miRTarBase - #MIRT025987


—
pre-miRNA Information
pre-miRNA hsa-mir-148a   
Genomic Coordinates chr7: 25949919 - 25949986
Description Homo sapiens miR-148a stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-148a-3p
Sequence 44| UCAGUGCACUACAGAACUUUGU |65
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs772747528 2 dbSNP
rs1290582082 8 dbSNP
rs370090919 11 dbSNP
rs771952261 13 dbSNP
rs1249161151 16 dbSNP
rs748063984 19 dbSNP
rs774196394 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PAPD4   
Synonyms GLD2, TUT2
Description poly(A) RNA polymerase D4, non-canonical
Transcript NM_001114393   
Other Transcripts NM_001114394 , NM_173797   
Expression
Putative miRNA Targets on PAPD4
3'UTR of PAPD4
(miRNA target sites are highlighted)		 
>PAPD4|NM_001114393|3'UTR
   1 CTGGCCTCTATTTCTTAATAAATTCTTCCAAGAAATAAAGAACAATAGTTTCATCATAATACATTATGTTTACCTCCATC
  81 ATAGTTGCTTTTTTCATAGTTCTTGTTTTCATGTTTTATTTTTAAAAAGACATATAAAGATTGCATATTTTATTATGACA
 161 TTTCCTAATAAACCCCTTTGATTTAAAAATGTATTTTTAAAAATGTTTACATTGATGATGAGTAATATTGCATGTGTTTT
 241 CAGGTGATCAGATAAAATATATTTTGGGAAATTAACTGAACAAATAAAAAGTTTTTGATATAACTTCAATTAATTGTACC
 321 ACATGCTAATCCTGAAGAGATGTGTAGAATTTTGGAAAGGGTCTAATTCATACATGCTTAAAGTATAACCTACGTTAGAT
 401 AGTTTGTTGTCAAAGTCTGTTCTAGTAAAGTGAAGATTCAAGTCAGTTGTTCAGTTACTTGAAGCAAAACGAAATCTTTC
 481 ATTTCAGTCAAATCACTGCAGTCATGAAATACTGAACAATTGCCTTAAGTCTTTGCTTGACTCACTGGGATAGACTGAGG
 561 CTTTGGGTGTGTCTGTATTAGCATTTCATTAGTACTTCACATGCTTTTGATGTACTCTTGAGATTGCTTTAAATTTTGTA
 641 TTGAAACAACAATACATTTTGCACTGTAGTAATGGGAGCACTAACTCTTACAACAGTTAGTGAATCGTTTTAAAGAATCA
 721 GTTCAGTGTAGACATTTTGAAAAGATTGTTTCCTGTGCTTTACGATAGCTTAGTGCAATGTGCACTTCTGTTTTACTTGC
 801 CATTTTCCTGCTCTGTTTTCTCTGTGACATGAAGCAACAGAAACTGAGATCAAAGTTAAGATTATATCCTGTTTGTAGTA
 881 TCAGATATTTTTCTGTGTACAATTATAGGATTGTAATCTAAACTGGAATTTTTAGGCAGTAAGTCACCACAAAATGTTTT
 961 AGATAAGACACAATAAAATTATTATAAATAAAAGCTTAATGTTTGTAAAAAATCTCTTTTTTAGTATTTCTTTTTTCACA
1041 TGAAAGAAGTGGTGGCTGCTAAAAAAAAAGCTACAGTGTTTATTAAGGGTCTTTTTGATTTATGTAAATATTTGTAAATT
1121 GGTCAGTGCCTGTAAATTTAAATATAAAAAGTAACCTTGAAAACAGTTTTAACTTTTTCAAAAGAACTATGTCCAACATT
1201 TTTTAGACCTGCTGTAGTACAGTTTTGTACCTCTAACGTATTTTTTTTTTGCAGACCAAATGCTAAAACTTTTGCTTTTC
1281 TTTGACTTGTAAAAGGTGCACATTTTCATTTTCTTCCTTAAGTTCAAATTTTTGTATGATGTCAAATGCAATAAAATTTA
1361 TATATGGACATTGTTGAGGTGCCTTTTTTTTCTGTGAAAATCTTTGCTTTGAGATGAGACCGAGGCTGTAGTTATCATCT
1441 AGAACTGAACTAAATCTACTTATTAGCCAGCTAACGACATCAATATCTTATGTCTCTGGCATTATGAGGAATGAAAGTTT
1521 ACACATAGTGAATTTTTTAGATTCCTGATGTGTAACACTTTTTATGCATTTGAGCTTTTCATATTTTGGGGGGGAATTTT
1601 TCCTAAAATTTACACTGTGCATCTCTTAATCAGAATGTACTGAGTAGAGTTAATATTCTAGTGATGACTGGGTAATCATT
1681 ATAAGCATTAGTCATAGTACTATTCAGTAATACTGTGCAACTTTCAGGGATGGGTAAGTATGTACCCTCTGCCTCTACAG
1761 TATTATGACATTTCCTAATAAAACCCCAGAATTTACCATGGTGTGGGTTCCTTCACTGTCACTGTTTTCTCAGTTTTCAG
1841 TGGCCCCACACTTACTACTGCTTTTCTTTGTTTTACCACGAAAAACAGATCAAGAAGTCACTAAACTTAGACCCAATTCT
1921 ATATCAGTAGACTGAGGCCTGAAATTATGCACACATAACTGGCCAAATATCAGATAAGTGAACTGTTAATATATGAGAGA
2001 ATTTTCTGGACTTTTAAGTTATTAATCTCAATTATTTGTGTGGTGAGTACTAAATTATTTTCTGTTTGTGTTGATCTGTC
2081 CATTTCTGTATATAGTTGTCCCTCAGTATATTGAGGGATTGATTCCAGGTCAACCCCGTCCTCTTCAGATACCAAAATCC
2161 ACAGATACTCAAGTCCCTTATATAAAATGGTGTAGTGTTTGCATATATCCTACACACATTCTCTTGATACTTTAAATCAT
2241 CTCTAAATTACCTGATACGTAATACAATGTAAATGCTATGTAAATAGTTGTTATACTGTATTGTTTAGGGAATAATAATG
2321 ACAAGACAAAAAGTCTATACCTGTTCGGTACAGATGCAACCATTCTGCCTCCTCCCTACCCCCTCCCAAATATTTTTCAT
2401 CCTGGTTGAATTCACAAATCCTACATGGTTACGGAGGGTTGACTGTATTTGCATATGTTGTTAAAGTGGTGTTTAAAATG
2481 TGCAATCTGTACTACAATTCTAAATTTTGGATTGATTTGAACTAGGATCTTTGCAAATAAATCTCATAGACATTAATGTT
2561 TGTAAGAAATTTTTAATTAAATGATGGAAGGAACATAGAATGGCTACCTGTGATTTTGATTAGTGTTTAACAGATTGCCA
2641 CAGCTGTGATTGAATTCCTTTTGTACTGGATGAGCATGGTCATTTGGGATTACTGATGGTGAAGTCTAGCTGGTGTTAAG
2721 AGAATAAATATTGCTGATGCTAAACCTGGTTTAGTGAGCTGTGGAAGCCTTGACTCTGCTGTTTTCCCTCCTTATGCCCC
2801 ACTAGCTGATGTATCTGTACTGTAATTCAATGATTTACAGTTCATTACCTCCAGACATAATGCATGCATACCAGCTCGTG
2881 TAACTGGTGAATAATCCCCAGCTTACAGTCATATTTAACAACTCTGTGACTTGCTATAATTAAAAATAAATGTTAACTCT
2961 TCTAGCCATC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uguuucaagacaucACGUGACu 5'
                        ||||||| 
Target 5' acaacaatacatttTGCACTGt 3'
 646 - 667 140.00 -9.70
2 
miRNA  3' ugUUUCAAGACAUCACGUGACu 5'
            :|| | || |  ||:|||| 
Target 5' ttGAATTCCTTT--TGTACTGg 3'
 2650 - 2669 136.00 -8.80
3 
miRNA  3' uguUUCAAGACAU-CACGUGACu 5'
             |: |  ||||  ||:|||| 
Target 5' actAGCTGATGTATCTGTACTGt 3'
 2801 - 2823 135.00 -9.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30146616 9 COSMIC
COSN26960689 23 COSMIC
COSN31546654 33 COSMIC
COSN14180837 41 COSMIC
COSN26603716 41 COSMIC
COSN30499880 44 COSMIC
COSN30182273 53 COSMIC
COSN29462113 74 COSMIC
COSN30146649 81 COSMIC
COSN30114003 130 COSMIC
COSN20101444 278 COSMIC
COSN5610916 310 COSMIC
COSN28634720 455 COSMIC
COSN31530807 461 COSMIC
COSN31547855 477 COSMIC
COSN30159258 584 COSMIC
COSN31523500 650 COSMIC
COSN31556731 735 COSMIC
COSN17075700 745 COSMIC
COSN5810040 994 COSMIC
COSN31520439 1001 COSMIC
COSN29098910 1251 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1441072213 7 dbSNP
rs757046529 9 dbSNP
rs745475521 11 dbSNP
rs770467476 17 dbSNP
rs1359519218 18 dbSNP
rs1213560039 19 dbSNP
rs778421127 20 dbSNP
rs1193775350 25 dbSNP
rs755590784 26 dbSNP
rs748741058 36 dbSNP
rs1245629553 38 dbSNP
rs769342628 42 dbSNP
rs774972126 45 dbSNP
rs547158174 46 dbSNP
rs1254959107 47 dbSNP
rs1485018352 50 dbSNP
rs939789478 62 dbSNP
rs1198511570 67 dbSNP
rs374814793 68 dbSNP
rs1252857075 69 dbSNP
rs1480809867 87 dbSNP
rs1037167447 96 dbSNP
rs1235233170 101 dbSNP
rs1250796093 102 dbSNP
rs1018822145 103 dbSNP
rs1295412393 103 dbSNP
rs189479859 106 dbSNP
rs996046665 112 dbSNP
rs1028482328 123 dbSNP
rs535763752 124 dbSNP
rs1413088768 130 dbSNP
rs974720311 132 dbSNP
rs890079977 133 dbSNP
rs557219483 136 dbSNP
rs1428636510 144 dbSNP
rs1193788178 145 dbSNP
rs1387802161 146 dbSNP
rs1187751059 148 dbSNP
rs146287903 156 dbSNP
rs1283118451 170 dbSNP
rs1236800876 176 dbSNP
rs1185207716 177 dbSNP
rs181866625 195 dbSNP
rs187205518 199 dbSNP
rs978189138 209 dbSNP
rs1375161541 216 dbSNP
rs768577890 223 dbSNP
rs774527465 225 dbSNP
rs1466510233 231 dbSNP
rs554596199 260 dbSNP
rs1340731639 269 dbSNP
rs146114846 274 dbSNP
rs75003579 274 dbSNP
rs916621367 277 dbSNP
rs1357768501 285 dbSNP
rs542200274 286 dbSNP
rs1408901152 292 dbSNP
rs1294207730 296 dbSNP
rs957235013 302 dbSNP
rs990430236 308 dbSNP
rs1368313198 310 dbSNP
rs915729643 311 dbSNP
rs1297700713 313 dbSNP
rs749633519 314 dbSNP
rs1232525959 315 dbSNP
rs981295132 316 dbSNP
rs1161422381 322 dbSNP
rs574659675 334 dbSNP
rs999707573 343 dbSNP
rs1052830083 348 dbSNP
rs928323496 349 dbSNP
rs939652870 355 dbSNP
rs1482888320 365 dbSNP
rs1271027500 368 dbSNP
rs540093793 373 dbSNP
rs1231362151 377 dbSNP
rs560292246 386 dbSNP
rs1438498411 393 dbSNP
rs1213857960 394 dbSNP
rs573378976 395 dbSNP
rs1484578423 398 dbSNP
rs1294361947 399 dbSNP
rs1187738708 402 dbSNP
rs1228134739 411 dbSNP
rs1348296330 421 dbSNP
rs114752985 425 dbSNP
rs1478430146 432 dbSNP
rs931073633 436 dbSNP
rs3087813 455 dbSNP
rs1348796883 468 dbSNP
rs139310218 471 dbSNP
rs889942782 472 dbSNP
rs1395114984 478 dbSNP
rs964434534 490 dbSNP
rs1008495148 494 dbSNP
rs1019853936 495 dbSNP
rs1463213626 497 dbSNP
rs902518283 501 dbSNP
rs996038114 502 dbSNP
rs1027543427 506 dbSNP
rs1179177925 511 dbSNP
rs1470604058 512 dbSNP
rs1246265077 527 dbSNP
rs1211895758 530 dbSNP
rs1470252119 537 dbSNP
rs1274331466 538 dbSNP
rs1208598724 541 dbSNP
rs951861465 568 dbSNP
rs983251454 570 dbSNP
rs999898321 584 dbSNP
rs1032335361 589 dbSNP
rs958388445 601 dbSNP
rs990907237 610 dbSNP
rs1023233875 612 dbSNP
rs969843343 628 dbSNP
rs1341119669 630 dbSNP
rs1414033841 631 dbSNP
rs1346763096 641 dbSNP
rs1159551077 647 dbSNP
rs759906522 654 dbSNP
rs1043972392 658 dbSNP
rs150020924 664 dbSNP
rs935445426 665 dbSNP
rs762608434 678 dbSNP
rs928523135 679 dbSNP
rs961271146 682 dbSNP
rs1188488562 688 dbSNP
rs561462007 692 dbSNP
rs1277723085 700 dbSNP
rs972849049 700 dbSNP
rs1235975988 701 dbSNP
rs530413478 704 dbSNP
rs1009059096 705 dbSNP
rs1296155266 714 dbSNP
rs919582921 716 dbSNP
rs772430600 719 dbSNP
rs931081365 726 dbSNP
rs546879762 737 dbSNP
rs911411811 740 dbSNP
rs1357168318 742 dbSNP
rs1314728297 745 dbSNP
rs995817326 748 dbSNP
rs944148991 749 dbSNP
rs145246931 756 dbSNP
rs1027489515 764 dbSNP
rs1217390424 765 dbSNP
rs951973872 776 dbSNP
rs771444702 779 dbSNP
rs902800932 781 dbSNP
rs1264436617 782 dbSNP
rs999764683 786 dbSNP
rs1483140689 787 dbSNP
rs1255883521 790 dbSNP
rs992637989 791 dbSNP
rs1476420825 803 dbSNP
rs1348139639 811 dbSNP
rs1054226371 812 dbSNP
rs1182774634 820 dbSNP
rs1224573965 821 dbSNP
rs1407619217 829 dbSNP
rs532090259 830 dbSNP
rs1161398060 831 dbSNP
rs551825192 835 dbSNP
rs1395346332 852 dbSNP
rs1361177787 855 dbSNP
rs1353337705 861 dbSNP
rs1314419458 864 dbSNP
rs760133098 865 dbSNP
rs1434064564 867 dbSNP
rs1416916468 869 dbSNP
rs148672531 875 dbSNP
rs969874570 878 dbSNP
rs1460509627 881 dbSNP
rs1310945903 886 dbSNP
rs1002696431 896 dbSNP
rs1374815735 900 dbSNP
rs1357262692 903 dbSNP
rs764633402 907 dbSNP
rs1423671583 927 dbSNP
rs1416222226 929 dbSNP
rs1190508075 930 dbSNP
rs1485818027 933 dbSNP
rs1250589935 938 dbSNP
rs752312362 947 dbSNP
rs972661084 948 dbSNP
rs537477544 949 dbSNP
rs1427194406 950 dbSNP
rs919596467 951 dbSNP
rs554538428 963 dbSNP
rs554678950 968 dbSNP
rs935561582 978 dbSNP
rs1370796196 984 dbSNP
rs1294968411 985 dbSNP
rs985616812 1001 dbSNP
rs1306587426 1005 dbSNP
rs1356392587 1005 dbSNP
rs144395931 1006 dbSNP
rs1225054033 1007 dbSNP
rs910940241 1018 dbSNP
rs762506366 1019 dbSNP
rs1309356934 1022 dbSNP
rs116479289 1024 dbSNP
rs1298808641 1042 dbSNP
rs1461441144 1043 dbSNP
rs775656986 1043 dbSNP
rs1167614543 1047 dbSNP
rs774132282 1049 dbSNP
rs1040505296 1053 dbSNP
rs1179233641 1055 dbSNP
rs1467112401 1061 dbSNP
rs775559867 1061 dbSNP
rs900252818 1061 dbSNP
rs931617546 1074 dbSNP
rs1214195169 1076 dbSNP
rs1048707409 1084 dbSNP
rs1059236 1093 dbSNP
rs1237169605 1097 dbSNP
rs1337751793 1100 dbSNP
rs1468804698 1101 dbSNP
rs1004739806 1119 dbSNP
rs924093209 1121 dbSNP
rs935595007 1124 dbSNP
rs1328561421 1133 dbSNP
rs1462365721 1134 dbSNP
rs1384719370 1146 dbSNP
rs147192503 1167 dbSNP
rs896278415 1168 dbSNP
rs1054018373 1170 dbSNP
rs1455080897 1173 dbSNP
rs1363983159 1179 dbSNP
rs1197600712 1181 dbSNP
rs1452055549 1182 dbSNP
rs1254289113 1189 dbSNP
rs1194190092 1190 dbSNP
rs893804338 1196 dbSNP
rs1381027429 1199 dbSNP
rs1013436487 1210 dbSNP
rs1024098684 1219 dbSNP
rs1012218454 1220 dbSNP
rs1171808394 1221 dbSNP
rs1045038473 1226 dbSNP
rs1233796099 1230 dbSNP
rs1345830175 1232 dbSNP
rs979545651 1233 dbSNP
rs1442362032 1234 dbSNP
rs553695571 1234 dbSNP
rs577079180 1238 dbSNP
rs1003562710 1239 dbSNP
rs1384248235 1240 dbSNP
rs1035515465 1241 dbSNP
rs572971640 1241 dbSNP
rs956714323 1241 dbSNP
rs1352477936 1242 dbSNP
rs988770370 1248 dbSNP
rs961205877 1251 dbSNP
rs1240264575 1252 dbSNP
rs1443961671 1253 dbSNP
rs1195178624 1255 dbSNP
rs189208785 1270 dbSNP
rs1255142777 1300 dbSNP
rs1210458270 1301 dbSNP
rs1026862989 1309 dbSNP
rs1345980419 1309 dbSNP
rs1235072376 1314 dbSNP
rs944165345 1320 dbSNP
rs1339358386 1324 dbSNP
rs559124539 1324 dbSNP
rs1268951946 1332 dbSNP
rs1230209393 1350 dbSNP
rs1331549192 1352 dbSNP
rs1369749515 1354 dbSNP
rs1312588995 1360 dbSNP
rs1412604153 1361 dbSNP
rs1376864677 1364 dbSNP
rs952491414 1371 dbSNP
rs975615526 1373 dbSNP
rs1408886486 1379 dbSNP
rs1416722914 1383 dbSNP
rs1475669945 1384 dbSNP
rs985156814 1384 dbSNP
rs1416971442 1391 dbSNP
rs1017949939 1392 dbSNP
rs564839953 1392 dbSNP
rs1484835282 1394 dbSNP
rs1304973771 1395 dbSNP
rs1211021619 1404 dbSNP
rs180739634 1406 dbSNP
rs1270888083 1415 dbSNP
rs976470068 1416 dbSNP
rs1198092523 1417 dbSNP
rs186468059 1422 dbSNP
rs1293131860 1429 dbSNP
rs1231819352 1431 dbSNP
rs935474644 1432 dbSNP
rs940372493 1436 dbSNP
rs751222206 1445 dbSNP
rs1440937167 1449 dbSNP
rs1200890473 1453 dbSNP
rs1330298544 1455 dbSNP
rs896404025 1460 dbSNP
rs1013802392 1464 dbSNP
rs756993521 1466 dbSNP
rs75008119 1468 dbSNP
rs1379381356 1472 dbSNP
rs546503125 1476 dbSNP
rs780995907 1477 dbSNP
rs561334784 1480 dbSNP
rs1206709820 1484 dbSNP
rs1417153158 1492 dbSNP
rs1458644556 1500 dbSNP
rs1032442644 1512 dbSNP
rs1036379680 1513 dbSNP
rs1411500470 1523 dbSNP
rs1331787707 1525 dbSNP
rs896980853 1526 dbSNP
rs531121798 1527 dbSNP
rs956668992 1534 dbSNP
rs544523278 1558 dbSNP
rs1009574220 1583 dbSNP
rs1020252812 1588 dbSNP
rs965652227 1588 dbSNP
rs1438189163 1589 dbSNP
rs561540105 1590 dbSNP
rs147854598 1597 dbSNP
rs1027226291 1601 dbSNP
rs1369547019 1602 dbSNP
rs1331145043 1612 dbSNP
rs1323839858 1614 dbSNP
rs1462885744 1615 dbSNP
rs530449912 1615 dbSNP
rs1394958236 1616 dbSNP
rs1158086359 1619 dbSNP
rs1400412465 1620 dbSNP
rs1406022984 1621 dbSNP
rs1179120609 1628 dbSNP
rs888407895 1630 dbSNP
rs1440433784 1631 dbSNP
rs1437840154 1637 dbSNP
rs1006793859 1642 dbSNP
rs1252380719 1642 dbSNP
rs1192323304 1653 dbSNP
rs1270181030 1661 dbSNP
rs1017967806 1665 dbSNP
rs1215483529 1677 dbSNP
rs141409653 1680 dbSNP
rs1285936253 1687 dbSNP
rs115088657 1690 dbSNP
rs908982269 1692 dbSNP
rs749882173 1694 dbSNP
rs1300553905 1695 dbSNP
rs1334454710 1700 dbSNP
rs546839185 1708 dbSNP
rs1211984224 1709 dbSNP
rs1288110939 1712 dbSNP
rs1269598821 1714 dbSNP
rs190169789 1715 dbSNP
rs1192531828 1716 dbSNP
rs940309686 1725 dbSNP
rs956653887 1728 dbSNP
rs1171142174 1735 dbSNP
rs1420478830 1744 dbSNP
rs1416813641 1748 dbSNP
rs1171845200 1757 dbSNP
rs1456000845 1759 dbSNP
rs917608290 1761 dbSNP
rs1459578270 1769 dbSNP
rs1186391900 1773 dbSNP
rs778843484 1777 dbSNP
rs1390978735 1778 dbSNP
rs1399658593 1791 dbSNP
rs1045410221 1797 dbSNP
rs915378528 1807 dbSNP
rs566844349 1812 dbSNP
rs1277656007 1817 dbSNP
rs552337176 1824 dbSNP
rs568650895 1828 dbSNP
rs948333704 1840 dbSNP
rs766151366 1842 dbSNP
rs531431545 1845 dbSNP
