
rs1192274545 251 dbSNP
rs905458838 254 dbSNP
rs938222014 255 dbSNP
rs1209929296 260 dbSNP
rs35339463 261 dbSNP
rs1264264822 262 dbSNP
rs142787485 267 dbSNP
rs185327128 271 dbSNP
rs1311232062 283 dbSNP
rs1231938963 285 dbSNP
rs1368431473 288 dbSNP
rs747316729 295 dbSNP
rs1388597062 297 dbSNP
rs1382969622 300 dbSNP
rs771513465 306 dbSNP
rs1454546480 316 dbSNP
rs968502228 319 dbSNP
rs1021160891 320 dbSNP
rs1378613548 325 dbSNP
rs1396216830 328 dbSNP
rs979942900 334 dbSNP
rs927391838 337 dbSNP
rs1201736220 339 dbSNP
rs1434387866 348 dbSNP
rs938772057 355 dbSNP
rs1259119401 358 dbSNP
rs547581073 371 dbSNP
rs1001114067 381 dbSNP
rs1287829287 392 dbSNP
rs1208478980 393 dbSNP
rs1346975258 399 dbSNP
rs1275364699 406 dbSNP
rs1235397662 409 dbSNP
rs772958234 409 dbSNP
rs1017361746 420 dbSNP
rs777275669 433 dbSNP
rs1382944844 434 dbSNP
rs530757234 440 dbSNP
rs975995046 441 dbSNP
rs1360861113 444 dbSNP
rs1037940837 457 dbSNP
rs1434486132 458 dbSNP
rs1255880222 462 dbSNP
rs769924855 465 dbSNP
rs775884005 468 dbSNP
rs1030191844 469 dbSNP
rs566132190 474 dbSNP
rs755553834 475 dbSNP
rs1191870522 477 dbSNP
rs1477908344 478 dbSNP
rs955598604 482 dbSNP
rs138885628 484 dbSNP
rs1339771367 488 dbSNP
rs1485214695 491 dbSNP
rs1245492629 492 dbSNP
rs548592971 494 dbSNP
rs996338863 504 dbSNP
rs1350868151 517 dbSNP
rs1238902439 523 dbSNP
rs190036748 539 dbSNP
rs1286316954 543 dbSNP
rs1342527208 549 dbSNP
rs889505906 550 dbSNP
rs1414451603 555 dbSNP
rs550782949 559 dbSNP
rs116071189 563 dbSNP
rs1396425661 570 dbSNP
rs1443489647 575 dbSNP
rs556390406 577 dbSNP
rs571363701 579 dbSNP
rs938150314 586 dbSNP
rs1056765715 587 dbSNP
rs955695520 595 dbSNP
rs1162319781 596 dbSNP
rs1236358511 600 dbSNP
rs1439175316 601 dbSNP
rs1237789847 603 dbSNP
rs1189379380 605 dbSNP
rs1435941602 607 dbSNP
rs555977300 608 dbSNP
rs1199260970 609 dbSNP
rs1320068589 615 dbSNP
rs945037519 619 dbSNP
rs1382429488 623 dbSNP
rs1232862812 627 dbSNP
rs1464767021 633 dbSNP
rs1286258059 642 dbSNP
rs553501225 649 dbSNP
rs1170570967 656 dbSNP
rs1042019773 657 dbSNP
rs571800875 658 dbSNP
rs1332614293 659 dbSNP
rs1021492134 661 dbSNP
rs183374896 669 dbSNP
rs903612355 672 dbSNP
rs1460541303 676 dbSNP
rs531813299 686 dbSNP
rs148988866 693 dbSNP
rs979925822 713 dbSNP
rs900372615 716 dbSNP
rs143709141 718 dbSNP
rs1363063655 720 dbSNP
rs1459064100 722 dbSNP
rs997301950 722 dbSNP
rs1251170607 728 dbSNP
rs1213154148 730 dbSNP
rs1257920264 734 dbSNP
rs960127324 738 dbSNP
rs1030208228 748 dbSNP
rs773098314 749 dbSNP
rs907976743 750 dbSNP
rs1310499667 753 dbSNP
rs1004635860 755 dbSNP
rs34035103 757 dbSNP
rs940670241 762 dbSNP
rs1037740740 763 dbSNP
rs529746314 764 dbSNP
rs1300544864 770 dbSNP
rs543772162 774 dbSNP
rs1318331927 779 dbSNP
rs759434583 780 dbSNP
rs546285223 782 dbSNP
rs1325091983 796 dbSNP
rs566428449 798 dbSNP
rs890635117 800 dbSNP
rs963016836 803 dbSNP
rs1346161288 804 dbSNP
rs974185688 807 dbSNP
rs1478387238 812 dbSNP
rs1009098664 813 dbSNP
rs1041171724 816 dbSNP
rs1206055514 824 dbSNP
rs926688620 827 dbSNP
rs1446669907 828 dbSNP
rs959564107 834 dbSNP
rs115717224 839 dbSNP
rs1346249985 840 dbSNP
rs1457339274 842 dbSNP
rs1179299147 843 dbSNP
rs532599621 863 dbSNP
rs918173226 870 dbSNP
rs945621226 872 dbSNP
rs1428161410 875 dbSNP
rs1339464370 880 dbSNP
rs1298509399 882 dbSNP
rs185930966 883 dbSNP
rs148124686 884 dbSNP
rs757694396 885 dbSNP
rs753715054 893 dbSNP
rs936327955 894 dbSNP
rs1038793082 900 dbSNP
rs1376797576 912 dbSNP
rs1475170265 913 dbSNP
rs1264164625 914 dbSNP
rs968565411 917 dbSNP
rs1178453907 925 dbSNP
rs997311789 927 dbSNP
rs1051575964 929 dbSNP
rs1001875324 938 dbSNP
rs1280061903 945 dbSNP
rs750555698 945 dbSNP
rs1034157787 951 dbSNP
rs1465086748 961 dbSNP
rs1401511193 962 dbSNP
rs1353294354 964 dbSNP
rs1016580894 966 dbSNP
rs530201614 972 dbSNP
rs962774213 977 dbSNP
rs1360840419 978 dbSNP
rs1331425359 981 dbSNP
rs1168320779 984 dbSNP
rs1374972142 986 dbSNP
rs1424487094 992 dbSNP
rs1387754746 996 dbSNP
rs1173058493 997 dbSNP
rs1474369005 998 dbSNP
rs1255852611 999 dbSNP
rs1182823850 1006 dbSNP
rs1384651509 1009 dbSNP
rs960131040 1018 dbSNP
rs1204503735 1024 dbSNP
rs995506598 1026 dbSNP
rs1258184980 1027 dbSNP
rs1220043623 1029 dbSNP
rs1332250243 1033 dbSNP
rs1228670665 1043 dbSNP
rs1311672717 1043 dbSNP
rs992714747 1046 dbSNP
rs1296362063 1048 dbSNP
rs1331987544 1050 dbSNP
rs1401076139 1054 dbSNP
rs1015008855 1055 dbSNP
rs1333475530 1067 dbSNP
rs962130401 1072 dbSNP
rs1460023292 1084 dbSNP
rs1225765286 1085 dbSNP
rs959411866 1088 dbSNP
rs1165829821 1089 dbSNP
rs1425906886 1091 dbSNP
rs1256601434 1097 dbSNP
rs973363897 1102 dbSNP
rs1406298695 1103 dbSNP
rs1178530925 1104 dbSNP
rs992342060 1109 dbSNP
rs920614567 1118 dbSNP
rs1199997768 1122 dbSNP
rs967263577 1134 dbSNP
rs1466810072 1141 dbSNP
rs1317820231 1145 dbSNP
rs932195102 1146 dbSNP
rs986777644 1149 dbSNP
rs548675050 1153 dbSNP
rs141897258 1156 dbSNP
rs925519462 1161 dbSNP
rs754490468 1168 dbSNP
rs1311473117 1177 dbSNP
rs1487549292 1197 dbSNP
rs1390178026 1201 dbSNP
rs1209416121 1204 dbSNP
rs1294313302 1206 dbSNP
rs936344028 1210 dbSNP
rs1343760510 1222 dbSNP
rs1052648970 1225 dbSNP
rs974345612 1227 dbSNP
rs1440784712 1228 dbSNP
rs57628243 1232 dbSNP
rs191076470 1233 dbSNP
rs1192377344 1238 dbSNP
rs3791730 1239 dbSNP
rs945800444 1240 dbSNP
rs1266105133 1262 dbSNP
rs1051931771 1263 dbSNP
rs1489272143 1265 dbSNP
rs767415374 1269 dbSNP
rs1283549965 1271 dbSNP
rs1042680015 1281 dbSNP
rs1421288749 1282 dbSNP
rs752315509 1286 dbSNP
rs1288054579 1288 dbSNP
rs1477454088 1290 dbSNP
rs1001236266 1292 dbSNP
rs1171309181 1294 dbSNP
rs1232049077 1303 dbSNP
rs1034678440 1311 dbSNP
rs940509414 1318 dbSNP
rs1302106889 1320 dbSNP
rs1355719514 1320 dbSNP
rs571607398 1323 dbSNP
rs895767280 1330 dbSNP
rs1420687290 1332 dbSNP
rs1362901867 1343 dbSNP
rs1172281823 1346 dbSNP
rs1466008028 1361 dbSNP
rs1292537359 1362 dbSNP
rs1014471055 1365 dbSNP
rs879054994 1370 dbSNP
rs1014769181 1371 dbSNP
rs1406440806 1374 dbSNP
rs571519029 1376 dbSNP
rs1276682755 1390 dbSNP
rs1340370454 1395 dbSNP
rs1219713780 1417 dbSNP
rs538500699 1420 dbSNP
rs995517727 1422 dbSNP
rs1298401653 1423 dbSNP
rs1265110457 1425 dbSNP
rs3177055 1426 dbSNP
rs1344245403 1432 dbSNP
rs895251512 1443 dbSNP
rs973498335 1444 dbSNP
rs35596741 1445 dbSNP
rs966937922 1446 dbSNP
rs1400884758 1455 dbSNP
rs1342727572 1464 dbSNP
rs535962705 1472 dbSNP
rs978662744 1481 dbSNP
rs1266164029 1487 dbSNP
rs557129940 1487 dbSNP
rs1174899857 1493 dbSNP
rs1467123910 1495 dbSNP
rs147233049 1504 dbSNP
rs1169473051 1506 dbSNP
rs1214812097 1508 dbSNP
rs139059682 1508 dbSNP
rs1185157465 1527 dbSNP
rs958254539 1535 dbSNP
rs986186440 1537 dbSNP
rs1202164266 1551 dbSNP
rs1456473997 1553 dbSNP
rs537002785 1568 dbSNP
rs1219429009 1569 dbSNP
rs944983976 1571 dbSNP
rs987271477 1590 dbSNP
rs559033085 1601 dbSNP
rs988227514 1613 dbSNP
rs1421601952 1616 dbSNP
rs1422023927 1629 dbSNP
rs914089605 1635 dbSNP
rs940539886 1638 dbSNP
rs577456140 1645 dbSNP
rs1390212082 1652 dbSNP
rs757684934 1657 dbSNP
rs1426158510 1660 dbSNP
rs1330124311 1663 dbSNP
rs1042775211 1668 dbSNP
rs1402029904 1674 dbSNP
rs904304074 1680 dbSNP
rs1161165796 1681 dbSNP
rs936995771 1688 dbSNP
rs1055703394 1690 dbSNP
rs781768720 1696 dbSNP
rs895178278 1698 dbSNP
rs1189483463 1700 dbSNP
rs183660344 1701 dbSNP
rs1043259 1705 dbSNP
rs895685091 1712 dbSNP
rs1401025058 1718 dbSNP
rs1291038422 1721 dbSNP
rs187986975 1722 dbSNP
rs192028222 1731 dbSNP
rs1304361950 1733 dbSNP
rs897651011 1734 dbSNP
rs999712046 1749 dbSNP
rs994699756 1754 dbSNP
rs1027740170 1756 dbSNP
rs1355834275 1759 dbSNP
rs953520268 1769 dbSNP
rs1407185491 1781 dbSNP
rs1007936789 1784 dbSNP
rs1164795076 1789 dbSNP
rs1352666769 1790 dbSNP
rs974992808 1793 dbSNP
rs1179239321 1796 dbSNP
rs182982214 1798 dbSNP
rs1029190493 1803 dbSNP
rs1018948185 1813 dbSNP
rs966670774 1831 dbSNP
rs1198382498 1844 dbSNP
rs1243685337 1844 dbSNP
rs987500772 1850 dbSNP
rs1482229366 1851 dbSNP
rs907627210 1852 dbSNP
rs200157829 1858 dbSNP
rs1287355857 1861 dbSNP
rs1445941262 1868 dbSNP
rs973281275 1877 dbSNP
rs868317696 1880 dbSNP
rs1374838080 1882 dbSNP
rs1272595920 1885 dbSNP
rs1435235079 1898 dbSNP
rs914183700 1899 dbSNP
rs1304650410 1900 dbSNP
rs920451062 1901 dbSNP
rs1359714430 1904 dbSNP
rs1159143512 1910 dbSNP
rs542354201 1921 dbSNP
rs1423095020 1929 dbSNP
rs968169240 1937 dbSNP
rs1055755206 1939 dbSNP
rs979605195 1944 dbSNP
rs1248669548 1946 dbSNP
rs917169111 1952 dbSNP
rs553109621 1961 dbSNP
rs949415976 1970 dbSNP
rs746333943 1975 dbSNP
rs937110625 1980 dbSNP
rs1219366758 2005 dbSNP
rs1310969633 2006 dbSNP
rs1275810777 2014 dbSNP
rs1055846362 2015 dbSNP
rs1000040742 2017 dbSNP
rs1447854800 2019 dbSNP
rs1053784905 2027 dbSNP
rs1303944898 2029 dbSNP
rs1339549784 2030 dbSNP
rs916936742 2032 dbSNP
rs949784900 2034 dbSNP
rs1036265192 2037 dbSNP
rs1357367254 2043 dbSNP
rs1333507169 2046 dbSNP
rs1444700203 2052 dbSNP
rs1415098766 2056 dbSNP
rs1431605218 2059 dbSNP
rs1168756286 2061 dbSNP
rs770012899 2068 dbSNP
rs1424714569 2081 dbSNP
rs563727242 2083 dbSNP
rs1482518971 2084 dbSNP
rs1237396401 2085 dbSNP
rs1211495515 2089 dbSNP
rs780326083 2093 dbSNP
rs1225748042 2097 dbSNP
rs1264487794 2105 dbSNP
rs1216363944 2109 dbSNP
rs749293085 2110 dbSNP
rs1007660539 2111 dbSNP
rs1029201752 2113 dbSNP
rs1216106630 2127 dbSNP
rs1376780121 2129 dbSNP
rs1310225542 2133 dbSNP
rs1283506729 2134 dbSNP
rs1209266618 2137 dbSNP
rs1413822209 2138 dbSNP
rs1448720830 2164 dbSNP
rs1019334218 2166 dbSNP
rs1408338726 2176 dbSNP
rs1329410973 2181 dbSNP
rs1465235570 2185 dbSNP
rs1401295348 2186 dbSNP
rs1263703528 2187 dbSNP
rs1172880114 2189 dbSNP
rs1422409882 2189 dbSNP
rs1413572255 2195 dbSNP
rs955092488 2197 dbSNP
rs1176211416 2201 dbSNP
rs1244387082 2212 dbSNP
rs1237094291 2213 dbSNP
rs1008578958 2214 dbSNP
rs530856580 2219 dbSNP
rs1206242439 2230 dbSNP
rs1319670243 2231 dbSNP
rs1311779576 2232 dbSNP
rs1470305041 2242 dbSNP
rs753752207 2244 dbSNP
rs1014982184 2252 dbSNP
rs1307080339 2260 dbSNP
rs1446111354 2269 dbSNP
rs1377804299 2270 dbSNP
rs1009545951 2276 dbSNP
rs1456608440 2278 dbSNP
rs1423425061 2279 dbSNP
rs1021160141 2289 dbSNP
rs1165949777 2302 dbSNP
rs1427036875 2303 dbSNP
rs1379001685 2305 dbSNP
rs973179226 2310 dbSNP
rs768988261 2320 dbSNP
rs1414278024 2334 dbSNP
rs552536745 2340 dbSNP
rs1177729097 2342 dbSNP
rs1408905621 2345 dbSNP
rs565069952 2346 dbSNP
rs1222024091 2347 dbSNP
rs1361400357 2349 dbSNP
rs1283770135 2355 dbSNP
rs747162943 2358 dbSNP
rs760531336 2362 dbSNP
rs532416296 2365 dbSNP
rs1309262168 2370 dbSNP
rs1385244402 2378 dbSNP
rs1367179886 2389 dbSNP
rs1294412869 2394 dbSNP
rs1336503048 2400 dbSNP
rs1359086175 2409 dbSNP
rs1158541972 2412 dbSNP
rs1363821966 2424 dbSNP
rs547259422 2424 dbSNP
rs991282138 2427 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.655 8.6e-4 0.770 3.6e-5 20 Click to see details
GSE26953 Aortic valvular endothelial cells -0.572 1.7e-3 -0.563 2.1e-3 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.568 4.5e-3 0.624 1.6e-3 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.496 5.8e-3 0.514 4.3e-3 25 Click to see details
GSE38226 Liver fibrosis 0.464 1.7e-2 0.457 1.9e-2 21 Click to see details
GSE14794 Lymphoblastoid cells -0.216 2.0e-2 -0.243 1.1e-2 90 Click to see details
GSE28544 Breast cancer 0.411 2.3e-2 0.432 1.8e-2 24 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.651 2.9e-2 -0.950 4.4e-5 9 Click to see details
GSE28260 Renal cortex and medulla -0.468 5.3e-2 -0.319 1.4e-1 13 Click to see details
GSE42095 Differentiated embryonic stem cells 0.3 8.2e-2 0.014 4.7e-1 23 Click to see details
GSE17306 Multiple myeloma 0.148 1.6e-1 0.115 2.2e-1 49 Click to see details
GSE27834 Pluripotent stem cells -0.243 1.8e-1 -0.282 1.4e-1 16 Click to see details
GSE21032 Prostate cancer 0.089 2.1e-1 0.071 2.6e-1 83 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.131 2.7e-1 0.290 8.0e-2 25 Click to see details
GSE21687 Ependynoma primary tumors 0.066 3.0e-1 0.151 1.2e-1 64 Click to see details
GSE32688 Pancreatic cancer 0.06 3.7e-1 0.157 2.0e-1 32 Click to see details
GSE21849 B cell lymphoma -0.052 3.9e-1 0.113 2.8e-1 29 Click to see details
GSE19536 Breast cancer 0.019 4.3e-1 -0.037 3.6e-1 100 Click to see details
GSE19783 ER- ER- breast cancer -0.018 4.4e-1 -0.116 1.5e-1 79 Click to see details
GSE19350 CNS germ cell tumors 0.003 5.0e-1 0.257 2.1e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.44 0 -0.372 0.01 42 Click to see details
ESCA -0.673 0.01 -0.555 0.04 11 Click to see details
PCPG -0.999 0.01 -1.000 0.5 3 Click to see details
BLCA 0.514 0.01 0.459 0.03 18 Click to see details
LIHC -0.246 0.04 -0.261 0.04 49 Click to see details
THCA 0.196 0.07 0.232 0.04 59 Click to see details
STAD 0.218 0.12 0.102 0.29 32 Click to see details
BRCA 0.129 0.12 0.135 0.11 84 Click to see details
CHOL 0.427 0.13 0.550 0.06 9 Click to see details
COAD -0.437 0.14 -0.571 0.07 8 Click to see details
UCEC -0.249 0.15 -0.174 0.24 19 Click to see details
PRAD -0.137 0.17 -0.078 0.3 50 Click to see details
KIRP -0.168 0.18 -0.024 0.45 32 Click to see details
PAAD 0.583 0.21 0.800 0.1 4 Click to see details
KIRC -0.085 0.25 -0.120 0.16 68 Click to see details
LUSC -0.114 0.25 -0.156 0.17 38 Click to see details
KICH -0.125 0.28 -0.175 0.2 25 Click to see details
CESC -0.269 0.41 -0.500 0.33 3 Click to see details
LUAD -0.064 0.42 -0.035 0.46 12 Click to see details
LUAD -0.064 0.42 -0.035 0.46 12 Click to see details
LUAD -0.064 0.42 -0.035 0.46 12 Click to see details
205 hsa-miR-148a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000020 DNMT1 DNA methyltransferase 1 7 7
MIRT000297 HLA-G major histocompatibility complex, class I, G 2 1
MIRT000298 TGIF2 TGFB induced factor homeobox 2 3 2
MIRT000955 DNMT3B DNA methyltransferase 3 beta 5 2
MIRT003998 NR1I2 nuclear receptor subfamily 1 group I member 2 7 2
MIRT004504 RPS6KA5 ribosomal protein S6 kinase A5 4 1
MIRT005898 CCKBR cholecystokinin B receptor 4 3
MIRT006859 IRS1 insulin receptor substrate 1 2 1
MIRT006946 ACVR1 activin A receptor type 1 2 2
MIRT006975 BCL2 BCL2, apoptosis regulator 1 1
MIRT007017 TMED7 transmembrane p24 trafficking protein 7 1 1
MIRT025970 GPATCH8 G-patch domain containing 8 1 1
MIRT025971 TMEM14A transmembrane protein 14A 1 1
MIRT025972 ANP32A acidic nuclear phosphoprotein 32 family member A 1 1
MIRT025973 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT025974 HSP90B1 heat shock protein 90 beta family member 1 1 1
MIRT025975 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT025976 CYCS cytochrome c, somatic 1 1
MIRT025977 ADARB1 adenosine deaminase, RNA specific B1 1 1
MIRT025978 CBX3 chromobox 3 1 1
MIRT025979 UQCRQ ubiquinol-cytochrome c reductase complex III subunit VII 1 1
MIRT025980 SPRY2 sprouty RTK signaling antagonist 2 1 1
MIRT025981 PAN3 PAN3 poly(A) specific ribonuclease subunit 1 1
MIRT025982 KANSL1 KAT8 regulatory NSL complex subunit 1 1 1
MIRT025983 GAS1 growth arrest specific 1 2 6
MIRT025984 PTPN4 protein tyrosine phosphatase, non-receptor type 4 1 1
MIRT025985 ZNF92 zinc finger protein 92 1 1
MIRT025986 RAB10 RAB10, member RAS oncogene family 1 1
MIRT025987 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 3
MIRT025988 HCCS holocytochrome c synthase 1 1
MIRT025989 WAPAL WAPL cohesin release factor 1 1
MIRT025990 MPP5 membrane palmitoylated protein 5 1 1
MIRT025991 ZNF490 zinc finger protein 490 1 1
MIRT025992 RAB12 RAB12, member RAS oncogene family 2 3
MIRT025993 GNB5 G protein subunit beta 5 1 1
MIRT025994 SNAPIN SNAP associated protein 2 3
MIRT025995 PSMD9 proteasome 26S subunit, non-ATPase 9 1 1
MIRT025996 TRIM59 tripartite motif containing 59 1 1
MIRT025997 DYNLL2 dynein light chain LC8-type 2 1 1
MIRT025998 SECISBP2L SECIS binding protein 2 like 2 6
MIRT025999 LYSMD1 LysM domain containing 1 1 1
MIRT026000 PBXIP1 PBX homeobox interacting protein 1 2 2
MIRT026001 MTMR9 myotubularin related protein 9 1 1
MIRT026002 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 1 1
MIRT026003 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT026004 LBR lamin B receptor 1 1
MIRT026005 KIAA1549 KIAA1549 1 1
MIRT026006 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 1 1
MIRT026007 CDK19 cyclin dependent kinase 19 2 3
MIRT026008 RAB34 RAB34, member RAS oncogene family 2 3
MIRT026009 ARRDC3 arrestin domain containing 3 1 1
MIRT026010 PRNP prion protein 2 1
MIRT026011 HOXC8 homeobox C8 4 1
MIRT026012 TMEM9B TMEM9 domain family member B 1 1
MIRT026013 RASSF8 Ras association domain family member 8 1 1
MIRT026014 BTBD3 BTB domain containing 3 2 12
MIRT026015 TNRC6A trinucleotide repeat containing 6A 2 3
MIRT026016 SESTD1 SEC14 and spectrin domain containing 1 1 1
MIRT026017 CDC25B cell division cycle 25B 3 1
MIRT048023 MRPL45 mitochondrial ribosomal protein L45 1 1
MIRT048024 DENR density regulated re-initiation and release factor 1 1
MIRT048025 APPBP2 amyloid beta precursor protein binding protein 2 1 1
MIRT048026 SLC2A3 solute carrier family 2 member 3 1 1
MIRT048027 PTPN23 protein tyrosine phosphatase, non-receptor type 23 1 1
MIRT048028 VPS41 VPS41, HOPS complex subunit 1 1
MIRT048029 MSL3 MSL complex subunit 3 1 1
MIRT048030 AMELX amelogenin, X-linked 1 1
MIRT048031 OR2C3 olfactory receptor family 2 subfamily C member 3 1 1
MIRT048032 SLC25A3 solute carrier family 25 member 3 1 1
MIRT048033 APC APC, WNT signaling pathway regulator 1 1
MIRT048034 GOLIM4 golgi integral membrane protein 4 1 1
MIRT048035 MYCBP2 MYC binding protein 2, E3 ubiquitin protein ligase 1 1
MIRT048036 RPS17 ribosomal protein S17 1 1
MIRT048037 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT048038 WDTC1 WD and tetratricopeptide repeats 1 1 1
MIRT048039 HMGB1 high mobility group box 1 1 1
MIRT048040 MAP3K4 mitogen-activated protein kinase kinase kinase 4 4 2
MIRT048041 USP38 ubiquitin specific peptidase 38 1 1
MIRT048042 NONO non-POU domain containing octamer binding 1 1
MIRT048043 CCNI cyclin I 1 1
MIRT048044 AURKB aurora kinase B 1 1
MIRT052917 MMP7 matrix metallopeptidase 7 4 1
MIRT053185 WNT10B Wnt family member 10B 4 1
MIRT053199 MYC MYC proto-oncogene, bHLH transcription factor 2 1
MIRT053475 CDKN1B cyclin dependent kinase inhibitor 1B 4 5
MIRT053477 SERPINE1 serpin family E member 1 3 1
MIRT053478 ITGB8 integrin subunit beta 8 5 3
MIRT053479 VAV2 vav guanine nucleotide exchange factor 2 3 1
MIRT053480 ITGA5 integrin subunit alpha 5 3 1
MIRT053483 ROCK1 Rho associated coiled-coil containing protein kinase 1 6 3
MIRT053518 RUNX3 runt related transcription factor 3 2 1
MIRT053560 SMAD2 SMAD family member 2 3 1
MIRT054115 UNKL unkempt family like zinc finger 1 1
MIRT054388 MET MET proto-oncogene, receptor tyrosine kinase 3 1
MIRT057492 CEP55 centrosomal protein 55 2 4
MIRT062708 MLEC malectin 2 4
MIRT084562 BCL2L11 BCL2 like 11 2 1
MIRT105304 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT130076 TXNIP thioredoxin interacting protein 4 4
MIRT138426 KIF2C kinesin family member 2C 2 2
MIRT152411 ARID3A AT-rich interaction domain 3A 2 2
MIRT155749 SIK1 salt inducible kinase 1 2 6
MIRT210293 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT218522 HLA-A major histocompatibility complex, class I, A 2 2
MIRT222270 CCT6A chaperonin containing TCP1 subunit 6A 2 2
MIRT270936 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT280554 GLRX5 glutaredoxin 5 2 2
MIRT281136 PDIA3 protein disulfide isomerase family A member 3 3 1
MIRT296526 STX16 syntaxin 16 2 2
MIRT301572 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT347400 CEBPG CCAAT/enhancer binding protein gamma 2 2
MIRT382244 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT399584 RBM38 RNA binding motif protein 38 2 2
MIRT437409 MAFB MAF bZIP transcription factor B 1 1
MIRT438088 ERRFI1 ERBB receptor feedback inhibitor 1 2 1
MIRT438751 S1PR1 sphingosine-1-phosphate receptor 1 3 3
MIRT438752 USP4 ubiquitin specific peptidase 4 3 1
MIRT453164 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT456196 ZDHHC6 zinc finger DHHC-type containing 6 2 2
MIRT458103 TTLL1 tubulin tyrosine ligase like 1 2 2
MIRT459958 POC1A POC1 centriolar protein A 2 2
MIRT461329 MRPS27 mitochondrial ribosomal protein S27 2 2
MIRT462848 B4GALT7 beta-1,4-galactosyltransferase 7 2 2
MIRT463247 ZIC5 Zic family member 5 2 2
MIRT464041 WASL Wiskott-Aldrich syndrome like 2 2
MIRT466869 STX6 syntaxin 6 2 2
MIRT467697 SLC38A2 solute carrier family 38 member 2 2 4
MIRT468920 RPS6KA4 ribosomal protein S6 kinase A4 2 2
MIRT469506 RCC2 regulator of chromosome condensation 2 2 2
MIRT469815 RAB14 RAB14, member RAS oncogene family 2 2
MIRT470329 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT473770 MAP3K9 mitogen-activated protein kinase kinase kinase 9 5 3
MIRT477363 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT478215 DDX6 DEAD-box helicase 6 2 2
MIRT479812 CCNA2 cyclin A2 2 6
MIRT484939 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485432 KLF6 Kruppel like factor 6 9 3
MIRT485645 DICER1 dicer 1, ribonuclease III 2 4
MIRT487938 HLA-C major histocompatibility complex, class I, C 3 2
MIRT488937 ETV7 ETS variant 7 2 2
MIRT492821 PATL1 PAT1 homolog 1, processing body mRNA decay factor 2 2
MIRT496749 PDIK1L PDLIM1 interacting kinase 1 like 2 2
MIRT497883 SLC12A7 solute carrier family 12 member 7 2 2
MIRT500918 STARD13 StAR related lipid transfer domain containing 13 2 4
MIRT503176 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT505102 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 2
MIRT505256 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT511220 LNPEP leucyl and cystinyl aminopeptidase 2 4
MIRT513209 RFT1 RFT1 homolog 2 2
MIRT513617 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT522804 KPNA4 karyopherin subunit alpha 4 2 4
MIRT525443 RBM23 RNA binding motif protein 23 2 2
MIRT530302 AKAP17A A-kinase anchoring protein 17A 2 2
MIRT531689 MYO3A myosin IIIA 2 2
MIRT537300 FZD5 frizzled class receptor 5 2 2
MIRT541199 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT544732 NDRG1 N-myc downstream regulated 1 2 2
MIRT549174 BMP3 bone morphogenetic protein 3 2 2
MIRT549231 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT551864 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT559687 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT561658 RNF219 ring finger protein 219 2 2
MIRT561856 NPTX1 neuronal pentraxin 1 2 2
MIRT565733 SESN3 sestrin 3 2 2
MIRT566568 OTUD4 OTU deubiquitinase 4 2 2
MIRT567186 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT567834 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT574794 FAM104A family with sequence similarity 104 member A 2 2
MIRT576772 Tmem127 transmembrane protein 127 2 2
MIRT610545 WNT2B Wnt family member 2B 2 4
MIRT613042 FOXP1 forkhead box P1 2 2
MIRT615073 COLEC12 collectin subfamily member 12 2 2
MIRT617481 AP5B1 adaptor related protein complex 5 beta 1 subunit 2 2
MIRT622753 PHACTR2 phosphatase and actin regulator 2 2 2
MIRT625516 PPAPDC1A phospholipid phosphatase 4 2 2
MIRT628641 ABLIM1 actin binding LIM protein 1 2 2
MIRT630234 SORD sorbitol dehydrogenase 2 2
MIRT635946 PLA2G12A phospholipase A2 group XIIA 2 2
MIRT646776 IL23R interleukin 23 receptor 2 2
MIRT648163 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT653244 SOS2 SOS Ras/Rho guanine nucleotide exchange factor 2 5 2
MIRT661182 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT693234 KIAA0907 KIAA0907 2 4
MIRT693776 VGLL2 vestigial like family member 2 2 2
MIRT702589 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT715175 DTX4 deltex E3 ubiquitin ligase 4 2 2
MIRT722871 FAM212B family with sequence similarity 212 member B 2 2
MIRT723139 YPEL1 yippee like 1 2 2
MIRT723186 OVOL1 ovo like transcriptional repressor 1 2 2
MIRT732353 WNT1 Wnt family member 1 3 1
MIRT732362 STAT3 signal transducer and activator of transcription 3 3 1
MIRT734547 HNRNPK heterogeneous nuclear ribonucleoprotein K 2 0
MIRT734935 CXCR4 C-X-C motif chemokine receptor 4 1 0
MIRT736034 ITGA9 integrin subunit alpha 9 3 0
MIRT736105 PTEN phosphatase and tensin homolog 5 1
MIRT736114 IL15 interleukin 15 2 0
MIRT736501 AKT1 AKT serine/threonine kinase 1 1 0
MIRT737228 PCGEM1 PCGEM1, prostate-specific transcript (non-protein coding) 2 0
MIRT737363 UBAP2 ubiquitin associated protein 2 3 0
MIRT737364 FOXK2 forkhead box K2 3 0
MIRT755397 WNT10A Wnt family member 10A 2 1
MIRT755440 LDLR low density lipoprotein receptor 1 1
MIRT756258 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 3 1
MIRT756289 SLC7A11 solute carrier family 7 member 11 2 1
MIRT756402 CNTN4 contactin 4 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-148a Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-148a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
miR-148a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-148a Bilobalide NULL 73581 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Bilobalide NULL 73581 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-148a Daidzein NULL 5281708 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Dexamethasone approved 5743 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-148a Paclitaxel approved 36314 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Vinblastine approved 13342 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 down-regulated
miR-148a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-148a 5a-dihydrotestosterone (DHT) NULL 15 Quantitative real-time PCR LNCaP cells 22266859 2012 up-regulated
miR-148a Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miR-148a Celecoxib approved 2662 Microarray gastric cancer cells. 23001726 2013 up-regulated
miR-148a Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miR-148a 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 up-regulated
miR-148a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-148a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer tissue
hsa-mir-148a Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer tissue
hsa-mir-148a Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-148a Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-148a Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-148a Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-148a Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-148a-3p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-148a-3p (2,3-dihydroxyphenyl)-[1-[(4-fluorophenyl)methyl]-4-hydroxyindol-3-yl]methanone 42624812 NSC746053 sensitive
hsa-miR-148a-3p (2E)-2-[(2-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516827 NSC639520 sensitive
hsa-miR-148a-3p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-148a-3p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-148a-3p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 resistant
hsa-miR-148a-3p (4z,5z)-1-[(e)-(2-hydroxyphenyl)methyleneamino]-3-phenyl-4,5-bis(phenylimino)imidazolidine-2-thione 135509182 NSC671409 resistant
hsa-miR-148a-3p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-148a-3p (E)-1-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54612660 NSC741738 resistant
hsa-miR-148a-3p (e)-3-chloro-2-(3,4-dimethoxyphenyl)-3-(3,4-dipropoxyphenyl)prop-2-enal 3004402 NSC650594 sensitive
hsa-miR-148a-3p (e)-but-2-enedioic acid;1-(7,8,9,10-tetrahydrophenanthridin-6-yl)piperidin-4-amine 5471308 NSC710333 sensitive
hsa-miR-148a-3p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-methylphenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351426 NSC670225 sensitive
hsa-miR-148a-3p .beta.-d-glucopyranose, 2,3-o-(diethylstannylene)- 16683462 NSC306911 sensitive
hsa-miR-148a-3p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 sensitive
hsa-miR-148a-3p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-148a-3p [1,1,1,3,3,3-hexafluoro-2-(quinolin-2-ylmethyl)propan-2-yl] acetate 379602 NSC664303 sensitive
hsa-miR-148a-3p [2-(4-methoxyphenyl)-2-oxoethyl] (2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[[(2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[2-(4-methoxyphenyl)-2-oxoethoxy]-3-oxopropyl]diselanyl]propanoate 45029327 NSC746149 resistant
hsa-miR-148a-3p [4-[[2-(1h-indol-2-yl)-1,3-dioxolan-2-yl]methyl]-1-piperidyl]-phenyl-methanone 398268 NSC707982 sensitive
hsa-miR-148a-3p [7-fluoro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-(furan-2-yl)methanone 23635646 NSC736443 sensitive
hsa-miR-148a-3p [acetyl(diphenyl)[?]yl] acetate 363302 NSC628121 sensitive
hsa-miR-148a-3p 1-((4-methylene-5-oxo-2-phenyltetrahydro-2-furanyl)methyl)dihydro-2,4(1h,3h)-pyrimidinedione 381497 NSC668253 sensitive
hsa-miR-148a-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 sensitive
hsa-miR-148a-3p 1-[(1e)-2,3,3-trichloro-1-[chloro(nitro)methylene]allyl]piperidine 3004947 NSC665087 sensitive
hsa-miR-148a-3p 1-[(4-fluorophenyl)amino]-2,3-propanopyrido[1,2-a]benzimidazole-4-carbonitrile 395404 NSC699940 resistant
hsa-miR-148a-3p 1-cyclohexyl-3-[(e)-(6-methyl-2-pyridyl)methyleneamino]thiourea 9571907 NSC670782 sensitive
hsa-miR-148a-3p 12-(3,5-ditert-butyl-4-hydroxyphenyl)-1,4,7,10,13,16-hexaoxacyclooctadecane-2,9-dione 386885 NSC679743 resistant
hsa-miR-148a-3p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 resistant
hsa-miR-148a-3p 17-methyl-13,14,17-triazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,8,11(16),14-heptaen-12-one 403909 NSC719502 resistant
hsa-miR-148a-3p 2-(2-naphthyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 388200 NSC682768 resistant
hsa-miR-148a-3p 2-(2-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468909 NSC679021 sensitive
hsa-miR-148a-3p 2-(2,4-dichlorobenzyl)-3,5,6-trimethyl-2h-indazole-7-carbonitrile 367590 NSC637422 resistant
hsa-miR-148a-3p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-148a-3p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepine-6-thione 4998423 NSC684481 resistant
hsa-miR-148a-3p 2-(3-methylbutylsulfanyl)naphthalene-1,4-dione 315743 NSC241494 sensitive
hsa-miR-148a-3p 2-(3-phenyl-4,5-bis(phenylimino)-1,3-thiazolidin-2-ylidene)malononitrile 383253 NSC671367 sensitive
hsa-miR-148a-3p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 sensitive
hsa-miR-148a-3p 2-(4-isothiocyanatophenyl)sulfanylacetic acid 345648 NSC403376 sensitive
hsa-miR-148a-3p 2-(6-ethenyl-4-hydroxy-6-methyl-3-methylidene-2-oxo-4,5,7,7a-tetrahydro-3aH-1-benzofuran-7-yl)prop-2-enal 495207 NSC645991 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]-1-(2-nitrophenyl)prop-2-en-1-one 411522 NSC34821 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]-1-(2,5-dimethylphenyl)prop-2-en-1-one 436059 NSC382001 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]cyclopentan-1-one 244760 NSC621888 sensitive
hsa-miR-148a-3p 2-[(z)-2-(benzenesulfonyl)-2-(5-nitrofuran-2-yl)ethenyl]-5-nitrofuran 6072945 NSC291049 sensitive
hsa-miR-148a-3p 2-[(Z)-2-[3-[3-methoxy-5-(trifluoromethyl)phenyl]-1,2,4-triazol-1-yl]ethenyl]-1,3,4-oxadiazole 57524026 NSC757569 sensitive
hsa-miR-148a-3p 2-[5-[4-[5-[4-(6-morpholin-4-yl-1H-benzimidazol-2-yl)phenoxy]pentyl]piperazin-1-yl]pentyl]benzo[de]isoquinoline-1,3-dione 44219118 NSC743432 sensitive
hsa-miR-148a-3p 2-acetamido-6-methyl-8-hydroxy-1,4-naphthaquinone 377214 NSC658450 sensitive
hsa-miR-148a-3p 2-amino-6-[4-[[4,6-bis(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-4-(4-methoxyphenyl)pyridine-3-carbonitrile 45028694 NSC743853 sensitive
hsa-miR-148a-3p 2-nitro-1-phenylpropan-1-ol 226118 NSC16258 sensitive
hsa-miR-148a-3p 2,3-bis(naphthalen-2-ylsulfanyl)naphthalene-1,4-dione 312602 NSC222722 sensitive
hsa-miR-148a-3p 2,5,9,12-tetrathiabicyclo[11.4.0]heptadeca-1(13),14,16-triene-15,16-dicarbonitrile 387185 NSC680721 resistant
hsa-miR-148a-3p 2,6-bis(4-morpholinylmethyl)cyclohexanone,dihydrochloride NSC38535 sensitive
hsa-miR-148a-3p 2,6-bis[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 358899 NSC619042 sensitive
hsa-miR-148a-3p 3-(3-chloro-4-methoxyphenyl)-N-[2-(dimethylamino)ethyl]-4-pyridin-4-ylpyrazole-1-carboxamide 60147896 NSC752885 resistant
hsa-miR-148a-3p 3-(4-chlorophenyl)-6-(5-nitrofuran-2-yl)-7H-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine 364212 NSC629974 sensitive
hsa-miR-148a-3p 3-[2-[(3,5-dichlorophenyl)amino]thiazol-4-yl]chromen-2-one 395985 NSC701109 resistant
hsa-miR-148a-3p 3-[2-[[5-[(4-bromophenyl)diazenyl]-2-hydroxyphenyl]-phenylsulfanylmethyl]hydrazinyl]-3-oxo-n-phenylpropanamide 377943 NSC659611 sensitive
hsa-miR-148a-3p 3-bromo-1-oxo-2-phenylthiochromen-4-one 5472015 NSC715997 sensitive
hsa-miR-148a-3p 3-chloro-4-methyl-7-((2-methyl-4-methylene-5-oxotetrahydro-2-furanyl)methoxy)-2h-chromen-2-one 381507 NSC668263 sensitive
hsa-miR-148a-3p 3-deazaneplanocin, hydrochloride 358176 NSC617989 sensitive
hsa-miR-148a-3p 4-(1-(4-aminophenyl)-3,4-diphenyl-1h-1.lambda.~4~-thien-1-yl)phenylamine 392992 NSC694234 resistant
hsa-miR-148a-3p 4-(2-(((6-bromo-1,3-benzodioxol-5-yl)methyl)amino)ethyl)phenol 290548 NSC154572 sensitive
hsa-miR-148a-3p 4-(2-azidophenothiazin-10-yl)-N,N-dimethylbutan-1-amine;oxalic acid 385933 NSC677395 sensitive
hsa-miR-148a-3p 4-[3-(4-chlorophenyl)-5-(2,5-dimethoxyphenyl)pyrazol-1-yl]benzenesulfonamide 24204421 NSC731805 sensitive
hsa-miR-148a-3p 4-amino-2-(4-chloroanilino)-5-(4-chlorobenzoyl)-n-phenyl-1h-pyrrole-3-carbothioamide 5472776 NSC721531 resistant
hsa-miR-148a-3p 4-amino-3,5-dichloro-n-(3-(4-(2-methoxyphenyl)-1-piperazinyl)propyl)benzamide 379857 NSC664993 sensitive
hsa-miR-148a-3p 4-morpholinecarbodithioic acid, antimony complex NSC625498 sensitive
hsa-miR-148a-3p 5-[2-(4-methoxyphenyl)ethyl]-1,2,3-dimethoxy benzene NSC631356 sensitive
hsa-miR-148a-3p 5,6,11,12-tetramethyl-5,5a,6,11,11a,12-hexahydroquinoxalino[2,3-b]quinoxaline 365519 NSC633207 sensitive
hsa-miR-148a-3p 5,7-dihydroquinolino[3,2-d][1]benzazepine-6-thione 3005168 NSC679092 resistant
hsa-miR-148a-3p 6-(3-azidopropyl)-2,3-dimethoxy-5,11-dioxoindeno[1,2-c]isoquinoline-9-carbonitrile 17755511 NSC734749 resistant
hsa-miR-148a-3p 7-chloro-5-hydroxy-2-methoxy-2,4-dimethyl-1H-benzo[e][1]benzofuran-6,9-dione 359534 NSC620517 sensitive
hsa-miR-148a-3p 7-hydroxystaurosporine 5351376 NSC638646 resistant
hsa-miR-148a-3p 8-{[(3as)-2-methylhexahydro-1h-pyrrolo[1,2-c][1,3,2]diazaphosphol-1-yl]oxy}quinoline 402496 NSC716522 sensitive
hsa-miR-148a-3p 8-fluoro-11-methyl-1h-benzo[a]carbazole-1,4(11h)-dione 381772 NSC668844 sensitive
hsa-miR-148a-3p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 sensitive
hsa-miR-148a-3p 9-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386894 NSC679796 sensitive
hsa-miR-148a-3p 9-isobutyl-6-(((2-methyl-1-naphthyl)methyl)thio)-9h-purin-2-amine 244996 NSC56452 sensitive
hsa-miR-148a-3p 9h-purine, 2-amino-6-(2,4-dichlorobenzylthio)-9-isobutyl- 240896 NSC47786 sensitive
hsa-miR-148a-3p Ab01327238-02 6892730 NSC670969 sensitive
hsa-miR-148a-3p Acetamide, n-(2-mercaptoethyl)-, benzoate (6ci, 7ci) 281604 NSC134459 sensitive
hsa-miR-148a-3p Aj-131/36477019 384476 NSC674278 resistant
hsa-miR-148a-3p Aspiculamycin hcl 5458423 NSC200692 resistant
hsa-miR-148a-3p Auranofin 6333901 NSC321521 sensitive
hsa-miR-148a-3p Baccharin 5358645 NSC269757 sensitive
hsa-miR-148a-3p Benzene, 1,1'-[(1,3-butadiene-1,4-diyl)sulfonyl]bis 5468033 NSC662781 sensitive
hsa-miR-148a-3p Caracemide 54747 NSC253272 sensitive
hsa-miR-148a-3p Cbmicro_021216 812842 NSC707055 sensitive
hsa-miR-148a-3p Chimaphilin 101211 NSC400245 sensitive
hsa-miR-148a-3p Cis-amminedichloro(4-methoxyphenethylamine)platinum(ii) 498559 NSC631306 sensitive
hsa-miR-148a-3p Compactin 2854 NSC281245 resistant
hsa-miR-148a-3p Copper;(ne,3z)-n-[1-(6-methylpyridazin-3-yl)ethylidene]-3-azabicyclo[3.2.2]nonane-3-carbohydrazonothioate 9578854 NSC633271 sensitive
hsa-miR-148a-3p Cyanocycline a 100158 NSC349644 sensitive
hsa-miR-148a-3p Cycloalkannin 133408 NSC301457 sensitive
hsa-miR-148a-3p Cyclopentanone, 2,5-bis[(trimethylamino)methyl]-, iodide 360925 NSC623639 sensitive
hsa-miR-148a-3p Cytembena 23663958 NSC104801 sensitive
hsa-miR-148a-3p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-148a-3p Dasatinib 3062316 NSC732517 approved resistant
hsa-miR-148a-3p Dibutyl(bis((3-(2-fluorophenyl)acryloyl)oxy))stannane 16683204 NSC643860 sensitive
hsa-miR-148a-3p Dichloroallyl lawsone 277767 NSC126771 sensitive
hsa-miR-148a-3p Dichlorodipropyltin 93562 NSC92618 sensitive
hsa-miR-148a-3p Dichloroiron;(NE,1E)-N-(1-pyridin-2-ylethylidene)azepane-1-carbohydrazonothioate 9578789 NSC338304 sensitive
hsa-miR-148a-3p Diethyl 2-[[4-(3-phenylquinoxalin-2-yl)oxybenzoyl]amino]pentanedioate 390812 NSC688814 resistant
hsa-miR-148a-3p Diketocoriolin b 294475 NSC163027 sensitive
hsa-miR-148a-3p Enhydrin a 5359029 NSC294601 sensitive
hsa-miR-148a-3p Entinostat 4261 NSC706995 sensitive
hsa-miR-148a-3p Ethanone, 1-(2-pyrimidinyl)-, (2-benzoxazolyl)hydrazone 9572051 NSC693639 sensitive
hsa-miR-148a-3p Ethyl 3-[[5-[(e)-3-methoxy-3-oxoprop-1-enyl]-1h-imidazol-4-yl]diazenyl]benzoate 135436270 NSC716679 sensitive
hsa-miR-148a-3p Ethyl 3-benzyl-2-methyl-4,5-dioxobenzo[e]indole-1-carboxylate 406008 NSC723888 sensitive
hsa-miR-148a-3p Ethyl 7-(3,4-difluorophenyl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399952 NSC711104 resistant
hsa-miR-148a-3p Gold(1+), bis(trimethylphosphine)-, chloride 6333886 NSC313985 sensitive
hsa-miR-148a-3p Gtpl8141 44478401 NSC752203 resistant
hsa-miR-148a-3p Gw410563a 10425574 NSC756225 resistant
hsa-miR-148a-3p Gw559768x 9927432 NSC756251 resistant
hsa-miR-148a-3p Gw612286x 9822610 NSC756278 resistant
hsa-miR-148a-3p Gw643971x 135778715 NSC756297 resistant
hsa-miR-148a-3p Insariotoxin 6711181 NSC138780 sensitive
hsa-miR-148a-3p Isodonol 317640 NSC250682 sensitive
hsa-miR-148a-3p J7x181m78y 395460 NSC700023 resistant
hsa-miR-148a-3p Ldn-211904 46175113 NSC751644 resistant
hsa-miR-148a-3p Ls-123342 5469111 NSC683328 sensitive
hsa-miR-148a-3p Methyl 1-[[N-[(3-methoxycarbonyl-5-methylpyrazol-1-yl)methyl]anilino]methyl]-5-methylpyrazole-3-carboxylate 404564 NSC720860 sensitive
hsa-miR-148a-3p Methyl 2-[(2e)-2-[(2,6-dichlorophenyl)methylidene]hydrazinyl]-5-(3,4,5-trimethoxyphenyl)-1h-pyrrole-3-carboxylate 45029264 NSC745940 resistant
hsa-miR-148a-3p Methyl N-[(E)-1-pyridin-2-ylethylideneamino]carbamodithioate 5947235 NSC251190 sensitive
hsa-miR-148a-3p Methylene blue 6099 NSC617593 approved sensitive
hsa-miR-148a-3p N'-[1-(1-benzothiophen-2-yl)cyclohexyl]-n-methylpropane-1,3-diamine;(e)-but-2-enedioic acid 54611499 NSC708074 sensitive
hsa-miR-148a-3p N-(((2-methoxy-5-(trifluoromethyl)anilino)carbonyl)oxy)butanimidoyl chloride 9556202 NSC672059 sensitive
hsa-miR-148a-3p N-(2-((((4-methoxyphenyl)diazenyl)carbonyl)amino)-4-methylpentanoyl)phenylalanine 386436 NSC678404 sensitive
hsa-miR-148a-3p N-(2,5-dimethylphenyl)-2-(3-oxo-4H-1,4-benzothiazin-2-yl)acetamide 366111 NSC634398 resistant
hsa-miR-148a-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 sensitive
hsa-miR-148a-3p N-(4-methoxyphenyl)-3-[4-[(4-methylphenyl)diazenyl]-3,5-diphenylpyrazol-1-yl]-3-oxopropanamide 367846 NSC637921 resistant
hsa-miR-148a-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 sensitive
hsa-miR-148a-3p N-[(e)-(5-chloro-2-hydroxyphenyl)methylideneamino]-2-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968273 NSC747459 sensitive
hsa-miR-148a-3p N-[2-(1H-indol-3-yl)ethyl]-1,1-dioxo-2-(3-propan-2-yloxyphenyl)-4H-pyrido[4,3-e][1,2,4]thiadiazin-3-imine 135426715 NSC710895 sensitive
hsa-miR-148a-3p N-[4-[2-(2,4-dinitrophenyl)-3-(3-ethoxy-4-hydroxyphenyl)-3,4-dihydropyrazol-5-yl]phenyl]-2-methyl-5-nitrobenzenesulfonamide 402369 NSC716281 resistant
hsa-miR-148a-3p N-[4-[hydroxy(methyl)amino]-6-(propylamino)-1,3,5-triazin-2-yl]-n-methylhydroxylamine 45029482 NSC746928 sensitive
hsa-miR-148a-3p N,N'-bis(3-aminopropyl)-N,N'-dibenzylbutane-1,4-diamine;2,2,2-trifluoroacetic acid 389631 NSC685976 resistant
hsa-miR-148a-3p N,N-dimethyl-4-[(Z)-(6-methylindolo[1,2-b]indazol-6-ium-11-ylidene)methyl]aniline;trifluoromethanesulfonate 5471987 NSC715775 sensitive
hsa-miR-148a-3p Navan 941650 NSC108165 sensitive
hsa-miR-148a-3p Neuro_000327 16683203 NSC643859 sensitive
hsa-miR-148a-3p NSC600301 NSC600301 sensitive
hsa-miR-148a-3p NSC607281 NSC607281 sensitive
hsa-miR-148a-3p NSC621335 NSC621335 sensitive
hsa-miR-148a-3p NSC621339 NSC621339 sensitive
hsa-miR-148a-3p NSC625496 NSC625496 sensitive
hsa-miR-148a-3p NSC641052 NSC641052 sensitive
hsa-miR-148a-3p NSC716032 NSC716032 sensitive
hsa-miR-148a-3p Oridonin (thiol adduct of) 432952 NSC319730 sensitive
hsa-miR-148a-3p Oxin 1923 NSC2039 approved sensitive
hsa-miR-148a-3p Phenol, 4,4'-(5,5'-biisoxazole-3,3'-diyl)bis- 386651 NSC679108 sensitive
hsa-miR-148a-3p Physalin f 433531 NSC661115 sensitive
hsa-miR-148a-3p Pmp (van) 72508 NSC1906 sensitive
hsa-miR-148a-3p Pyrazino[1,2-a]benzimidazole, 1,3-diphenyl- 384474 NSC674276 resistant
hsa-miR-148a-3p Quinolin-8-yl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402508 NSC716535 sensitive
hsa-miR-148a-3p Sergeolide,desacetyl 125729 NSC364170 sensitive
hsa-miR-148a-3p Staurosporine 5459111 NSC618487 resistant
hsa-miR-148a-3p Stk386853 5291187 NSC65628 sensitive
hsa-miR-148a-3p Streptovaricin b 135443622 NSC156215 sensitive
hsa-miR-148a-3p Tetraplatin 13920603 NSC363812 sensitive
hsa-miR-148a-3p Trimethyl-[(1-oxo-3,4-dihydro-2H-naphthalen-2-yl)methyl]azanium;iodide 375929 NSC656280 sensitive
hsa-miR-148a-3p U-22265 265952 NSC102810 sensitive
hsa-miR-148a-3p Ver a 5351232 NSC126728 sensitive
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3)
hsa-miR-148a-3p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Adenocarcinoma cell line (OE19)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Adenocarcinoma cell line (OE19)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant Low Squamous Cell Carcinoma cell line (SCC-11)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-148a-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-148a-3p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-148a-3p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (22Rv1, DU-145, PC-3,22Rv1RD, DU-145RD, PC-3RD)
hsa-miR-148a-3p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (PC-3)
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-148a-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (PANC-1, MIA-PaCa-2)
hsa-miR-148a-3p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive Low ER-Positive Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Renal Cell Cancer cell line (Caki)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (BGC823, SGC7901)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7C)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Adenocarcinoma cell line (MCF-7, MDA-MB-231)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Adenocarcinoma cell line (MCF-7, MDA-MB-231)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (VCaP-R)
hsa-miR-148a-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Colorectal Cancer cell line (SW480)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKVO3ip1, HeyA8)
hsa-miR-148a-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-CC, MCF-7-TT, MCF-7-21)
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly19, RIVA, SU DHL-8, U2932)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1, PANC-1)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-148a-3p Bromocriptine 31101 NSC169774 approved sensitive Low Prolactinoma tissue
hsa-miR-148a-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-148a-3p Cyclophosphamide 2907 NSC26271 approved resistant High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-148a-3p Rhamnetin 5281691 NSC19802 sensitive Low Hepatocellular Carcinoma cell line (MHCC97-H, HepG2)
hsa-miR-148a-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa, SiHa)
hsa-miR-148a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (A375)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-148a-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-148a-3p Ribavirin+Pegylated IFNa-2b sensitive tissue (chronic hepatitis C)
hsa-miR-148a-3p Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-miR-148a-3p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-148a-3p Testosterone+Letrozole sensitive cell line (MCF-7)
hsa-miR-148a-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-148a-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-148a-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-148a-3p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-148a-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR1)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-148a-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-148a-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission