miRTarBase - #MIRT026034


—
pre-miRNA Information
pre-miRNA hsa-mir-196a-1   
Genomic Coordinates chr17: 48632490 - 48632559
Synonyms MIRN196-1, MIRN196A1, MIR196A1
Description Homo sapiens miR-196a-1 stem-loop
Comment Lagos-Quintana et al. .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-196a-2   
Genomic Coordinates chr12: 53991738 - 53991847
Synonyms MIRN196-2, MIRN196A2, MIR196A2
Description Homo sapiens miR-196a-2 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-196a-5p
Sequence 25| UAGGUAGUUUCAUGUUGUUGGG |46
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 6 17 - 48632548 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30188818 11 COSMIC
COSN30130427 18 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1449318187 1 dbSNP
rs1167097656 4 dbSNP
rs767877229 4 dbSNP
rs750731061 10 dbSNP
rs756640169 12 dbSNP
rs931027203 13 dbSNP
rs185070757 13 dbSNP
rs569910454 16 dbSNP
rs190478598 17 dbSNP
rs755062780 17 dbSNP
rs751887895 18 dbSNP
rs1422312414 20 dbSNP
rs372978481 21 dbSNP
rs1289240119 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NHLRC3   
Synonyms -
Description NHL repeat containing 3
Transcript NM_001012754   
Other Transcripts NM_001017370   
Expression
Putative miRNA Targets on NHLRC3
3'UTR of NHLRC3
(miRNA target sites are highlighted)		 
>NHLRC3|NM_001012754|3'UTR
   1 TGTTTCTTTCCTGGGAATATTTCAAGTGGCAGTTCAGATTCTCAATTCACTAAGTGCTTAAAAATGATGTTCAAGCACAA
  81 GAATTTATTTTTCTAGTATAAAAGATCTAGTATCAGAAAGATTTGTTTTTGTATCATTAAGAATCTTATATTTTGTTGCC
 161 CTCTTGGGACTTAGTTTTATTTGTAAGTGCATAAGGATATTTTAATGAAAGGAAAGTAACTAAAAAATGGGGTTGGGAAG
 241 AGGGACTAAGGTGGTAACCTCATTATTTGCCCTGGTAGACTGATTCTCCCTGGGTAAAAAAAATGGGAATAAAAATGAGC
 321 TTGCATGATAATTTATTAAATTTCATGTGAAGAACTCCAGACCTCCAGATTGTGCAACTAACATAAAATGAGCTGCTTGA
 401 GAGATTGTAAATAAGATGAACTATTGATTAATTTGAGTACCCACAGAGTGCTGTGTCTTGACGACTTAAAAATGAAAAAG
 481 CAGGATTGCCTTTTGAGTAGCTTGCAGTCTAGTGGGGAGACAAGCAGGCAAACAGTCACAACACAGCAAAAGCGACCTTG
 561 GAGCATAGTGGGACTTTTGGAGTAGGAGTGCTGCATTTGACTGAGGGAATCATGGATACTTCGCAGGAGAAGTGAATTTG
 641 AGCTCAGACTTGAAAACTGAGGAGGAGCTTACCAAGGGACAAGGAGGAGAAAACAATAATTTCCAAGTAAAGAAGGTATA
 721 AAAAGTTAGAAGTGTACTGTAAACTTTGATAGGCTTTTAGGCCTTTTTTAAAGCCCAACTTGGCTTCTGTCCATTACCTA
 801 TAAGATATTTAATGTCAGTCAGCCTTTAAATGTAGGAATAAAATGGCTGGCATCTAAGCACTTTAGTAAAAGAGGTTTTT
 881 ACAAATAACTAAGGATTGTAGAGCTTCCTTCTCTTTTTTTTTCTTTTTCTTTCTTTTGTTTTACATGAACTCAACTTATT
 961 CCTAACATTTGTCTACCTCAAAGAAATTTCAAGATTATTTAGATAACATGGATATGTGCCAAATCCTTTGAGCTGTTAAG
1041 ATGATAATTTCCTGCTTTCCTCCTACATCTTCTCCTCCCACTCCCTCCTTTGGTGTGAATATTGGCTTCCCAATTAAGAC
1121 CTTTTTTTTTTTTTTTCCAGTTTGTTTTAGCTTATTATAGGTTTTGGAGGAACTTTGCCATTTTGTAATCTTTCAAATCA
1201 TTCTTCACCCTTCCTCACATCAGCTTCCTGCTTTTCCCAGTGTTTTACTGTAAATTGTGTAGCATATGACAAATCTTGAG
1281 CTGACTTTCCTCTTCACCTGTTATGGCTGGAGTATTTTCCAGACCTGAAGGGACTCACACTTGTTTTGATACTTGGATCA
1361 CATCTCCGTGAGGTTAGGAAGGTAAATCTACCAACAGGAAGCCCTGTACTCTGTATTCCAAGGCCATTGGTAAATGTGTT
1441 GGTGCCACTGATCGGACTGTATGACCTTAAACAAGTCACCTTAGTTTTCAGTGAAATGGGAATATCATTGTCTCCTCTTT
1521 CATGAATGCTGTGAGAATCAGATGTGCAACAGGTACAGACTTGCCCTTTGAAATCTATACCTCTGGATACATTAGAGGCA
1601 TTTTATTAACAAAGGCCCTTCTAAATGTGCTATTTATTTGACAATAACTATCAGATTTGCCTTAATTTTGTGTTTATAGC
1681 ATTTATCAAAACGTATCCTCATAGACTTTATGCAGATTAATATGGTCAATTGATTTGGATAAAAGAAAGTAATTTCAGGG
1761 TTTGTTTTTAAGCCAGGACAAGAAGTGCAAATGCCTCTTTGAAGCAATTTAGGCTAAACTGATTTTGAAATTTCAAAATG
1841 TTTTATTTTACTTTGTTTTATTAAGCCAGGACAAGAAGTGCAAATGCCTCTTTGAAGCAATTCAGGCTAGGTAAACCGAT
1921 TTTGCCATTTCAAAACGTTTTATTTTACTTTGTTTTATATCAGAGTCTTATAAAACCTGCTGCAAATATTTCTGAATGTC
2001 TTTGTAAAAGTGTTTGTTAGTGTACCTGTGATTATAGTACTTCACTTTTTTCCTTTGGATTAATTGGTTAAATGAATGAG
2081 AAATGTGTTATGTTTTTTACTAAAAAGTATAAATTAAAATTTTGGAAAGAAAAGGCAATATTATCTGGCTCCCCAATTAA
2161 AGTTTGATTTTATTGTCACAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggguuGUUGUACUUUGAUGGAu 5'
               :|||||  : |||||| 
Target 5' attccTAACATTTGTCTACCTc 3'
 958 - 979 129.00 -16.40
2 
miRNA  3' ggguuGUUGUACU--------UUGAUGGAu 5'
               |||| ||:         |:||||| 
Target 5' aagccCAACTTGGCTTCTGTCCATTACCTa 3'
 771 - 800 127.00 -16.90
3 
miRNA  3' gggUUGUUGUACUUUGAUGGAu 5'
             || |:||  ::|:|:||| 
Target 5' tgaAAAAGCA--GGATTGCCTt 3'
 473 - 492 123.00 -8.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30130376 7 COSMIC
COSN6624144 13 COSMIC
COSN30523976 38 COSMIC
COSN30487796 42 COSMIC
COSN26986489 59 COSMIC
COSN31495859 73 COSMIC
COSN31601738 76 COSMIC
COSN30120464 121 COSMIC
COSN31610252 199 COSMIC
COSN7401080 412 COSMIC
COSN32061253 682 COSMIC
COSN7401081 777 COSMIC
COSN1609085 780 COSMIC
COSN31960902 855 COSMIC
COSN24297057 923 COSMIC
COSN31595937 960 COSMIC
COSN31591508 967 COSMIC
COSN20210429 1046 COSMIC
COSN31518024 1053 COSMIC
COSN20110623 1137 COSMIC
COSN20110624 1137 COSMIC
COSN28709878 1428 COSMIC
COSN6228683 1446 COSMIC
COSN7401082 1478 COSMIC
COSN7401083 1507 COSMIC
COSN32141291 1542 COSMIC
COSN32057937 1559 COSMIC
COSN20092761 2067 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1318572248 12 dbSNP
rs772746364 12 dbSNP
rs9532318 13 dbSNP
rs201037532 14 dbSNP
rs540296742 18 dbSNP
rs576865180 22 dbSNP
rs751060001 24 dbSNP
rs1478541110 26 dbSNP
rs756996258 29 dbSNP
rs372614878 30 dbSNP
rs1193434684 36 dbSNP
rs745487060 42 dbSNP
rs906381031 43 dbSNP
rs377293280 44 dbSNP
rs779701256 46 dbSNP
rs749314984 48 dbSNP
rs763339228 51 dbSNP
rs2274383 52 dbSNP
rs1033603321 70 dbSNP
rs1311959554 72 dbSNP
rs1034197441 78 dbSNP
rs1220659744 81 dbSNP
rs895554417 82 dbSNP
rs1277667782 83 dbSNP
rs1380559333 84 dbSNP
rs532618312 108 dbSNP
rs957930846 110 dbSNP
rs1304505234 119 dbSNP
rs1466421405 123 dbSNP
rs1358332980 124 dbSNP
rs1173877169 137 dbSNP
rs1466884103 147 dbSNP
rs1411621399 149 dbSNP
rs1291465450 161 dbSNP
rs1426163607 175 dbSNP
rs990203768 181 dbSNP
rs1354882405 188 dbSNP
rs1022025420 189 dbSNP
rs1182945708 192 dbSNP
rs1014444815 203 dbSNP
rs1241659889 215 dbSNP
rs1200856954 216 dbSNP
rs545912527 221 dbSNP
rs1019947291 222 dbSNP
rs1257586866 222 dbSNP
rs1234045390 223 dbSNP
rs967483150 247 dbSNP
rs978459904 251 dbSNP
rs1381890843 264 dbSNP
rs1305995088 291 dbSNP
rs1448635419 296 dbSNP
rs1033641707 297 dbSNP
rs953650402 301 dbSNP
rs755608016 304 dbSNP
rs1204179830 305 dbSNP
rs1252287747 316 dbSNP
rs967515432 318 dbSNP
rs1460085272 319 dbSNP
rs1369661362 325 dbSNP
rs977925040 327 dbSNP
rs1209327226 342 dbSNP
rs1257479720 343 dbSNP
rs754352473 351 dbSNP
rs1423764775 366 dbSNP
rs1180900886 368 dbSNP
rs1188118347 376 dbSNP
rs1237878567 381 dbSNP
rs1194270255 383 dbSNP
rs1489536232 383 dbSNP
rs1266135619 384 dbSNP
rs9576710 389 dbSNP
rs565027174 393 dbSNP
rs1169437264 404 dbSNP
rs944788315 411 dbSNP
rs1377357107 412 dbSNP
rs972590895 421 dbSNP
rs1327815130 425 dbSNP
rs1389297973 430 dbSNP
rs919356259 445 dbSNP
rs1293635647 447 dbSNP
rs1423378833 451 dbSNP
rs752061788 454 dbSNP
rs75207304 458 dbSNP
rs1160955662 460 dbSNP
rs921552657 463 dbSNP
rs757815807 464 dbSNP
rs1310966220 469 dbSNP
rs931554886 479 dbSNP
rs1435164389 496 dbSNP
rs143290715 498 dbSNP
rs567493876 507 dbSNP
rs567080935 511 dbSNP
rs1489876606 522 dbSNP
rs1415410445 526 dbSNP
rs939677650 527 dbSNP
rs1046181471 536 dbSNP
rs888335105 537 dbSNP
rs183568802 554 dbSNP
rs73169477 555 dbSNP
rs1332465486 560 dbSNP
rs1344718263 566 dbSNP
rs1033508108 567 dbSNP
rs893744550 583 dbSNP
rs186760962 597 dbSNP
rs1020839290 608 dbSNP
rs757845518 620 dbSNP
rs967803478 624 dbSNP
rs1300646675 625 dbSNP
rs977355753 633 dbSNP
rs375335487 634 dbSNP
rs1384824721 641 dbSNP
rs1013998093 646 dbSNP
rs1467850998 651 dbSNP
rs1019667016 658 dbSNP
rs558232286 664 dbSNP
rs1378486053 665 dbSNP
rs1020421477 678 dbSNP
rs1198962777 679 dbSNP
rs569392016 682 dbSNP
rs965426401 694 dbSNP
rs1194413431 695 dbSNP
rs1000248347 705 dbSNP
rs1283386360 706 dbSNP
rs1203174684 707 dbSNP
rs1220131023 717 dbSNP
rs1346839959 719 dbSNP
rs975592353 722 dbSNP
rs921415935 723 dbSNP
rs931611700 727 dbSNP
rs1279580129 739 dbSNP
rs984796496 741 dbSNP
rs1032654328 748 dbSNP
rs370077667 749 dbSNP
rs939689796 762 dbSNP
rs1176039463 763 dbSNP
rs1468451008 780 dbSNP
rs538096581 782 dbSNP
rs1019060499 783 dbSNP
rs1171477868 790 dbSNP
rs1241500242 793 dbSNP
rs1190927230 794 dbSNP
rs966146534 797 dbSNP
rs1451097846 802 dbSNP
rs972259404 812 dbSNP
rs1256625667 814 dbSNP
rs1202758735 818 dbSNP
rs777424109 822 dbSNP
rs1218773911 823 dbSNP
rs746624975 824 dbSNP
rs151263266 825 dbSNP
rs770670916 832 dbSNP
rs1054992176 844 dbSNP
rs985183242 845 dbSNP
rs1341540426 848 dbSNP
rs1336520013 861 dbSNP
rs1450823779 862 dbSNP
rs926639352 865 dbSNP
rs1332276294 867 dbSNP
rs1336194122 868 dbSNP
rs1343484440 874 dbSNP
rs1165029908 876 dbSNP
rs937233980 885 dbSNP
rs1385719531 890 dbSNP
rs1430153445 897 dbSNP
rs893642496 901 dbSNP
rs1239695270 912 dbSNP
rs917172455 913 dbSNP
rs1041562868 914 dbSNP
rs1270299575 914 dbSNP
rs949887740 914 dbSNP
rs1314888285 920 dbSNP
rs902905990 920 dbSNP
rs1303138421 924 dbSNP
rs1349183393 926 dbSNP
rs1221458661 930 dbSNP
rs1282831742 934 dbSNP
rs1310312236 934 dbSNP
rs999969796 934 dbSNP
rs1054044514 939 dbSNP
rs1010717656 940 dbSNP
rs1042701732 946 dbSNP
rs902397027 955 dbSNP
rs539075550 957 dbSNP
rs35462854 961 dbSNP
rs1162847996 962 dbSNP
rs1248193822 965 dbSNP
rs1381915847 970 dbSNP
rs1007185315 973 dbSNP
rs540937479 977 dbSNP
rs1469335853 980 dbSNP
rs1230751395 982 dbSNP
rs554181202 986 dbSNP
rs1191468572 994 dbSNP
rs781429655 1000 dbSNP
rs1490365628 1012 dbSNP
rs879770100 1015 dbSNP
rs17059064 1030 dbSNP
rs1220861157 1034 dbSNP
rs1356349717 1036 dbSNP
rs1454585865 1037 dbSNP
rs546280615 1041 dbSNP
rs780261916 1042 dbSNP
rs1174216042 1045 dbSNP
rs966333744 1047 dbSNP
rs1371478648 1052 dbSNP
rs191471106 1056 dbSNP
rs1405785505 1063 dbSNP
rs1437364463 1064 dbSNP
rs1344930887 1066 dbSNP
rs1302526844 1068 dbSNP
rs754288303 1068 dbSNP
rs994049291 1070 dbSNP
rs1026507459 1072 dbSNP
rs1019570542 1074 dbSNP
rs984906915 1076 dbSNP
rs965457672 1084 dbSNP
rs996874873 1085 dbSNP
rs1267526047 1088 dbSNP
rs1196603851 1103 dbSNP
rs1325594772 1104 dbSNP
rs959320441 1110 dbSNP
rs1372156145 1120 dbSNP
rs11384181 1122 dbSNP
rs1491019531 1122 dbSNP
rs200635456 1122 dbSNP
rs572582129 1122 dbSNP
rs879037644 1122 dbSNP
rs370624700 1137 dbSNP
rs79133621 1137 dbSNP
rs1439103762 1138 dbSNP
rs1278293860 1140 dbSNP
rs913803224 1145 dbSNP
rs1429844908 1146 dbSNP
rs1222635666 1150 dbSNP
rs1177849653 1152 dbSNP
rs945271628 1155 dbSNP
rs1330708618 1158 dbSNP
rs1211410376 1159 dbSNP
rs1272196662 1160 dbSNP
rs1451962951 1162 dbSNP
rs781015786 1168 dbSNP
rs530731960 1174 dbSNP
rs952994483 1180 dbSNP
rs917141180 1195 dbSNP
rs950014522 1198 dbSNP
rs1263133865 1200 dbSNP
rs1186414402 1204 dbSNP
rs1182940728 1205 dbSNP
rs1041921392 1218 dbSNP
rs745847326 1220 dbSNP
rs984271180 1227 dbSNP
rs1239605637 1241 dbSNP
rs1204664654 1258 dbSNP
rs1459989807 1259 dbSNP
rs908820977 1260 dbSNP
rs935748893 1265 dbSNP
rs1220607113 1268 dbSNP
rs1395583565 1269 dbSNP
rs1308144222 1270 dbSNP
rs1296250995 1273 dbSNP
rs1407427176 1277 dbSNP
rs1359713918 1290 dbSNP
rs544101499 1291 dbSNP
rs1327269317 1295 dbSNP
rs1354419700 1297 dbSNP
rs961647662 1300 dbSNP
rs1054096481 1309 dbSNP
rs888874458 1310 dbSNP
rs1046230335 1312 dbSNP
rs927770148 1314 dbSNP
rs938784201 1320 dbSNP
rs1007152753 1326 dbSNP
rs1466769670 1330 dbSNP
rs1040035639 1331 dbSNP
rs1169075856 1334 dbSNP
rs1230993886 1336 dbSNP
rs1427294481 1339 dbSNP
rs902075356 1340 dbSNP
rs1184605160 1341 dbSNP
rs1444384433 1344 dbSNP
rs1292279593 1349 dbSNP
rs981795026 1351 dbSNP
rs561218744 1368 dbSNP
rs769763780 1369 dbSNP
rs1202475699 1384 dbSNP
rs1270663754 1391 dbSNP
rs1305709781 1396 dbSNP
rs952285043 1402 dbSNP
rs1054898997 1407 dbSNP
rs1437114195 1423 dbSNP
rs775499527 1427 dbSNP
rs117121350 1428 dbSNP
rs959455517 1433 dbSNP
rs1042218653 1454 dbSNP
rs546510737 1455 dbSNP
rs1297111651 1456 dbSNP
rs140349297 1462 dbSNP
rs367894148 1467 dbSNP
rs1369215918 1476 dbSNP
rs977407390 1477 dbSNP
rs901195694 1485 dbSNP
rs1419926520 1495 dbSNP
rs924528171 1498 dbSNP
rs1175617774 1529 dbSNP
rs1489505924 1536 dbSNP
rs1293917529 1548 dbSNP
rs996763149 1553 dbSNP
rs9576711 1559 dbSNP
rs1289364293 1565 dbSNP
rs771817054 1567 dbSNP
rs952818980 1567 dbSNP
rs568906408 1574 dbSNP
rs544202662 1579 dbSNP
rs1305832784 1587 dbSNP
rs531430744 1598 dbSNP
rs943146747 1606 dbSNP
rs538419190 1611 dbSNP
rs554831044 1615 dbSNP
rs929546026 1617 dbSNP
rs1364206601 1621 dbSNP
rs1047935864 1625 dbSNP
rs773014960 1628 dbSNP
rs773612583 1630 dbSNP
rs1157159060 1633 dbSNP
rs982372196 1640 dbSNP
rs1269723606 1646 dbSNP
rs1198737288 1651 dbSNP
rs760929312 1656 dbSNP
rs1490167833 1663 dbSNP
rs1266618296 1677 dbSNP
rs568661575 1679 dbSNP
rs1206732229 1680 dbSNP
rs928177112 1681 dbSNP
rs534449576 1682 dbSNP
rs959030694 1693 dbSNP
rs1484650489 1694 dbSNP
rs990468293 1696 dbSNP
rs60068247 1699 dbSNP
rs554516299 1711 dbSNP
rs895212630 1716 dbSNP
rs1256995390 1719 dbSNP
rs1390642714 1724 dbSNP
rs915011501 1730 dbSNP
rs766712108 1745 dbSNP
rs375313442 1761 dbSNP
rs1013704331 1766 dbSNP
rs1191279137 1775 dbSNP
rs1471096933 1775 dbSNP
rs1241805760 1776 dbSNP
rs1450477733 1780 dbSNP
rs1170884548 1783 dbSNP
rs1025385654 1787 dbSNP
rs558833473 1788 dbSNP
rs1375923432 1791 dbSNP
rs546269989 1792 dbSNP
rs1434665255 1797 dbSNP
rs1195199860 1805 dbSNP
rs556669291 1806 dbSNP
rs754227443 1807 dbSNP
rs1447413904 1812 dbSNP
rs183984647 1814 dbSNP
rs545084334 1816 dbSNP
rs1462378772 1825 dbSNP
rs1263312788 1842 dbSNP
rs1397316932 1845 dbSNP
rs944515185 1848 dbSNP
rs1325555846 1852 dbSNP
rs1031560338 1854 dbSNP
rs1040288574 1856 dbSNP
rs1228827986 1869 dbSNP
rs900392449 1871 dbSNP
rs932688105 1873 dbSNP
rs1345598830 1880 dbSNP
rs1233440635 1881 dbSNP
rs989924496 1890 dbSNP
rs1049748009 1901 dbSNP
rs1468334982 1902 dbSNP
rs1398697864 1905 dbSNP
rs943115468 1906 dbSNP
rs975896473 1909 dbSNP
rs1261221224 1914 dbSNP
rs866311585 1917 dbSNP
rs1465526244 1918 dbSNP
rs564871679 1919 dbSNP
rs370521733 1937 dbSNP
rs888551661 1938 dbSNP
rs1274546492 1943 dbSNP
rs1005619376 1945 dbSNP
rs1195807315 1955 dbSNP
rs1200170103 1964 dbSNP
rs1379937677 1965 dbSNP
rs1467125735 1968 dbSNP
rs1248709086 1972 dbSNP
rs1268924755 1972 dbSNP
rs1016064252 1973 dbSNP
rs1383946957 1978 dbSNP
rs1314686643 1979 dbSNP
rs560889139 1986 dbSNP
rs1156307051 1992 dbSNP
rs897344577 2001 dbSNP
rs928951642 2005 dbSNP
rs1047862161 2006 dbSNP
rs755344404 2011 dbSNP
rs1003672910 2014 dbSNP
rs1166609096 2016 dbSNP
rs1426370722 2017 dbSNP
rs1035280496 2023 dbSNP
rs942281702 2026 dbSNP
rs1055284605 2027 dbSNP
rs1234201591 2036 dbSNP
rs959604985 2049 dbSNP
rs1386066077 2053 dbSNP
rs990934137 2054 dbSNP
rs1332765998 2058 dbSNP
rs759753512 2059 dbSNP
rs1260242628 2060 dbSNP
rs1273153807 2064 dbSNP
rs1330041963 2072 dbSNP
rs1225337710 2083 dbSNP
rs1210788539 2084 dbSNP
rs1013766940 2085 dbSNP
rs1244153091 2092 dbSNP
rs1025027201 2099 dbSNP
rs1280344438 2100 dbSNP
rs1021943766 2101 dbSNP
rs1468307080 2107 dbSNP
rs765785367 2111 dbSNP
rs1366048594 2135 dbSNP
rs999510955 2136 dbSNP
rs968231795 2155 dbSNP
rs1409796055 2160 dbSNP
rs1158754417 2163 dbSNP
rs1210879311 2169 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer 0.609 1.1e-4 0.665 1.6e-5 32 Click to see details
GSE28260 Renal cortex and medulla -0.724 2.6e-3 -0.577 1.9e-2 13 Click to see details
GSE14794 Lymphoblastoid cells 0.291 2.7e-3 0.216 2.0e-2 90 Click to see details
GSE28544 Breast cancer -0.546 2.9e-3 -0.680 1.3e-4 24 Click to see details
GSE38226 Liver fibrosis -0.48 1.4e-2 -0.523 7.5e-3 21 Click to see details
GSE42095 Differentiated embryonic stem cells 0.435 1.9e-2 0.350 5.1e-2 23 Click to see details
GSE17306 Multiple myeloma 0.242 4.7e-2 0.322 1.2e-2 49 Click to see details
GSE26953 Aortic valvular endothelial cells -0.329 5.8e-2 -0.180 2.0e-1 24 Click to see details
GSE19783 ER- ER- breast cancer -0.141 1.1e-1 -0.195 4.3e-2 79 Click to see details
GSE19536 Breast cancer -0.108 1.4e-1 -0.170 4.5e-2 100 Click to see details
GSE21687 Ependynoma primary tumors -0.103 2.1e-1 0.068 3.0e-1 64 Click to see details
GSE21849 B cell lymphoma 0.116 2.7e-1 0.046 4.1e-1 29 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.121 2.8e-1 0.148 2.4e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.126 3.0e-1 -0.281 1.2e-1 20 Click to see details
GSE19350 CNS germ cell tumors -0.166 3.0e-1 -0.154 3.2e-1 12 Click to see details
GSE27834 Pluripotent stem cells 0.101 3.5e-1 0.003 5.0e-1 16 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.056 4.0e-1 -0.059 3.9e-1 25 Click to see details
GSE21032 Prostate cancer -0.028 4.0e-1 -0.080 2.4e-1 83 Click to see details
GSE19783 ER+ ER+ breast cancer 0.032 4.5e-1 -0.141 2.8e-1 20 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.05 4.5e-1 -0.133 3.7e-1 9 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC 0.531 0.01 0.472 0.02 19 Click to see details
COAD 0.609 0.05 0.429 0.14 8 Click to see details
KICH -0.279 0.09 -0.228 0.14 25 Click to see details
BRCA -0.139 0.1 -0.071 0.26 84 Click to see details
LIHC -0.212 0.1 -0.087 0.3 37 Click to see details
ESCA -0.331 0.16 -0.300 0.19 11 Click to see details
STAD 0.17 0.18 0.160 0.19 31 Click to see details
CESC -0.789 0.21 -1.000 0.5 3 Click to see details
THCA 0.12 0.21 0.096 0.26 47 Click to see details
BLCA 0.194 0.22 0.135 0.3 18 Click to see details
PCPG -0.767 0.22 -1.000 0.5 3 Click to see details
PRAD 0.102 0.24 0.065 0.33 50 Click to see details
LUAD -0.228 0.25 -0.045 0.45 11 Click to see details
PAAD 0.422 0.29 -0.200 0.4 4 Click to see details
LUSC 0.09 0.3 0.087 0.3 38 Click to see details
KIRC 0.063 0.3 -0.037 0.38 68 Click to see details
HNSC 0.081 0.31 0.090 0.29 42 Click to see details
CHOL 0.128 0.38 0.214 0.31 8 Click to see details
KIRP 0.012 0.47 -0.083 0.33 32 Click to see details
KIRP 0.012 0.47 -0.083 0.33 32 Click to see details
KIRP 0.012 0.47 -0.083 0.33 32 Click to see details
301 hsa-miR-196a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000218 BMP4 bone morphogenetic protein 4 1 1
MIRT000219 SPRR2C small proline rich protein 2C (pseudogene) 3 2
MIRT000220 S100A9 S100 calcium binding protein A9 3 2
MIRT000221 KRT5 keratin 5 3 2
MIRT000709 ANXA1 annexin A1 4 2
MIRT002266 HOXB8 homeobox B8 5 7
MIRT002940 HOXA7 homeobox A7 4 5
MIRT002941 HOXD8 homeobox D8 3 3
MIRT002942 HOXC8 homeobox C8 6 15
MIRT004244 HOXB7 homeobox B7 4 1
MIRT004718 BACH1 BTB domain and CNC homolog 1 6 3
MIRT004719 HMOX1 heme oxygenase 1 4 1
MIRT005065 CDKN1B cyclin dependent kinase inhibitor 1B 6 7
MIRT006802 HMGA1 high mobility group AT-hook 1 5 5
MIRT006803 HMGA2 high mobility group AT-hook 2 5 7
MIRT006906 HOXA5 homeobox A5 5 3
MIRT026026 IKBKB inhibitor of nuclear factor kappa B kinase subunit beta 1 1
MIRT026027 PDCD4 programmed cell death 4 1 1
MIRT026028 SRRT serrate, RNA effector molecule 2 9
MIRT026029 DIEXF digestive organ expansion factor homolog (zebrafish) 1 1
MIRT026030 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT026031 NR4A1 nuclear receptor subfamily 4 group A member 1 1 1
MIRT026032 ABT1 activator of basal transcription 1 1 1
MIRT026033 SPATA2 spermatogenesis associated 2 1 1
MIRT026034 NHLRC3 NHL repeat containing 3 1 1
MIRT026035 RPUSD2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT026036 CEP120 centrosomal protein 120 1 1
MIRT026037 PHC3 polyhomeotic homolog 3 1 1
MIRT026038 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT026039 C9orf41 carnosine N-methyltransferase 1 1 1
MIRT026040 PNP purine nucleoside phosphorylase 1 1
MIRT026041 COPS3 COP9 signalosome subunit 3 1 1
MIRT026042 NUP50 nucleoporin 50 1 1
MIRT026043 ZNF763 zinc finger protein 763 1 1
MIRT026044 FOXJ3 forkhead box J3 1 1
MIRT026045 BIN3 bridging integrator 3 1 1
MIRT026046 C12orf4 chromosome 12 open reading frame 4 1 1
MIRT026047 RAD9A RAD9 checkpoint clamp component A 1 1
MIRT026048 PCGF3 polycomb group ring finger 3 1 1
MIRT026049 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT026050 SLC10A7 solute carrier family 10 member 7 1 1
MIRT026051 LBR lamin B receptor 1 1
MIRT026052 BCL11A B-cell CLL/lymphoma 11A 1 1
MIRT026053 GLMN glomulin, FKBP associated protein 1 1
MIRT026054 STK40 serine/threonine kinase 40 1 1
MIRT026055 TMEM135 transmembrane protein 135 1 1
MIRT026056 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 3
MIRT026057 POLR2D RNA polymerase II subunit D 2 5
MIRT026058 LGR4 leucine rich repeat containing G protein-coupled receptor 4 1 1
MIRT026059 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 4
MIRT026060 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT026061 RFX5 regulatory factor X5 1 1
MIRT026062 SYT9 synaptotagmin 9 1 1
MIRT026063 PEX13 peroxisomal biogenesis factor 13 1 1
MIRT026064 IGF1R insulin like growth factor 1 receptor 1 1
MIRT026065 SMCR7L mitochondrial elongation factor 1 1 4
MIRT026066 SLC30A6 solute carrier family 30 member 6 2 3
MIRT026067 RAB31 RAB31, member RAS oncogene family 1 1
MIRT026068 KPNA5 karyopherin subunit alpha 5 1 1
MIRT026069 SLC20A1 solute carrier family 20 member 1 1 1
MIRT026070 TIMM23 translocase of inner mitochondrial membrane 23 1 1
MIRT026071 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT026072 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 1 1
MIRT026073 CCNT2 cyclin T2 1 1
MIRT026074 CCND2 cyclin D2 1 1
MIRT026075 USP24 ubiquitin specific peptidase 24 1 1
MIRT026076 TRPC3 transient receptor potential cation channel subfamily C member 3 2 4
MIRT026077 SMC3 structural maintenance of chromosomes 3 1 1
MIRT026078 TMEM2 transmembrane protein 2 1 1
MIRT026079 RDH10 retinol dehydrogenase 10 1 1
MIRT026080 C11orf57 chromosome 11 open reading frame 57 2 5
MIRT026081 FAM127A retrotransposon Gag like 8C 2 4
MIRT026082 PRUNE2 prune homolog 2 2 3
MIRT026083 SPRYD4 SPRY domain containing 4 1 1
MIRT026084 TMEM161B transmembrane protein 161B 1 1
MIRT026085 CPEB3 cytoplasmic polyadenylation element binding protein 3 1 1
MIRT026086 FAM104A family with sequence similarity 104 member A 2 2
MIRT026087 RAB7L1 RAB29, member RAS oncogene family 1 1
MIRT026088 ITGAV integrin subunit alpha V 1 1
MIRT026089 CPD carboxypeptidase D 1 1
MIRT026090 ZNF354B zinc finger protein 354B 1 1
MIRT026091 TMEM194A nuclear envelope integral membrane protein 1 1 1
MIRT026092 EPHA7 EPH receptor A7 1 1
MIRT026093 KIAA1804 mitogen-activated protein kinase kinase kinase 21 1 1
MIRT026094 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT026095 TSPAN12 tetraspanin 12 1 1
MIRT026096 LIN28B lin-28 homolog B 1 1
MIRT026097 ARHGAP28 Rho GTPase activating protein 28 1 1
MIRT026098 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 1 1
MIRT026099 CCDC47 coiled-coil domain containing 47 1 1
MIRT026100 HAND1 heart and neural crest derivatives expressed 1 4 2
MIRT026101 LLGL1 LLGL1, scribble cell polarity complex component 1 1
MIRT048150 PGAM1 phosphoglycerate mutase 1 1 1
MIRT048151 PSMC3 proteasome 26S subunit, ATPase 3 1 1
MIRT048152 TMX2 thioredoxin related transmembrane protein 2 1 1
MIRT048153 KLHL7 kelch like family member 7 1 1
MIRT048154 RFC2 replication factor C subunit 2 1 1
MIRT048155 GLUL glutamate-ammonia ligase 1 1
MIRT048156 NRXN1 neurexin 1 1 1
MIRT048157 GSTK1 glutathione S-transferase kappa 1 1 1
MIRT048158 HIST2H4B histone cluster 2 H4 family member b 1 1
MIRT048159 SPEN spen family transcriptional repressor 1 1
MIRT048160 TAF15 TATA-box binding protein associated factor 15 1 1
MIRT048161 SAP18 Sin3A associated protein 18 1 1
MIRT048162 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 1 1
MIRT048163 MSL3 MSL complex subunit 3 1 1
MIRT048164 TSKU tsukushi, small leucine rich proteoglycan 1 1
MIRT048165 KMT2C lysine methyltransferase 2C 1 1
MIRT048166 LYRM2 LYR motif containing 2 1 1
MIRT048167 UBE2Z ubiquitin conjugating enzyme E2 Z 1 1
MIRT048168 C19orf55 proline and serine rich 3 1 1
MIRT048169 LRP2 LDL receptor related protein 2 1 1
MIRT048170 ND4L NADH dehydrogenase, subunit 4L (complex I) 1 1
MIRT048171 NKX6-1 NK6 homeobox 1 1 1
MIRT048172 BRMS1L breast cancer metastasis-suppressor 1 like 1 1
MIRT048173 RPS2 ribosomal protein S2 1 1
MIRT048174 RBMX RNA binding motif protein, X-linked 1 1
MIRT048175 ZFP64 ZFP64 zinc finger protein 1 1
MIRT048176 REEP2 receptor accessory protein 2 1 1
MIRT048177 MED13 mediator complex subunit 13 1 1
MIRT048178 MYCBP2 MYC binding protein 2, E3 ubiquitin protein ligase 1 1
MIRT048179 TRAPPC9 trafficking protein particle complex 9 1 1
MIRT048180 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 1 1
MIRT048181 VDAC3 voltage dependent anion channel 3 1 1
MIRT048182 ZNF529 zinc finger protein 529 1 1
MIRT048183 EWSR1 EWS RNA binding protein 1 1 1
MIRT048184 ATP6V1B2 ATPase H+ transporting V1 subunit B2 1 1
MIRT048185 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 1 1
MIRT048186 APP amyloid beta precursor protein 1 1
MIRT048187 PROSER1 proline and serine rich 1 1 1
MIRT048188 HIST1H2BB histone cluster 1 H2B family member b 1 1
MIRT048189 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 1 1
MIRT048190 TUBA1B tubulin alpha 1b 1 1
MIRT048191 USP19 ubiquitin specific peptidase 19 1 1
MIRT048192 COX3 cytochrome c oxidase III 1 1
MIRT048193 PSMD8 proteasome 26S subunit, non-ATPase 8 1 1
MIRT048194 TRA2B transformer 2 beta homolog 1 1
MIRT048195 MRPL35 mitochondrial ribosomal protein L35 1 1
MIRT048196 KCTD1 potassium channel tetramerization domain containing 1 1 1
MIRT048197 UBE2C ubiquitin conjugating enzyme E2 C 1 1
MIRT048198 ZNF581 zinc finger protein 581 1 1
MIRT048199 CNOT11 CCR4-NOT transcription complex subunit 11 1 1
MIRT048200 POTEG POTE ankyrin domain family member G 1 1
MIRT048201 MTRF1L mitochondrial translational release factor 1 like 1 1
MIRT048202 SRP9 signal recognition particle 9 2 5
MIRT048203 BCORL1 BCL6 corepressor like 1 1 1
MIRT048204 NRBP1 nuclear receptor binding protein 1 1 1
MIRT048205 LRRC41 leucine rich repeat containing 41 1 1
MIRT048206 ATP6 ATP synthase F0 subunit 6 1 1
MIRT048207 FKTN fukutin 1 1
MIRT048208 RANBP9 RAN binding protein 9 1 1
MIRT048209 SYVN1 synoviolin 1 1 1
MIRT048210 NR2F6 nuclear receptor subfamily 2 group F member 6 1 1
MIRT048211 ATG16L1 autophagy related 16 like 1 1 1
MIRT048212 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 1 1
MIRT048213 ECHDC1 ethylmalonyl-CoA decarboxylase 1 1 1
MIRT048214 HAUS6 HAUS augmin like complex subunit 6 1 1
MIRT048215 CKAP2L cytoskeleton associated protein 2 like 1 1
MIRT048216 IFNGR1 interferon gamma receptor 1 1 1
MIRT048217 ANXA7 annexin A7 1 1
MIRT048218 ENAH ENAH, actin regulator 1 1
MIRT048219 FOXO1 forkhead box O1 9 3
MIRT048220 NDFIP1 Nedd4 family interacting protein 1 1 1
MIRT048221 LSM14A LSM14A, mRNA processing body assembly factor 1 1
MIRT048222 ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 1 1
MIRT048223 SLC25A17 solute carrier family 25 member 17 1 1
MIRT048224 ZNF398 zinc finger protein 398 1 1
MIRT048225 RASSF7 Ras association domain family member 7 1 1
MIRT048226 SBF1 SET binding factor 1 1 1
MIRT048227 TP53RK TP53 regulating kinase 1 1
MIRT048228 MED12 mediator complex subunit 12 1 1
MIRT048229 FLNA filamin A 1 1
MIRT048230 CCNE2 cyclin E2 1 1
MIRT048231 CANX calnexin 1 1
MIRT048232 PRPF8 pre-mRNA processing factor 8 1 1
MIRT048233 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT048234 KIF18B kinesin family member 18B 1 1
MIRT048235 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT048236 SH3GL3 SH3 domain containing GRB2 like 3, endophilin A3 1 1
MIRT048237 VCP valosin containing protein 1 1
MIRT048238 ETV3 ETS variant 3 1 1
MIRT048239 BCS1L BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone 1 1
MIRT048240 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT048241 ZCCHC11 zinc finger CCHC-type containing 11 1 1
MIRT048242 RALGPS2 Ral GEF with PH domain and SH3 binding motif 2 1 1
MIRT048243 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT048244 ACTB actin beta 1 1
MIRT048245 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT048246 EIF2B4 eukaryotic translation initiation factor 2B subunit delta 1 1
MIRT048247 GMFB glia maturation factor beta 1 1
MIRT048248 PALLD palladin, cytoskeletal associated protein 1 1
MIRT048249 CASP3 caspase 3 1 1
MIRT048250 VCL vinculin 1 1
MIRT048251 IPO5 importin 5 1 1
MIRT048252 PATL1 PAT1 homolog 1, processing body mRNA decay factor 1 1
MIRT048253 NAP1L4 nucleosome assembly protein 1 like 4 1 1
MIRT048254 RUFY2 RUN and FYVE domain containing 2 2 1
MIRT048255 TUBB tubulin beta class I 1 1
MIRT048256 CCND1 cyclin D1 1 1
MIRT048257 GID8 GID complex subunit 8 homolog 1 1
MIRT048258 VDAC2 voltage dependent anion channel 2 1 1
MIRT048259 SLC6A8 solute carrier family 6 member 8 1 1
MIRT048260 FXR2 FMR1 autosomal homolog 2 1 1
MIRT048261 SCN11A sodium voltage-gated channel alpha subunit 11 1 1
MIRT048262 AHSA1 activator of HSP90 ATPase activity 1 1 1
MIRT048263 ATG9A autophagy related 9A 1 1
MIRT048264 NOTCH2 notch 2 1 1
MIRT048265 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 1 1
MIRT048266 ND4 NADH dehydrogenase, subunit 4 (complex I) 2 1
MIRT048267 OAT ornithine aminotransferase 1 1
MIRT048268 TRAP1 TNF receptor associated protein 1 1 1
MIRT048269 SKI SKI proto-oncogene 1 1
MIRT048270 GLTP glycolipid transfer protein 1 1
MIRT048271 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT048272 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 1 1
MIRT048273 GRIK4 glutamate ionotropic receptor kainate type subunit 4 1 1
MIRT048274 PDE6D phosphodiesterase 6D 1 1
MIRT048275 MPP2 membrane palmitoylated protein 2 1 1
MIRT048276 SAR1B secretion associated Ras related GTPase 1B 2 3
MIRT048277 MAP4 microtubule associated protein 4 1 1
MIRT048278 RAB21 RAB21, member RAS oncogene family 1 1
MIRT048279 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 1 1
MIRT048280 OGFRL1 opioid growth factor receptor like 1 1 1
MIRT048281 GOT2 glutamic-oxaloacetic transaminase 2 1 1
MIRT048282 NRDE2 NRDE-2, necessary for RNA interference, domain containing 1 1
MIRT048283 SBNO1 strawberry notch homolog 1 1 1
MIRT053067 NTN4 netrin 4 2 1
MIRT054025 RDX radixin 5 5
MIRT056750 ARID5B AT-rich interaction domain 5B 2 2
MIRT057645 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT076226 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT083303 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT095769 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT187720 SUOX sulfite oxidase 2 2
MIRT191923 CALM1 calmodulin 1 2 2
MIRT205504 SP100 SP100 nuclear antigen 2 2
MIRT209857 ACVR2B activin A receptor type 2B 2 2
MIRT229841 YIPF6 Yip1 domain family member 6 2 2
MIRT230833 TBRG1 transforming growth factor beta regulator 1 2 2
MIRT235376 CALM3 calmodulin 3 2 2
MIRT251626 KCNJ2 potassium voltage-gated channel subfamily J member 2 2 2
MIRT252333 SALL3 spalt like transcription factor 3 2 2
MIRT255317 CDV3 CDV3 homolog 2 2
MIRT324734 ACER2 alkaline ceramidase 2 4 3
MIRT386075 ZNF609 zinc finger protein 609 2 2
MIRT402060 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT437422 NFKBIA NFKB inhibitor alpha 4 2
MIRT437980 TYMS thymidylate synthetase 1 1
MIRT437981 NRP2 neuropilin 2 1 1
MIRT437982 LSP1 lymphocyte-specific protein 1 1 1
MIRT439104 MYC MYC proto-oncogene, bHLH transcription factor 0 1
MIRT447143 KIF27 kinesin family member 27 2 2
MIRT447559 C14orf37 chromosome 14 open reading frame 37 2 2
MIRT449961 FMNL3 formin like 3 2 2
MIRT465087 TSPAN3 tetraspanin 3 2 2
MIRT470426 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT472726 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473801 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT474507 KLHDC8B kelch domain containing 8B 2 2
MIRT474917 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT486549 DCTN4 dynactin subunit 4 2 2
MIRT492430 RGL2 ral guanine nucleotide dissociation stimulator like 2 2 2
MIRT493925 FAM127B retrotransposon Gag like 8A 2 4
MIRT500972 SPTSSA serine palmitoyltransferase small subunit A 2 2
MIRT501431 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT502410 GATA6 GATA binding protein 6 2 8
MIRT506368 NUP155 nucleoporin 155 2 6
MIRT507497 E2F7 E2F transcription factor 7 2 6
MIRT520041 YOD1 YOD1 deubiquitinase 2 6
MIRT522366 NAP1L1 nucleosome assembly protein 1 like 1 2 4
MIRT531281 SLC7A7 solute carrier family 7 member 7 2 2
MIRT543674 FAM135A family with sequence similarity 135 member A 2 2
MIRT545199 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT546336 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT546452 SLC9A7 solute carrier family 9 member A7 2 2
MIRT546787 RCC2 regulator of chromosome condensation 2 2 4
MIRT547253 NXPE3 neurexophilin and PC-esterase domain family member 3 2 2
MIRT547454 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT547581 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT547902 HOXA9 homeobox A9 2 4
MIRT549503 ABHD2 abhydrolase domain containing 2 2 2
MIRT549583 ZNF850 zinc finger protein 850 2 2
MIRT551888 MMS22L MMS22 like, DNA repair protein 2 2
MIRT552125 MED10 mediator complex subunit 10 2 2
MIRT554188 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT555552 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT556285 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT556980 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT559183 BRAP BRCA1 associated protein 2 2
MIRT561215 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT562352 EXOC8 exocyst complex component 8 2 2
MIRT565603 SLC35G1 solute carrier family 35 member G1 2 2
MIRT575599 Gnl1 guanine nucleotide binding protein-like 1 2 3
MIRT610363 GNL1 G protein nucleolar 1 (putative) 2 3
MIRT617860 FMO4 flavin containing monooxygenase 4 2 2
MIRT698193 TMEM66 store-operated calcium entry associated regulatory factor 1 1
MIRT704411 CTPS1 CTP synthase 1 2 2
MIRT732864 NARS asparaginyl-tRNA synthetase 3 0
MIRT732867 AJAP1 adherens junctions associated protein 1 3 0
MIRT732868 COL24A1 collagen type XXIV alpha 1 chain 3 0
MIRT735738 RASSF4 Ras association domain family member 4 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-196a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-196a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-196a Polylysine NULL 162282 Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-196a Trypaflavine NULL NULL Quantitative real-time PCR 293T(FLAG AGO2) cells 20529860 2010 down-regulated
miR-196a Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-196a 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-196a Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-196a Narangin NULL 442428 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-196a Proanthocyanin NULL 108065 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-196a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-196a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-196a 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
miR-196a (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miR-196a Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-196a-5p (e)-2-methyl-1-[2-(2-methyl-1h-indol-3-yl)indolin-1-yl]but-2-en-1-one 5388204 NSC633484 resistant
hsa-miR-196a-5p (E)-3-[2-(4-methoxyphenyl)imidazo[1,2-a]pyridin-3-yl]-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613570 NSC750335 sensitive
hsa-miR-196a-5p 1-[4-(5,6-diphenyl-1,2,4-triazin-3-yl)piperazin-1-yl]-2-[4-(4-methoxyphenyl)piperazin-1-yl]ethanone 54612996 NSC749161 sensitive
hsa-miR-196a-5p 2-[(e)-[6-(4-chloro-3-nitrophenyl)-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl]methylideneamino]guanidine;hydrochloride 16099315 NSC728901 resistant
hsa-miR-196a-5p 2-amino-6-(benzylamino)-4-(2-chlorophenyl)pyridine-3,5-dicarbonitrile 24205132 NSC734396 resistant
hsa-miR-196a-5p 7-[(3,4-dimethoxyphenyl)methyl]-6-phenyl-4,5-dihydropyrrolo[3,4-g][1,2]benzoxazole 60148271 NSC754077 sensitive
hsa-miR-196a-5p Bisarylpurine 45028308 NSC742146 resistant
hsa-miR-196a-5p Camptothecin derivative 97226 NSC107124 sensitive
hsa-miR-196a-5p Dimethylarsinothious acid, 2,4-pyrimidinediyl ester 294741 NSC163664 resistant
hsa-miR-196a-5p Ethyl 5-(2,4-dichlorobenzoyl)oxy-4-oxo-1,3-diphenyl-2-thioxo-thieno[2,3-d]pyrimidine-6-carboxylate 383097 NSC671141 resistant
hsa-miR-196a-5p Gw620972x 766949 NSC756282 sensitive
hsa-miR-196a-5p Methyl 11h-pyrido[2,3-a]carbazole-5-carboxylate 13776879 NSC740203 sensitive
hsa-miR-196a-5p Methyl 6-[2-(diethylamino)ethoxy]-7-[(E)-3-(4-methoxyphenyl)prop-2-enoyl]-3-methyl-1-benzofuran-2-carboxylate;hydrochloride 24204523 NSC732112 resistant
hsa-miR-196a-5p N'-[2-(1,3-benzoxazol-2-ylamino)-6-methylpyrimidin-4-yl]-2-hydroxybenzohydrazide 24205702 NSC736401 resistant
hsa-miR-196a-5p N-(1,3-benzothiazol-2-yl)-2-[4-[(Z)-(3-oxo-1-benzofuran-2-ylidene)methyl]phenoxy]acetamide 45028625 NSC743506 resistant
hsa-miR-196a-5p N,n'-bis[(z)-(2-hydroxyphenyl)methylideneamino]decanediamide 135408549 NSC49488 resistant
hsa-miR-196a-5p NSC617562 NSC617562 resistant
hsa-miR-196a-5p NSC756998 NSC756998 sensitive
hsa-miR-196a-5p Tellurium, trichloro[1,2-hexanedioato(2-)-o,o']-, ammonium 498945 NSC641009 resistant
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3, 2008, OVCAR10, OVCAR3, HeLa, MCF7, MDA-MB-468)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, Hep-394, Hep-SWX, Huh-7)
hsa-miR-196a-5p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-196a-5p 10-Hydroxycamptothecin 97226 NSC107124 sensitive High Gastric Cancer cell line (BGC823, SGC-7901, MGC-803, HGC-27, NCI-N87, AGS)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-196a-5p Fulvestrant 17756771 NSC719276 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-196a-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-196a-5p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue and cell line (MCF-7)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (TAMR1, TAMR4, TAMR8)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-196a-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-196a-5p Cytoxan + Doxorubicin + Fluorouracil resistant High Breast Cancer tissue
hsa-miR-196a-5p Cytoxan + Epirubicin + Fluorouracil resistant High Breast Cancer tissue
hsa-miR-196a-5p Cytoxan + Pirarubicin + Fluorouracil resistant High Breast Cancer tissue
hsa-miR-196a-5p Doxorubicin + Taxol resistant High Breast Cancer tissue
hsa-miR-196a-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-196a-5p Gefitinib 123631 NSC715055 approved resistant High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-196a-5p Yuanhuadine 6440572 resistant High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145R)
hsa-miR-196a-5p Paclitaxel + Cisplatin sensitive Low Esophageal Squamous Cell Carcinoma tissue
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-196a-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (2uM)
hsa-miR-196a-5p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (1uM)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-196a-5p Trastuzumab resistant High Breast Cancer cell line (MDA‐MB‐231, SKBR3, HEK‐293T)
hsa-miR-196a-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant High Epithelial Ovarian Cancer cell line (SKOV3)
hsa-miR-196a-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-196a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-196a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-196a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-196a-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-196a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-196a-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-196a-5p Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-196a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR8)
hsa-miR-196a-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR1)
hsa-miR-196a-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-196a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-196a-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-196a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-196a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-196a-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-196a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)

Error report submission