rs1325262422 1846 dbSNP
rs867908223 1848 dbSNP
rs1402332510 1852 dbSNP
rs1279234111 1854 dbSNP
rs1053832592 1856 dbSNP
rs927984659 1858 dbSNP
rs10641962 1861 dbSNP
rs397998299 1861 dbSNP
rs77016725 1861 dbSNP
rs33982740 1862 dbSNP
rs939313985 1867 dbSNP
rs1194836565 1877 dbSNP
rs1357279623 1878 dbSNP
rs552598479 1880 dbSNP
rs897944208 1887 dbSNP
rs371550921 1892 dbSNP
rs1028547476 1895 dbSNP
rs1250211408 1902 dbSNP
rs1202426609 1916 dbSNP
rs569300122 1922 dbSNP
rs7726102 1940 dbSNP
rs1189325444 1956 dbSNP
rs1006831606 1960 dbSNP
rs984254157 1967 dbSNP
rs908929656 1983 dbSNP
rs183160782 1984 dbSNP
rs1403014264 1985 dbSNP
rs1297663723 1992 dbSNP
rs1356753690 2002 dbSNP
rs1461269111 2012 dbSNP
rs1416059299 2014 dbSNP
rs1469294803 2015 dbSNP
rs113073592 2023 dbSNP
rs1249290397 2023 dbSNP
rs533138379 2024 dbSNP
rs111832490 2030 dbSNP
rs753135227 2032 dbSNP
rs755660849 2032 dbSNP
rs1212943565 2039 dbSNP
rs1332413695 2041 dbSNP
rs917571592 2042 dbSNP
rs549371090 2044 dbSNP
rs566058661 2051 dbSNP
rs1375347184 2053 dbSNP
rs772294570 2060 dbSNP
rs1306436528 2061 dbSNP
rs956508405 2068 dbSNP
rs1379144634 2070 dbSNP
rs1011061256 2071 dbSNP
rs575856725 2082 dbSNP
rs926530271 2085 dbSNP
rs1165361741 2089 dbSNP
rs1458133928 2096 dbSNP
rs969502247 2105 dbSNP
rs980990740 2108 dbSNP
rs1156436958 2128 dbSNP
rs936456217 2135 dbSNP
rs1238178736 2136 dbSNP
rs928184266 2137 dbSNP
rs377382902 2138 dbSNP
rs972128402 2139 dbSNP
rs1217410748 2140 dbSNP
rs1357381133 2141 dbSNP
rs1260384944 2144 dbSNP
rs919233519 2152 dbSNP
rs930773203 2154 dbSNP
rs554679778 2156 dbSNP
rs1484649564 2160 dbSNP
rs866081489 2167 dbSNP
rs1202022645 2171 dbSNP
rs1256520964 2172 dbSNP
rs1326008999 2175 dbSNP
rs942477897 2178 dbSNP
rs892335100 2182 dbSNP
rs1286764427 2186 dbSNP
rs945464914 2191 dbSNP
rs1039552011 2196 dbSNP
rs901130649 2204 dbSNP
rs1418149877 2208 dbSNP
rs998086190 2211 dbSNP
rs1179171506 2222 dbSNP
rs1041555850 2224 dbSNP
rs1396785571 2225 dbSNP
rs1381647964 2239 dbSNP
rs1439825719 2248 dbSNP
rs376669474 2248 dbSNP
rs35674489 2254 dbSNP
rs747266256 2256 dbSNP
rs1446244242 2257 dbSNP
rs1052137936 2259 dbSNP
rs892095925 2260 dbSNP
rs574745157 2269 dbSNP
rs1172440059 2273 dbSNP
rs1286885697 2278 dbSNP
rs150920965 2283 dbSNP
rs1464934418 2288 dbSNP
rs550591786 2294 dbSNP
rs888704334 2295 dbSNP
rs1199938781 2306 dbSNP
rs1403309978 2309 dbSNP
rs1326218904 2317 dbSNP
rs73773421 2322 dbSNP
rs1401533506 2323 dbSNP
rs1015712516 2324 dbSNP
rs1379359084 2325 dbSNP
rs1311795371 2326 dbSNP
rs112731971 2327 dbSNP
rs971825713 2331 dbSNP
rs1173094674 2335 dbSNP
rs1002360834 2340 dbSNP
rs532658014 2342 dbSNP
rs1302753263 2344 dbSNP
rs567139182 2347 dbSNP
rs980442530 2348 dbSNP
rs1201584559 2354 dbSNP
rs926311635 2355 dbSNP
rs1256396900 2356 dbSNP
rs972712099 2360 dbSNP
rs919283870 2362 dbSNP
rs1193835156 2369 dbSNP
rs1239663498 2373 dbSNP
rs1292328725 2379 dbSNP
rs758574131 2379 dbSNP
rs989422962 2379 dbSNP
rs952101690 2380 dbSNP
rs562695314 2382 dbSNP
rs945217232 2383 dbSNP
rs984903075 2384 dbSNP
rs1250524514 2401 dbSNP
rs879831740 2404 dbSNP
rs1431980916 2406 dbSNP
rs1178809500 2408 dbSNP
rs910675250 2409 dbSNP
rs76591641 2418 dbSNP
rs1239351163 2420 dbSNP
rs1039582811 2426 dbSNP
rs1188292465 2428 dbSNP
rs1437806865 2430 dbSNP
rs186065419 2433 dbSNP
rs376148044 2434 dbSNP
rs1319040635 2436 dbSNP
rs775863061 2451 dbSNP
rs1231146944 2454 dbSNP
rs1380849360 2460 dbSNP
rs1447717353 2466 dbSNP
rs1052755535 2473 dbSNP
rs1016288127 2484 dbSNP
rs1325302455 2485 dbSNP
rs897292429 2486 dbSNP
rs1333292416 2494 dbSNP
rs1447355434 2495 dbSNP
rs892131159 2498 dbSNP
rs11955879 2503 dbSNP
rs1043363600 2508 dbSNP
rs1403849956 2521 dbSNP
rs1301954312 2523 dbSNP
rs1306815272 2526 dbSNP
rs1024693945 2528 dbSNP
rs767569147 2535 dbSNP
rs904990093 2542 dbSNP
rs1001889736 2545 dbSNP
rs1318164931 2552 dbSNP
rs771166888 2552 dbSNP
rs980556953 2563 dbSNP
rs1458603626 2578 dbSNP
rs1252808628 2579 dbSNP
rs1219798091 2580 dbSNP
rs1033329863 2582 dbSNP
rs1290188759 2586 dbSNP
rs1222786530 2592 dbSNP
rs957723008 2594 dbSNP
rs527311504 2604 dbSNP
rs76462111 2605 dbSNP
rs749156052 2627 dbSNP
rs896629784 2629 dbSNP
rs1323699437 2632 dbSNP
rs190446609 2634 dbSNP
rs1026948488 2636 dbSNP
rs952323738 2639 dbSNP
rs1426136748 2640 dbSNP
rs1324458504 2647 dbSNP
rs539744289 2651 dbSNP
rs1378609239 2652 dbSNP
rs572466755 2659 dbSNP
rs1348334309 2669 dbSNP
rs1395036983 2673 dbSNP
rs1189945815 2675 dbSNP
rs878910847 2681 dbSNP
rs932733953 2689 dbSNP
rs1247600353 2696 dbSNP
rs767277810 2705 dbSNP
rs1287587867 2707 dbSNP
rs1240210144 2712 dbSNP
rs183395890 2714 dbSNP
rs1299143263 2716 dbSNP
rs1220810441 2721 dbSNP
rs1269365231 2723 dbSNP
rs35294972 2723 dbSNP
rs61282966 2723 dbSNP
rs72538772 2726 dbSNP
rs1430330405 2728 dbSNP
rs922446209 2730 dbSNP
rs112451059 2731 dbSNP
rs933776271 2734 dbSNP
rs140702369 2737 dbSNP
rs897408718 2738 dbSNP
rs1435409126 2739 dbSNP
rs1014543022 2740 dbSNP
rs1399843038 2742 dbSNP
rs1279893985 2747 dbSNP
rs1264914242 2750 dbSNP
rs1216838474 2755 dbSNP
rs537973023 2756 dbSNP
rs1212227093 2759 dbSNP
rs112444267 2764 dbSNP
rs1272085895 2774 dbSNP
rs1216592410 2775 dbSNP
rs755866379 2777 dbSNP
rs1280339760 2780 dbSNP
rs1043396475 2782 dbSNP
rs1354961133 2792 dbSNP
rs1287352973 2794 dbSNP
rs904854618 2795 dbSNP
rs1323142990 2798 dbSNP
rs937775178 2803 dbSNP
rs1221741816 2804 dbSNP
rs1259575001 2813 dbSNP
rs1485827709 2816 dbSNP
rs575269957 2826 dbSNP
rs896660488 2829 dbSNP
rs1033444506 2831 dbSNP
rs1265820160 2839 dbSNP
rs1464422953 2841 dbSNP
rs1325760112 2844 dbSNP
rs957670509 2845 dbSNP
rs188906046 2846 dbSNP
rs1187638981 2847 dbSNP
rs1253548106 2850 dbSNP
rs1411978964 2853 dbSNP
rs1483262029 2857 dbSNP
rs138435132 2858 dbSNP
rs747059419 2859 dbSNP
rs1026481270 2864 dbSNP
rs888051290 2865 dbSNP
rs1417812519 2866 dbSNP
rs922409569 2872 dbSNP
rs1006461533 2878 dbSNP
rs1017634010 2879 dbSNP
rs1397886648 2880 dbSNP
rs985479858 2888 dbSNP
rs1329763154 2897 dbSNP
rs1331268021 2901 dbSNP
rs964685908 2903 dbSNP
rs976165981 2904 dbSNP
rs761656345 2906 dbSNP
rs141357772 2907 dbSNP
rs1460633932 2907 dbSNP
rs956139739 2908 dbSNP
rs1423893191 2919 dbSNP
rs1228475457 2927 dbSNP
rs192395327 2930 dbSNP
rs1037433393 2934 dbSNP
rs988417957 2935 dbSNP
rs1350796670 2937 dbSNP
rs1176762224 2940 dbSNP
rs1459028939 2941 dbSNP
rs73121500 2951 dbSNP
rs1212810922 2952 dbSNP
rs1487357344 2959 dbSNP
rs946653084 2960 dbSNP
rs182741045 2961 dbSNP
rs758513362 2963 dbSNP
rs1322424379 2966 dbSNP
rs1308612893 2968 dbSNP
rs576552693 2974 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 167153.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uguuucaagacaucACGUGACu 5'
                        ||||||| 
Target 5' acaacaauacauuuUGCACUGu 3'
 		3 - 24
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000453514.1 | 3UTR | AAACAACAAUACAUUUUGCACUGUAGUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.766 6.4e-6 0.701 6.8e-5 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.635 1.3e-3 0.821 4.6e-6 20 Click to see details
GSE28260 Renal cortex and medulla -0.544 2.7e-2 -0.599 1.5e-2 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.34 5.2e-2 -0.135 2.6e-1 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.365 5.7e-2 0.083 3.6e-1 20 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.558 5.9e-2 -0.617 3.8e-2 9 Click to see details
GSE21032 Prostate cancer 0.151 8.6e-2 0.055 3.1e-1 83 Click to see details
GSE38226 Liver fibrosis -0.288 1.0e-1 -0.290 1.0e-1 21 Click to see details
GSE21687 Ependynoma primary tumors 0.134 1.5e-1 0.037 3.9e-1 64 Click to see details
GSE21849 B cell lymphoma 0.173 1.8e-1 0.179 1.8e-1 29 Click to see details
GSE32688 Pancreatic cancer 0.129 2.4e-1 0.104 2.9e-1 32 Click to see details
GSE19536 Breast cancer 0.07 2.4e-1 0.093 1.8e-1 100 Click to see details
GSE17306 Multiple myeloma 0.082 2.9e-1 -0.034 4.1e-1 49 Click to see details
GSE27834 Pluripotent stem cells -0.142 3.0e-1 -0.050 4.3e-1 16 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.104 3.1e-1 0.094 3.3e-1 25 Click to see details
GSE14794 Lymphoblastoid cells -0.037 3.6e-1 -0.058 2.9e-1 90 Click to see details
GSE19783 ER- ER- breast cancer 0.022 4.2e-1 0.034 3.8e-1 79 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.032 4.4e-1 -0.095 3.3e-1 25 Click to see details
GSE19350 CNS germ cell tumors -0.005 4.9e-1 -0.033 4.6e-1 12 Click to see details
GSE42095 Differentiated embryonic stem cells -0.003 4.9e-1 -0.100 3.2e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP 0.448 0.01 0.450 0 32 Click to see details
KICH 0.482 0.01 0.478 0.01 25 Click to see details
BLCA 0.437 0.03 0.296 0.12 18 Click to see details
COAD -0.609 0.05 -0.738 0.02 8 Click to see details
UCEC 0.324 0.09 0.358 0.07 19 Click to see details
PRAD -0.178 0.11 -0.171 0.12 50 Click to see details
LIHC -0.171 0.12 -0.061 0.34 49 Click to see details
BRCA -0.124 0.13 -0.084 0.22 84 Click to see details
STAD 0.204 0.13 0.210 0.12 32 Click to see details
LUAD -0.326 0.15 -0.378 0.11 12 Click to see details
PAAD -0.681 0.16 -0.800 0.1 4 Click to see details
CHOL 0.36 0.17 0.133 0.37 9 Click to see details
LUSC -0.156 0.17 -0.083 0.31 38 Click to see details
ESCA 0.292 0.19 -0.009 0.49 11 Click to see details
PCPG 0.822 0.19 0.500 0.33 3 Click to see details
KIRC 0.087 0.24 0.074 0.27 68 Click to see details
HNSC 0.047 0.38 -0.001 0.5 42 Click to see details
CESC -0.252 0.42 -0.500 0.33 3 Click to see details
THCA 0.012 0.46 -0.044 0.37 59 Click to see details
THCA 0.012 0.46 -0.044 0.37 59 Click to see details
THCA 0.012 0.46 -0.044 0.37 59 Click to see details
205 hsa-miR-148a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000020 DNMT1 DNA methyltransferase 1 7 7
MIRT000297 HLA-G major histocompatibility complex, class I, G 2 1
MIRT000298 TGIF2 TGFB induced factor homeobox 2 3 2
MIRT000955 DNMT3B DNA methyltransferase 3 beta 5 2
MIRT003998 NR1I2 nuclear receptor subfamily 1 group I member 2 7 2
MIRT004504 RPS6KA5 ribosomal protein S6 kinase A5 4 1
MIRT005898 CCKBR cholecystokinin B receptor 4 3
MIRT006859 IRS1 insulin receptor substrate 1 2 1
MIRT006946 ACVR1 activin A receptor type 1 2 2
MIRT006975 BCL2 BCL2, apoptosis regulator 1 1
MIRT007017 TMED7 transmembrane p24 trafficking protein 7 1 1
MIRT025970 GPATCH8 G-patch domain containing 8 1 1
MIRT025971 TMEM14A transmembrane protein 14A 1 1
MIRT025972 ANP32A acidic nuclear phosphoprotein 32 family member A 1 1
MIRT025973 RAB1B RAB1B, member RAS oncogene family 1 1
MIRT025974 HSP90B1 heat shock protein 90 beta family member 1 1 1
MIRT025975 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT025976 CYCS cytochrome c, somatic 1 1
MIRT025977 ADARB1 adenosine deaminase, RNA specific B1 1 1
MIRT025978 CBX3 chromobox 3 1 1
MIRT025979 UQCRQ ubiquinol-cytochrome c reductase complex III subunit VII 1 1
MIRT025980 SPRY2 sprouty RTK signaling antagonist 2 1 1
MIRT025981 PAN3 PAN3 poly(A) specific ribonuclease subunit 1 1
MIRT025982 KANSL1 KAT8 regulatory NSL complex subunit 1 1 1
MIRT025983 GAS1 growth arrest specific 1 2 6
MIRT025984 PTPN4 protein tyrosine phosphatase, non-receptor type 4 1 1
MIRT025985 ZNF92 zinc finger protein 92 1 1
MIRT025986 RAB10 RAB10, member RAS oncogene family 1 1
MIRT025987 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 3
MIRT025988 HCCS holocytochrome c synthase 1 1
MIRT025989 WAPAL WAPL cohesin release factor 1 1
MIRT025990 MPP5 membrane palmitoylated protein 5 1 1
MIRT025991 ZNF490 zinc finger protein 490 1 1
MIRT025992 RAB12 RAB12, member RAS oncogene family 2 3
MIRT025993 GNB5 G protein subunit beta 5 1 1
MIRT025994 SNAPIN SNAP associated protein 2 3
MIRT025995 PSMD9 proteasome 26S subunit, non-ATPase 9 1 1
MIRT025996 TRIM59 tripartite motif containing 59 1 1
MIRT025997 DYNLL2 dynein light chain LC8-type 2 1 1
MIRT025998 SECISBP2L SECIS binding protein 2 like 2 6
MIRT025999 LYSMD1 LysM domain containing 1 1 1
MIRT026000 PBXIP1 PBX homeobox interacting protein 1 2 2
MIRT026001 MTMR9 myotubularin related protein 9 1 1
MIRT026002 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 1 1
MIRT026003 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT026004 LBR lamin B receptor 1 1
MIRT026005 KIAA1549 KIAA1549 1 1
MIRT026006 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 1 1
MIRT026007 CDK19 cyclin dependent kinase 19 2 3
MIRT026008 RAB34 RAB34, member RAS oncogene family 2 3
MIRT026009 ARRDC3 arrestin domain containing 3 1 1
MIRT026010 PRNP prion protein 2 1
MIRT026011 HOXC8 homeobox C8 4 1
MIRT026012 TMEM9B TMEM9 domain family member B 1 1
MIRT026013 RASSF8 Ras association domain family member 8 1 1
MIRT026014 BTBD3 BTB domain containing 3 2 12
MIRT026015 TNRC6A trinucleotide repeat containing 6A 2 3
MIRT026016 SESTD1 SEC14 and spectrin domain containing 1 1 1
MIRT026017 CDC25B cell division cycle 25B 3 1
MIRT048023 MRPL45 mitochondrial ribosomal protein L45 1 1
MIRT048024 DENR density regulated re-initiation and release factor 1 1
MIRT048025 APPBP2 amyloid beta precursor protein binding protein 2 1 1
MIRT048026 SLC2A3 solute carrier family 2 member 3 1 1
MIRT048027 PTPN23 protein tyrosine phosphatase, non-receptor type 23 1 1
MIRT048028 VPS41 VPS41, HOPS complex subunit 1 1
MIRT048029 MSL3 MSL complex subunit 3 1 1
MIRT048030 AMELX amelogenin, X-linked 1 1
MIRT048031 OR2C3 olfactory receptor family 2 subfamily C member 3 1 1
MIRT048032 SLC25A3 solute carrier family 25 member 3 1 1
MIRT048033 APC APC, WNT signaling pathway regulator 1 1
MIRT048034 GOLIM4 golgi integral membrane protein 4 1 1
MIRT048035 MYCBP2 MYC binding protein 2, E3 ubiquitin protein ligase 1 1
MIRT048036 RPS17 ribosomal protein S17 1 1
MIRT048037 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT048038 WDTC1 WD and tetratricopeptide repeats 1 1 1
MIRT048039 HMGB1 high mobility group box 1 1 1
MIRT048040 MAP3K4 mitogen-activated protein kinase kinase kinase 4 4 2
MIRT048041 USP38 ubiquitin specific peptidase 38 1 1
MIRT048042 NONO non-POU domain containing octamer binding 1 1
MIRT048043 CCNI cyclin I 1 1
MIRT048044 AURKB aurora kinase B 1 1
MIRT052917 MMP7 matrix metallopeptidase 7 4 1
MIRT053185 WNT10B Wnt family member 10B 4 1
MIRT053199 MYC MYC proto-oncogene, bHLH transcription factor 2 1
MIRT053475 CDKN1B cyclin dependent kinase inhibitor 1B 4 5
MIRT053477 SERPINE1 serpin family E member 1 3 1
MIRT053478 ITGB8 integrin subunit beta 8 5 3
MIRT053479 VAV2 vav guanine nucleotide exchange factor 2 3 1
MIRT053480 ITGA5 integrin subunit alpha 5 3 1
MIRT053483 ROCK1 Rho associated coiled-coil containing protein kinase 1 6 3
MIRT053518 RUNX3 runt related transcription factor 3 2 1
MIRT053560 SMAD2 SMAD family member 2 3 1
MIRT054115 UNKL unkempt family like zinc finger 1 1
MIRT054388 MET MET proto-oncogene, receptor tyrosine kinase 3 1
MIRT057492 CEP55 centrosomal protein 55 2 4
MIRT062708 MLEC malectin 2 4
MIRT084562 BCL2L11 BCL2 like 11 2 1
MIRT105304 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT130076 TXNIP thioredoxin interacting protein 4 4
MIRT138426 KIF2C kinesin family member 2C 2 2
MIRT152411 ARID3A AT-rich interaction domain 3A 2 2
MIRT155749 SIK1 salt inducible kinase 1 2 6
MIRT210293 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT218522 HLA-A major histocompatibility complex, class I, A 2 2
MIRT222270 CCT6A chaperonin containing TCP1 subunit 6A 2 2
MIRT270936 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT280554 GLRX5 glutaredoxin 5 2 2
MIRT281136 PDIA3 protein disulfide isomerase family A member 3 3 1
MIRT296526 STX16 syntaxin 16 2 2
MIRT301572 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT347400 CEBPG CCAAT/enhancer binding protein gamma 2 2
MIRT382244 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT399584 RBM38 RNA binding motif protein 38 2 2
MIRT437409 MAFB MAF bZIP transcription factor B 1 1
MIRT438088 ERRFI1 ERBB receptor feedback inhibitor 1 2 1
MIRT438751 S1PR1 sphingosine-1-phosphate receptor 1 3 3
MIRT438752 USP4 ubiquitin specific peptidase 4 3 1
MIRT453164 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT456196 ZDHHC6 zinc finger DHHC-type containing 6 2 2
MIRT458103 TTLL1 tubulin tyrosine ligase like 1 2 2
MIRT459958 POC1A POC1 centriolar protein A 2 2
MIRT461329 MRPS27 mitochondrial ribosomal protein S27 2 2
MIRT462848 B4GALT7 beta-1,4-galactosyltransferase 7 2 2
MIRT463247 ZIC5 Zic family member 5 2 2
MIRT464041 WASL Wiskott-Aldrich syndrome like 2 2
MIRT466869 STX6 syntaxin 6 2 2
MIRT467697 SLC38A2 solute carrier family 38 member 2 2 4
MIRT468920 RPS6KA4 ribosomal protein S6 kinase A4 2 2
MIRT469506 RCC2 regulator of chromosome condensation 2 2 2
MIRT469815 RAB14 RAB14, member RAS oncogene family 2 2
MIRT470329 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT473770 MAP3K9 mitogen-activated protein kinase kinase kinase 9 5 3
MIRT477363 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT478215 DDX6 DEAD-box helicase 6 2 2
MIRT479812 CCNA2 cyclin A2 2 6
MIRT484939 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485432 KLF6 Kruppel like factor 6 9 3
MIRT485645 DICER1 dicer 1, ribonuclease III 2 4
MIRT487938 HLA-C major histocompatibility complex, class I, C 3 2
MIRT488937 ETV7 ETS variant 7 2 2
MIRT492821 PATL1 PAT1 homolog 1, processing body mRNA decay factor 2 2
MIRT496749 PDIK1L PDLIM1 interacting kinase 1 like 2 2
MIRT497883 SLC12A7 solute carrier family 12 member 7 2 2
MIRT500918 STARD13 StAR related lipid transfer domain containing 13 2 4
MIRT503176 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT505102 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 2
MIRT505256 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT511220 LNPEP leucyl and cystinyl aminopeptidase 2 4
MIRT513209 RFT1 RFT1 homolog 2 2
MIRT513617 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT522804 KPNA4 karyopherin subunit alpha 4 2 4
MIRT525443 RBM23 RNA binding motif protein 23 2 2
MIRT530302 AKAP17A A-kinase anchoring protein 17A 2 2
MIRT531689 MYO3A myosin IIIA 2 2
MIRT537300 FZD5 frizzled class receptor 5 2 2
MIRT541199 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT544732 NDRG1 N-myc downstream regulated 1 2 2
MIRT549174 BMP3 bone morphogenetic protein 3 2 2
MIRT549231 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT551864 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT559687 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT561658 RNF219 ring finger protein 219 2 2
MIRT561856 NPTX1 neuronal pentraxin 1 2 2
MIRT565733 SESN3 sestrin 3 2 2
MIRT566568 OTUD4 OTU deubiquitinase 4 2 2
MIRT567186 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT567834 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT574794 FAM104A family with sequence similarity 104 member A 2 2
MIRT576772 Tmem127 transmembrane protein 127 2 2
MIRT610545 WNT2B Wnt family member 2B 2 4
MIRT613042 FOXP1 forkhead box P1 2 2
MIRT615073 COLEC12 collectin subfamily member 12 2 2
MIRT617481 AP5B1 adaptor related protein complex 5 beta 1 subunit 2 2
MIRT622753 PHACTR2 phosphatase and actin regulator 2 2 2
MIRT625516 PPAPDC1A phospholipid phosphatase 4 2 2
MIRT628641 ABLIM1 actin binding LIM protein 1 2 2
MIRT630234 SORD sorbitol dehydrogenase 2 2
MIRT635946 PLA2G12A phospholipase A2 group XIIA 2 2
MIRT646776 IL23R interleukin 23 receptor 2 2
MIRT648163 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT653244 SOS2 SOS Ras/Rho guanine nucleotide exchange factor 2 5 2
MIRT661182 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT693234 KIAA0907 KIAA0907 2 4
MIRT693776 VGLL2 vestigial like family member 2 2 2
MIRT702589 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT715175 DTX4 deltex E3 ubiquitin ligase 4 2 2
MIRT722871 FAM212B family with sequence similarity 212 member B 2 2
MIRT723139 YPEL1 yippee like 1 2 2
MIRT723186 OVOL1 ovo like transcriptional repressor 1 2 2
MIRT732353 WNT1 Wnt family member 1 3 1
MIRT732362 STAT3 signal transducer and activator of transcription 3 3 1
MIRT734547 HNRNPK heterogeneous nuclear ribonucleoprotein K 2 0
MIRT734935 CXCR4 C-X-C motif chemokine receptor 4 1 0
MIRT736034 ITGA9 integrin subunit alpha 9 3 0
MIRT736105 PTEN phosphatase and tensin homolog 5 1
MIRT736114 IL15 interleukin 15 2 0
MIRT736501 AKT1 AKT serine/threonine kinase 1 1 0
MIRT737228 PCGEM1 PCGEM1, prostate-specific transcript (non-protein coding) 2 0
MIRT737363 UBAP2 ubiquitin associated protein 2 3 0
MIRT737364 FOXK2 forkhead box K2 3 0
MIRT755397 WNT10A Wnt family member 10A 2 1
MIRT755440 LDLR low density lipoprotein receptor 1 1
MIRT756258 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 3 1
MIRT756289 SLC7A11 solute carrier family 7 member 11 2 1
MIRT756402 CNTN4 contactin 4 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-148a Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-148a Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
miR-148a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-148a Bilobalide NULL 73581 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Bilobalide NULL 73581 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-148a Daidzein NULL 5281708 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Dexamethasone approved 5743 Quantitative real-time PCR human colorectal adenocarcinoma Caco-2 21796641 2011 down-regulated
miR-148a Paclitaxel approved 36314 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 up-regulated
miR-148a Vinblastine approved 13342 Quantitative real-time PCR Human breast cancer MCF-7 cells 21796641 2011 down-regulated
miR-148a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-148a 5a-dihydrotestosterone (DHT) NULL 15 Quantitative real-time PCR LNCaP cells 22266859 2012 up-regulated
miR-148a Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miR-148a Celecoxib approved 2662 Microarray gastric cancer cells. 23001726 2013 up-regulated
miR-148a Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miR-148a 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 up-regulated
miR-148a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-148a Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer tissue
hsa-mir-148a Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer tissue
hsa-mir-148a Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-148a Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-148a Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-148a Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-148a Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-148a Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-148a-3p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-148a-3p (2,3-dihydroxyphenyl)-[1-[(4-fluorophenyl)methyl]-4-hydroxyindol-3-yl]methanone 42624812 NSC746053 sensitive
hsa-miR-148a-3p (2E)-2-[(2-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516827 NSC639520 sensitive
hsa-miR-148a-3p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-148a-3p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-148a-3p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 resistant
hsa-miR-148a-3p (4z,5z)-1-[(e)-(2-hydroxyphenyl)methyleneamino]-3-phenyl-4,5-bis(phenylimino)imidazolidine-2-thione 135509182 NSC671409 resistant
hsa-miR-148a-3p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-148a-3p (E)-1-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54612660 NSC741738 resistant
hsa-miR-148a-3p (e)-3-chloro-2-(3,4-dimethoxyphenyl)-3-(3,4-dipropoxyphenyl)prop-2-enal 3004402 NSC650594 sensitive
hsa-miR-148a-3p (e)-but-2-enedioic acid;1-(7,8,9,10-tetrahydrophenanthridin-6-yl)piperidin-4-amine 5471308 NSC710333 sensitive
hsa-miR-148a-3p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-methylphenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351426 NSC670225 sensitive
hsa-miR-148a-3p .beta.-d-glucopyranose, 2,3-o-(diethylstannylene)- 16683462 NSC306911 sensitive
hsa-miR-148a-3p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 sensitive
hsa-miR-148a-3p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-148a-3p [1,1,1,3,3,3-hexafluoro-2-(quinolin-2-ylmethyl)propan-2-yl] acetate 379602 NSC664303 sensitive
hsa-miR-148a-3p [2-(4-methoxyphenyl)-2-oxoethyl] (2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[[(2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[2-(4-methoxyphenyl)-2-oxoethoxy]-3-oxopropyl]diselanyl]propanoate 45029327 NSC746149 resistant
hsa-miR-148a-3p [4-[[2-(1h-indol-2-yl)-1,3-dioxolan-2-yl]methyl]-1-piperidyl]-phenyl-methanone 398268 NSC707982 sensitive
hsa-miR-148a-3p [7-fluoro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-(furan-2-yl)methanone 23635646 NSC736443 sensitive
hsa-miR-148a-3p [acetyl(diphenyl)[?]yl] acetate 363302 NSC628121 sensitive
hsa-miR-148a-3p 1-((4-methylene-5-oxo-2-phenyltetrahydro-2-furanyl)methyl)dihydro-2,4(1h,3h)-pyrimidinedione 381497 NSC668253 sensitive
hsa-miR-148a-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 sensitive
hsa-miR-148a-3p 1-[(1e)-2,3,3-trichloro-1-[chloro(nitro)methylene]allyl]piperidine 3004947 NSC665087 sensitive
hsa-miR-148a-3p 1-[(4-fluorophenyl)amino]-2,3-propanopyrido[1,2-a]benzimidazole-4-carbonitrile 395404 NSC699940 resistant
hsa-miR-148a-3p 1-cyclohexyl-3-[(e)-(6-methyl-2-pyridyl)methyleneamino]thiourea 9571907 NSC670782 sensitive
hsa-miR-148a-3p 12-(3,5-ditert-butyl-4-hydroxyphenyl)-1,4,7,10,13,16-hexaoxacyclooctadecane-2,9-dione 386885 NSC679743 resistant
hsa-miR-148a-3p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 resistant
hsa-miR-148a-3p 17-methyl-13,14,17-triazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,8,11(16),14-heptaen-12-one 403909 NSC719502 resistant
hsa-miR-148a-3p 2-(2-naphthyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 388200 NSC682768 resistant
hsa-miR-148a-3p 2-(2-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468909 NSC679021 sensitive
hsa-miR-148a-3p 2-(2,4-dichlorobenzyl)-3,5,6-trimethyl-2h-indazole-7-carbonitrile 367590 NSC637422 resistant
hsa-miR-148a-3p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-148a-3p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepine-6-thione 4998423 NSC684481 resistant
hsa-miR-148a-3p 2-(3-methylbutylsulfanyl)naphthalene-1,4-dione 315743 NSC241494 sensitive
hsa-miR-148a-3p 2-(3-phenyl-4,5-bis(phenylimino)-1,3-thiazolidin-2-ylidene)malononitrile 383253 NSC671367 sensitive
hsa-miR-148a-3p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 sensitive
hsa-miR-148a-3p 2-(4-isothiocyanatophenyl)sulfanylacetic acid 345648 NSC403376 sensitive
hsa-miR-148a-3p 2-(6-ethenyl-4-hydroxy-6-methyl-3-methylidene-2-oxo-4,5,7,7a-tetrahydro-3aH-1-benzofuran-7-yl)prop-2-enal 495207 NSC645991 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]-1-(2-nitrophenyl)prop-2-en-1-one 411522 NSC34821 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]-1-(2,5-dimethylphenyl)prop-2-en-1-one 436059 NSC382001 sensitive
hsa-miR-148a-3p 2-[(dimethylamino)methyl]cyclopentan-1-one 244760 NSC621888 sensitive
hsa-miR-148a-3p 2-[(z)-2-(benzenesulfonyl)-2-(5-nitrofuran-2-yl)ethenyl]-5-nitrofuran 6072945 NSC291049 sensitive
hsa-miR-148a-3p 2-[(Z)-2-[3-[3-methoxy-5-(trifluoromethyl)phenyl]-1,2,4-triazol-1-yl]ethenyl]-1,3,4-oxadiazole 57524026 NSC757569 sensitive
hsa-miR-148a-3p 2-[5-[4-[5-[4-(6-morpholin-4-yl-1H-benzimidazol-2-yl)phenoxy]pentyl]piperazin-1-yl]pentyl]benzo[de]isoquinoline-1,3-dione 44219118 NSC743432 sensitive
hsa-miR-148a-3p 2-acetamido-6-methyl-8-hydroxy-1,4-naphthaquinone 377214 NSC658450 sensitive
hsa-miR-148a-3p 2-amino-6-[4-[[4,6-bis(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-4-(4-methoxyphenyl)pyridine-3-carbonitrile 45028694 NSC743853 sensitive
hsa-miR-148a-3p 2-nitro-1-phenylpropan-1-ol 226118 NSC16258 sensitive
hsa-miR-148a-3p 2,3-bis(naphthalen-2-ylsulfanyl)naphthalene-1,4-dione 312602 NSC222722 sensitive
hsa-miR-148a-3p 2,5,9,12-tetrathiabicyclo[11.4.0]heptadeca-1(13),14,16-triene-15,16-dicarbonitrile 387185 NSC680721 resistant
hsa-miR-148a-3p 2,6-bis(4-morpholinylmethyl)cyclohexanone,dihydrochloride NSC38535 sensitive
hsa-miR-148a-3p 2,6-bis[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 358899 NSC619042 sensitive
hsa-miR-148a-3p 3-(3-chloro-4-methoxyphenyl)-N-[2-(dimethylamino)ethyl]-4-pyridin-4-ylpyrazole-1-carboxamide 60147896 NSC752885 resistant
hsa-miR-148a-3p 3-(4-chlorophenyl)-6-(5-nitrofuran-2-yl)-7H-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine 364212 NSC629974 sensitive
hsa-miR-148a-3p 3-[2-[(3,5-dichlorophenyl)amino]thiazol-4-yl]chromen-2-one 395985 NSC701109 resistant
hsa-miR-148a-3p 3-[2-[[5-[(4-bromophenyl)diazenyl]-2-hydroxyphenyl]-phenylsulfanylmethyl]hydrazinyl]-3-oxo-n-phenylpropanamide 377943 NSC659611 sensitive
hsa-miR-148a-3p 3-bromo-1-oxo-2-phenylthiochromen-4-one 5472015 NSC715997 sensitive
hsa-miR-148a-3p 3-chloro-4-methyl-7-((2-methyl-4-methylene-5-oxotetrahydro-2-furanyl)methoxy)-2h-chromen-2-one 381507 NSC668263 sensitive
hsa-miR-148a-3p 3-deazaneplanocin, hydrochloride 358176 NSC617989 sensitive
hsa-miR-148a-3p 4-(1-(4-aminophenyl)-3,4-diphenyl-1h-1.lambda.~4~-thien-1-yl)phenylamine 392992 NSC694234 resistant
hsa-miR-148a-3p 4-(2-(((6-bromo-1,3-benzodioxol-5-yl)methyl)amino)ethyl)phenol 290548 NSC154572 sensitive
hsa-miR-148a-3p 4-(2-azidophenothiazin-10-yl)-N,N-dimethylbutan-1-amine;oxalic acid 385933 NSC677395 sensitive
hsa-miR-148a-3p 4-[3-(4-chlorophenyl)-5-(2,5-dimethoxyphenyl)pyrazol-1-yl]benzenesulfonamide 24204421 NSC731805 sensitive
hsa-miR-148a-3p 4-amino-2-(4-chloroanilino)-5-(4-chlorobenzoyl)-n-phenyl-1h-pyrrole-3-carbothioamide 5472776 NSC721531 resistant
hsa-miR-148a-3p 4-amino-3,5-dichloro-n-(3-(4-(2-methoxyphenyl)-1-piperazinyl)propyl)benzamide 379857 NSC664993 sensitive
hsa-miR-148a-3p 4-morpholinecarbodithioic acid, antimony complex NSC625498 sensitive
hsa-miR-148a-3p 5-[2-(4-methoxyphenyl)ethyl]-1,2,3-dimethoxy benzene NSC631356 sensitive
hsa-miR-148a-3p 5,6,11,12-tetramethyl-5,5a,6,11,11a,12-hexahydroquinoxalino[2,3-b]quinoxaline 365519 NSC633207 sensitive
hsa-miR-148a-3p 5,7-dihydroquinolino[3,2-d][1]benzazepine-6-thione 3005168 NSC679092 resistant
hsa-miR-148a-3p 6-(3-azidopropyl)-2,3-dimethoxy-5,11-dioxoindeno[1,2-c]isoquinoline-9-carbonitrile 17755511 NSC734749 resistant
hsa-miR-148a-3p 7-chloro-5-hydroxy-2-methoxy-2,4-dimethyl-1H-benzo[e][1]benzofuran-6,9-dione 359534 NSC620517 sensitive
hsa-miR-148a-3p 7-hydroxystaurosporine 5351376 NSC638646 resistant
hsa-miR-148a-3p 8-{[(3as)-2-methylhexahydro-1h-pyrrolo[1,2-c][1,3,2]diazaphosphol-1-yl]oxy}quinoline 402496 NSC716522 sensitive
hsa-miR-148a-3p 8-fluoro-11-methyl-1h-benzo[a]carbazole-1,4(11h)-dione 381772 NSC668844 sensitive
hsa-miR-148a-3p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 sensitive
hsa-miR-148a-3p 9-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386894 NSC679796 sensitive
hsa-miR-148a-3p 9-isobutyl-6-(((2-methyl-1-naphthyl)methyl)thio)-9h-purin-2-amine 244996 NSC56452 sensitive
hsa-miR-148a-3p 9h-purine, 2-amino-6-(2,4-dichlorobenzylthio)-9-isobutyl- 240896 NSC47786 sensitive
hsa-miR-148a-3p Ab01327238-02 6892730 NSC670969 sensitive
hsa-miR-148a-3p Acetamide, n-(2-mercaptoethyl)-, benzoate (6ci, 7ci) 281604 NSC134459 sensitive
hsa-miR-148a-3p Aj-131/36477019 384476 NSC674278 resistant
hsa-miR-148a-3p Aspiculamycin hcl 5458423 NSC200692 resistant
hsa-miR-148a-3p Auranofin 6333901 NSC321521 sensitive
hsa-miR-148a-3p Baccharin 5358645 NSC269757 sensitive
hsa-miR-148a-3p Benzene, 1,1'-[(1,3-butadiene-1,4-diyl)sulfonyl]bis 5468033 NSC662781 sensitive
hsa-miR-148a-3p Caracemide 54747 NSC253272 sensitive
hsa-miR-148a-3p Cbmicro_021216 812842 NSC707055 sensitive
hsa-miR-148a-3p Chimaphilin 101211 NSC400245 sensitive
hsa-miR-148a-3p Cis-amminedichloro(4-methoxyphenethylamine)platinum(ii) 498559 NSC631306 sensitive
hsa-miR-148a-3p Compactin 2854 NSC281245 resistant
hsa-miR-148a-3p Copper;(ne,3z)-n-[1-(6-methylpyridazin-3-yl)ethylidene]-3-azabicyclo[3.2.2]nonane-3-carbohydrazonothioate 9578854 NSC633271 sensitive
hsa-miR-148a-3p Cyanocycline a 100158 NSC349644 sensitive
hsa-miR-148a-3p Cycloalkannin 133408 NSC301457 sensitive
hsa-miR-148a-3p Cyclopentanone, 2,5-bis[(trimethylamino)methyl]-, iodide 360925 NSC623639 sensitive
hsa-miR-148a-3p Cytembena 23663958 NSC104801 sensitive
hsa-miR-148a-3p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-148a-3p Dasatinib 3062316 NSC732517 approved resistant
hsa-miR-148a-3p Dibutyl(bis((3-(2-fluorophenyl)acryloyl)oxy))stannane 16683204 NSC643860 sensitive
hsa-miR-148a-3p Dichloroallyl lawsone 277767 NSC126771 sensitive
hsa-miR-148a-3p Dichlorodipropyltin 93562 NSC92618 sensitive
hsa-miR-148a-3p Dichloroiron;(NE,1E)-N-(1-pyridin-2-ylethylidene)azepane-1-carbohydrazonothioate 9578789 NSC338304 sensitive
hsa-miR-148a-3p Diethyl 2-[[4-(3-phenylquinoxalin-2-yl)oxybenzoyl]amino]pentanedioate 390812 NSC688814 resistant
hsa-miR-148a-3p Diketocoriolin b 294475 NSC163027 sensitive
hsa-miR-148a-3p Enhydrin a 5359029 NSC294601 sensitive
hsa-miR-148a-3p Entinostat 4261 NSC706995 sensitive
hsa-miR-148a-3p Ethanone, 1-(2-pyrimidinyl)-, (2-benzoxazolyl)hydrazone 9572051 NSC693639 sensitive
hsa-miR-148a-3p Ethyl 3-[[5-[(e)-3-methoxy-3-oxoprop-1-enyl]-1h-imidazol-4-yl]diazenyl]benzoate 135436270 NSC716679 sensitive
hsa-miR-148a-3p Ethyl 3-benzyl-2-methyl-4,5-dioxobenzo[e]indole-1-carboxylate 406008 NSC723888 sensitive
hsa-miR-148a-3p Ethyl 7-(3,4-difluorophenyl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399952 NSC711104 resistant
hsa-miR-148a-3p Gold(1+), bis(trimethylphosphine)-, chloride 6333886 NSC313985 sensitive
hsa-miR-148a-3p Gtpl8141 44478401 NSC752203 resistant
hsa-miR-148a-3p Gw410563a 10425574 NSC756225 resistant
hsa-miR-148a-3p Gw559768x 9927432 NSC756251 resistant
hsa-miR-148a-3p Gw612286x 9822610 NSC756278 resistant
hsa-miR-148a-3p Gw643971x 135778715 NSC756297 resistant
hsa-miR-148a-3p Insariotoxin 6711181 NSC138780 sensitive
hsa-miR-148a-3p Isodonol 317640 NSC250682 sensitive
hsa-miR-148a-3p J7x181m78y 395460 NSC700023 resistant
hsa-miR-148a-3p Ldn-211904 46175113 NSC751644 resistant
hsa-miR-148a-3p Ls-123342 5469111 NSC683328 sensitive
hsa-miR-148a-3p Methyl 1-[[N-[(3-methoxycarbonyl-5-methylpyrazol-1-yl)methyl]anilino]methyl]-5-methylpyrazole-3-carboxylate 404564 NSC720860 sensitive
hsa-miR-148a-3p Methyl 2-[(2e)-2-[(2,6-dichlorophenyl)methylidene]hydrazinyl]-5-(3,4,5-trimethoxyphenyl)-1h-pyrrole-3-carboxylate 45029264 NSC745940 resistant
hsa-miR-148a-3p Methyl N-[(E)-1-pyridin-2-ylethylideneamino]carbamodithioate 5947235 NSC251190 sensitive
hsa-miR-148a-3p Methylene blue 6099 NSC617593 approved sensitive
hsa-miR-148a-3p N'-[1-(1-benzothiophen-2-yl)cyclohexyl]-n-methylpropane-1,3-diamine;(e)-but-2-enedioic acid 54611499 NSC708074 sensitive
hsa-miR-148a-3p N-(((2-methoxy-5-(trifluoromethyl)anilino)carbonyl)oxy)butanimidoyl chloride 9556202 NSC672059 sensitive
hsa-miR-148a-3p N-(2-((((4-methoxyphenyl)diazenyl)carbonyl)amino)-4-methylpentanoyl)phenylalanine 386436 NSC678404 sensitive
hsa-miR-148a-3p N-(2,5-dimethylphenyl)-2-(3-oxo-4H-1,4-benzothiazin-2-yl)acetamide 366111 NSC634398 resistant
hsa-miR-148a-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 sensitive
hsa-miR-148a-3p N-(4-methoxyphenyl)-3-[4-[(4-methylphenyl)diazenyl]-3,5-diphenylpyrazol-1-yl]-3-oxopropanamide 367846 NSC637921 resistant
hsa-miR-148a-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 sensitive
hsa-miR-148a-3p N-[(e)-(5-chloro-2-hydroxyphenyl)methylideneamino]-2-[[2-(trifluoromethyl)pyridin-4-yl]amino]benzamide 135968273 NSC747459 sensitive
hsa-miR-148a-3p N-[2-(1H-indol-3-yl)ethyl]-1,1-dioxo-2-(3-propan-2-yloxyphenyl)-4H-pyrido[4,3-e][1,2,4]thiadiazin-3-imine 135426715 NSC710895 sensitive
hsa-miR-148a-3p N-[4-[2-(2,4-dinitrophenyl)-3-(3-ethoxy-4-hydroxyphenyl)-3,4-dihydropyrazol-5-yl]phenyl]-2-methyl-5-nitrobenzenesulfonamide 402369 NSC716281 resistant
hsa-miR-148a-3p N-[4-[hydroxy(methyl)amino]-6-(propylamino)-1,3,5-triazin-2-yl]-n-methylhydroxylamine 45029482 NSC746928 sensitive
hsa-miR-148a-3p N,N'-bis(3-aminopropyl)-N,N'-dibenzylbutane-1,4-diamine;2,2,2-trifluoroacetic acid 389631 NSC685976 resistant
hsa-miR-148a-3p N,N-dimethyl-4-[(Z)-(6-methylindolo[1,2-b]indazol-6-ium-11-ylidene)methyl]aniline;trifluoromethanesulfonate 5471987 NSC715775 sensitive
hsa-miR-148a-3p Navan 941650 NSC108165 sensitive
hsa-miR-148a-3p Neuro_000327 16683203 NSC643859 sensitive
hsa-miR-148a-3p NSC600301 NSC600301 sensitive
hsa-miR-148a-3p NSC607281 NSC607281 sensitive
hsa-miR-148a-3p NSC621335 NSC621335 sensitive
hsa-miR-148a-3p NSC621339 NSC621339 sensitive
hsa-miR-148a-3p NSC625496 NSC625496 sensitive
hsa-miR-148a-3p NSC641052 NSC641052 sensitive
hsa-miR-148a-3p NSC716032 NSC716032 sensitive
hsa-miR-148a-3p Oridonin (thiol adduct of) 432952 NSC319730 sensitive
hsa-miR-148a-3p Oxin 1923 NSC2039 approved sensitive
hsa-miR-148a-3p Phenol, 4,4'-(5,5'-biisoxazole-3,3'-diyl)bis- 386651 NSC679108 sensitive
hsa-miR-148a-3p Physalin f 433531 NSC661115 sensitive
hsa-miR-148a-3p Pmp (van) 72508 NSC1906 sensitive
hsa-miR-148a-3p Pyrazino[1,2-a]benzimidazole, 1,3-diphenyl- 384474 NSC674276 resistant
hsa-miR-148a-3p Quinolin-8-yl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402508 NSC716535 sensitive
hsa-miR-148a-3p Sergeolide,desacetyl 125729 NSC364170 sensitive
hsa-miR-148a-3p Staurosporine 5459111 NSC618487 resistant
hsa-miR-148a-3p Stk386853 5291187 NSC65628 sensitive
hsa-miR-148a-3p Streptovaricin b 135443622 NSC156215 sensitive
hsa-miR-148a-3p Tetraplatin 13920603 NSC363812 sensitive
hsa-miR-148a-3p Trimethyl-[(1-oxo-3,4-dihydro-2H-naphthalen-2-yl)methyl]azanium;iodide 375929 NSC656280 sensitive
hsa-miR-148a-3p U-22265 265952 NSC102810 sensitive
hsa-miR-148a-3p Ver a 5351232 NSC126728 sensitive
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (PC-3)
hsa-miR-148a-3p Imatinib 5291 NSC743414 approved sensitive High Myelogenous Leukemia cell line (MYL)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Adenocarcinoma cell line (OE19)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Adenocarcinoma cell line (OE19)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant Low Squamous Cell Carcinoma cell line (SCC-11)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-148a-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-148a-3p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-148a-3p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (22Rv1, DU-145, PC-3,22Rv1RD, DU-145RD, PC-3RD)
hsa-miR-148a-3p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (PC-3)
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-148a-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (PANC-1, MIA-PaCa-2)
hsa-miR-148a-3p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive Low ER-Positive Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Renal Cell Cancer cell line (Caki)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (BGC823, SGC7901)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7C)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Adenocarcinoma cell line (MCF-7, MDA-MB-231)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Adenocarcinoma cell line (MCF-7, MDA-MB-231)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant Low Prostate Cancer cell line (VCaP-R)
hsa-miR-148a-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Colorectal Cancer cell line (SW480)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKVO3ip1, HeyA8)
hsa-miR-148a-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-CC, MCF-7-TT, MCF-7-21)
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly19, RIVA, SU DHL-8, U2932)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1, PANC-1)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-148a-3p Bromocriptine 31101 NSC169774 approved sensitive Low Prolactinoma tissue
hsa-miR-148a-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-148a-3p Cyclophosphamide 2907 NSC26271 approved resistant High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-148a-3p Vincristine 5978 approved sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-miR-148a-3p Rhamnetin 5281691 NSC19802 sensitive Low Hepatocellular Carcinoma cell line (MHCC97-H, HepG2)
hsa-miR-148a-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa, SiHa)
hsa-miR-148a-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (A375)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-148a-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-148a-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-148a-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-148a-3p Ribavirin+Pegylated IFNa-2b sensitive tissue (chronic hepatitis C)
hsa-miR-148a-3p Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-miR-148a-3p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-148a-3p Testosterone+Letrozole sensitive cell line (MCF-7)
hsa-miR-148a-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-148a-3p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-148a-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-148a-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-148a-3p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-148a-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-148a-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR1)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-148a-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-148a-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-148a-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-148a-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-148a-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)
hsa-miR-148a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission