miRTarBase - #MIRT027244


—
pre-miRNA Information
pre-miRNA hsa-mir-101-1   
Genomic Coordinates chr1: 65058434 - 65058508
Description Homo sapiens miR-101-1 stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-101-2   
Genomic Coordinates chr9: 4850297 - 4850375
Description Homo sapiens miR-101-2 stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-101-3p
Sequence 47| UACAGUACUGUGAUAACUGAA |67
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 1 - 65058459 29233923 MiREDiBase
A-to-I 20 1 - 65058443 29233923 MiREDiBase
A-to-I 13 9 + 4850359 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1465115600 3 dbSNP
rs1430733904 4 dbSNP
rs368898585 4 dbSNP
rs778893471 12 dbSNP
rs1359996956 19 dbSNP
rs1243236452 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B9KM6E miR-101-3p Predictive Biomarker (PRD) Clinical/Experimental Data Expression Higher Blood Quantitative real-time PCR
Gene Information
Gene Symbol TGFBR3   
Synonyms BGCAN, betaglycan
Description transforming growth factor beta receptor 3
Transcript NM_003243   
Expression
Putative miRNA Targets on TGFBR3
3'UTR of TGFBR3
(miRNA target sites are highlighted)		 
>TGFBR3|NM_003243|3'UTR
   1 CCCAACCCAGCCCAACCCGGCCCAACCCAGCCCAGCCCAGCTCAGCTCAGCTACTGCCAAGGGCAGGACCAATGGCTGAG
  81 CCTCGTGTCCAGACTCAGAGGGCTGGATTTTGGTTCCCTTGTAAAGACAGAGTGAATTTCAGTATAAAGATCACCCGTTG
 161 TATTCACCCCACACCCAGGGCTAGTATAAACATGACCCTGGGCTTCTGTACCACACTAGAATTCATGTGAGAAAGCTAAA
 241 ATGGTGGTCTTCTCCACCAGCCCCTCACAGGCTTGGGGGTTTTCAATGTGAAACACATGCCAGTTTTTAAAATGCTGCTT
 321 TGTCCAGGTGAGAACATCCATAATTTGGGGCCCTGAGTTTTACCCAGACTCAAGGAGTTGGTAAAGGGTTAATAGCCAGA
 401 TAGTAGAACCAGTGAGGAGATGCGGCCAAAGATTCTTTATATCTGAACCAAGATGTAAAACAAGAAATGCTTTGAGGCTT
 481 TCTAAGCGATCCTCCTGTCTAATTTGCACCTTTGTCTGGATGCACACTTCTGACCTTGCTGCCACAACCTGTGGGGTCTG
 561 ATGTGTCCCTTGATGGGTGCTGCCCTCAGGGACTGCACCCTGACAAGTGTTAAGGCAACATTCCTTTCTTGTGCCCTGGG
 641 CCAAAACCAATGCTGATGACCTTATCAGCTTCCTGTTTCTTCCCATACTTGCATACACCACTGCAAAATGTCTTAATGCA
 721 AATTTTGTATTTCTTACAGGCCTACAGAAATTGAAAATGACCAAAATCAGGAACCACAGATTTGTGCCCATTCCTAATAT
 801 TTTGTTCTGCAAATTAATGTATAATTTGAGGTGAAATTCAGTTATAAAGTCAAGGACGAATTTGCACAGTGATATATTTC
 881 TATGTGTATGCAAGTACAAGTATATAATATGTCACCTGGCACATTCATTTTCTCAGTTGAAGAAGAGAAAATTTGAAAAT
 961 GTCCTTATGCTTTTAGAGTTGCAACTTAAGTATATTTGGTAGGGTGAGTGTTTCCACTCAAAATATGTCAACTTAAAAAA
1041 AAATAGGCCCTTTCATAAAAACCAAACTGTAGCAAGATGCAAATGCATGGCAAATCCTGTCGGTCTCCAGTTGGTTATCT
1121 GAATAGTGTCACCAATTCCACCAAGACAGTGCTGAGATTGGAAAAGGGCACTCATTTGGATTGCCTTACTTCTCTTGCCT
1201 TAAATATATCCCATATATTTAATATGTCAAAAAGGGCTTGAGGTGAATTTCATTAAATGGAATAATATGATGCCACTTTG
1281 CAGCTAAAATAAGCTCAGTGATACCTCCTTGTTAAAAAAAAAAAAAAAAAAAAAGAATGCCAGGGGGGAATTATCATGCT
1361 AAATTATTTTACTGCTGAAGATAGCTTCATTGCAAATTATTCTTTTTCCAGAATTTCCCCCAAACAACTTAGAATTCCAT
1441 AAGTAGAACAAGATAGATTCTACCCCCAAAATATTCATAAGCAAATCCCACTGCCCTTAAAATAAGGAAGTTATGCCTGG
1521 TTGTCTGTGAATGGAACCTCAGTAGGTAATCCTGATGAAGCTTAAAACCTTAGGGCAGTGTCTACATGGGAAACAAGTAT
1601 GTGGAAATTGACAATCATTTTTACCAAATCGTTGAGTAATAATATGACTTACCTGATAGATATACACATTCAATAAGGAA
1681 CATTTTTTTTTTTCAATAAGGAACATTTTAACTAAAACATTACTTTAGGGCTGAGATTTCCAGGCTATCTACATTGATCT
1761 ACTGAAAAATTTCTAGATTTCCATATACAAACGAAGAAGACATGAGTTTAGAGAATTTTTTTCCTTTAATTTTTTTTTAA
1841 CAGAAGGGTATCAGAGTGGAGGACCTAGATTACGCTACCTGTGTTTGAAAATATTGCGCTTTGCCTAACCTTCGGTGGAA
1921 TGTATTGTTTCAGCATATTCTATGTATAAAAAAGTTTAAAGATGTCTTCAAAGAAGACTAGAGTCTTTAAGTCACTTATA
2001 GCTATATTTTACTACAAAATTTGTGTATAAAGATATATTTAAGTGTTTTAGATAAATTTAAGTTACTCCATATGAAATGT
2081 TTAATTTCAGCTACTGTGAATTCTTTCGATCAGTCCTTTGCTTTTTTAAAAAATCTTTTCCATCGTGTTAAAAAGAAAAT
2161 TAGCTATTAGGAGATATTAAAAGATTGATGTCTTAGAAGGACAGGGTTAAAACCTTCTGTAATATATTTAAATATATATT
2241 TTTAAGAGAGATGCTACATTGCCAATGATTTTATAAATAATTTAAAATTAATTTACAAATTTATAGATGCAAACCAAAAG
2321 ATCTTTTTAAAAGAGAGAGAGAGGAAAAAAATCACCTTTTATTTGTTTGGGTCTCATTGTCAGAATTATTATTCAGATCA
2401 AGAAATCTGTGTCGATAAAACCTAATCTCATATTGGAGAGTGAATGTCGTTAAGTATTTCTGAAATGTTTCTAAAAAATG
2481 AACATGAAAAAAATAAGGTATTTTCTCCCTAGCTTCTCATTACAGTATTTCTAATTGCTTCACACTTTACAGTTTTAATA
2561 CAAAGTACAAGCTCTACTTTTATAACGTGTACTACAAGTTTCTTTAAAAGTATTGTTGTATTTCAGCTGAACTCTTGTAT
2641 CTGCAGTCTTTTGTTATTTCTGCAGGCTACACCCTTAATTTGCAGAGGCCATTTTGTTGTTTGTTTGATGCTGAAGCTGT
2721 TGTTAAAATGCCCCAAACTCCAAGGCAGATTGTCTGTATAATACGCTATAGCTTTTCACCATGTGGTGTTTACCAGCTGT
2801 TACTCTGTATTTTAAAAAGCCAGAGATTTCTTCTGTCTAAACTGTTTCTATAGCATTTTCTAAACAAAAAAAATGGTTTT
2881 TTTCTTTGCCTTGTAATAAGATTGTAAATCCATTTCCTGCTTGTGTTCTTAGTGGGCATGATTGTGAGTGTGTGTGGGGT
2961 GCTCACACGCGTGCCAGTCTTTTTGTACTGTAACTACCTCATGGTTTGAATGATGATTGTACTGCTGGTTGTGTTAACAG
3041 AGCACATTTTGTTGGGTGAGTCCTATGTGATTTTTTTCATGTTTGTTTTATCTGGGGGTTGTTCATGAAACTGACAGATG
3121 TTTTTCTAAAAAGGACTATTATCAGTTTCCAAATACAATACTTCTCTCTTCTGGTTTTTCCTGAATGAGCCTGATTTTGT
3201 TGCTGGTTTTCATCATCTATGAGGGTAAAACGAGTACCCTTAAAATCCCTGTGGCCAGTTTGAACACCCCTGTTGTATTC
3281 TTTTCTCTGTTCAGTGTGTCAGCTATTTTGTGAAGATGCTTAGATGTATAGTTTTGATAACCACAGTTTTAAATCTTTTA
3361 TCTGTGCATAATAAAAAGATATATATCAGTTATTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aaGUCAAUAGUGUCAUGACAu 5'
            ||| | |: : ||||||| 
Target 5' gcCAG-TCTTTTTGTACTGTa 3'
 2973 - 2992 150.00 -12.80
2 
miRNA  3' aagUCAAUAG----UGUCAUGACAu 5'
             |||| ||    | ||||:||| 
Target 5' acaAGTT-TCTTTAAAAGTATTGTt 3'
 2594 - 2617 139.00 -8.92
3 
miRNA  3' aagUCAAUAGUGUCAUGACau 5'
             | | || |: ||||||  
Target 5' ttgAATGATGATTGTACTGct 3'
 3006 - 3026 134.00 -7.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31526311 18 COSMIC
COSN30163684 21 COSMIC
COSN30135965 37 COSMIC
COSN31541833 42 COSMIC
COSN1463407 105 COSMIC
COSN23764580 144 COSMIC
COSN26557220 258 COSMIC
COSN31536325 259 COSMIC
COSN31577325 270 COSMIC
COSN31513060 424 COSMIC
COSN31541763 425 COSMIC
COSN31479838 474 COSMIC
COSN31595602 551 COSMIC
COSN30003012 567 COSMIC
COSN8521326 580 COSMIC
COSN31556105 710 COSMIC
COSN24886198 955 COSMIC
COSN29034372 1034 COSMIC
COSN1463406 1263 COSMIC
COSN17429273 1311 COSMIC
COSN29513495 1368 COSMIC
COSN5745360 1631 COSMIC
COSN28971011 1682 COSMIC
COSN26714224 1913 COSMIC
COSN21589230 2141 COSMIC
COSN21235486 2321 COSMIC
COSN27144824 2865 COSMIC
COSN28253075 3071 COSMIC
COSN29878468 3193 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1312480141 8 dbSNP
rs202191737 9 dbSNP
rs375168931 15 dbSNP
rs371085991 17 dbSNP
rs542197544 18 dbSNP
rs1131243 19 dbSNP
rs777459811 19 dbSNP
rs562004206 20 dbSNP
rs774746910 21 dbSNP
rs1000838892 23 dbSNP
rs1465013405 24 dbSNP
rs768750878 25 dbSNP
rs1427302997 26 dbSNP
rs749386034 27 dbSNP
rs1298050370 29 dbSNP
rs769235100 29 dbSNP
rs1480903440 30 dbSNP
rs1251509916 32 dbSNP
rs1175899984 34 dbSNP
rs758963836 35 dbSNP
rs767580175 35 dbSNP
rs780383881 35 dbSNP
rs1481899606 39 dbSNP
rs750939024 39 dbSNP
rs781184201 39 dbSNP
rs1420703234 40 dbSNP
rs540918983 40 dbSNP
rs902596823 41 dbSNP
rs757760206 42 dbSNP
rs746960035 43 dbSNP
rs777492809 44 dbSNP
rs758217785 50 dbSNP
rs754058860 53 dbSNP
rs1309878191 55 dbSNP
rs752312414 56 dbSNP
rs1223707398 58 dbSNP
rs754474478 71 dbSNP
rs751156484 72 dbSNP
rs576526609 75 dbSNP
rs573184725 77 dbSNP
rs895636610 78 dbSNP
rs780119636 81 dbSNP
rs937276095 84 dbSNP
rs765920731 85 dbSNP
rs1403947506 86 dbSNP
rs1036694652 90 dbSNP
rs940987648 94 dbSNP
rs1262393159 97 dbSNP
rs1411582080 103 dbSNP
rs1281566629 116 dbSNP
rs1157368132 119 dbSNP
rs1048543317 123 dbSNP
rs564491881 126 dbSNP
rs199503452 136 dbSNP
rs761208990 147 dbSNP
rs1181741503 151 dbSNP
rs1460397732 154 dbSNP
rs1805115 157 dbSNP
rs767955261 171 dbSNP
rs1328038605 174 dbSNP
rs1258510012 178 dbSNP
rs1289278545 179 dbSNP
rs1184791581 180 dbSNP
rs574788524 183 dbSNP
rs575782942 184 dbSNP
rs1240760818 185 dbSNP
rs1317240649 192 dbSNP
rs1311777904 194 dbSNP
rs1394183892 197 dbSNP
rs1805116 200 dbSNP
rs1406159552 205 dbSNP
rs1338769702 207 dbSNP
rs765016060 208 dbSNP
rs534907849 213 dbSNP
rs1156990479 214 dbSNP
rs1402814968 215 dbSNP
rs1455563476 218 dbSNP
rs1364701516 224 dbSNP
rs1224613967 239 dbSNP
rs1277241289 242 dbSNP
rs1357917139 243 dbSNP
rs1164568067 249 dbSNP
rs774611037 252 dbSNP
rs927443369 253 dbSNP
rs375927498 255 dbSNP
rs1387703462 257 dbSNP
rs1253026088 258 dbSNP
rs182999308 260 dbSNP
rs971472508 261 dbSNP
rs1239282464 262 dbSNP
rs1464000091 264 dbSNP
rs1259081813 267 dbSNP
rs763239975 270 dbSNP
rs1473129089 277 dbSNP
rs1486012381 279 dbSNP
rs1050619 285 dbSNP
rs985564756 288 dbSNP
rs865790178 290 dbSNP
rs1183078933 294 dbSNP
rs1383572391 296 dbSNP
rs1170218759 297 dbSNP
rs565585559 297 dbSNP
rs573873791 298 dbSNP
rs556859031 302 dbSNP
rs954449737 303 dbSNP
rs769937561 306 dbSNP
rs1315566711 313 dbSNP
rs1227596232 318 dbSNP
rs1364490675 319 dbSNP
rs1316356845 322 dbSNP
rs1384108192 332 dbSNP
rs1326845411 340 dbSNP
rs1386018978 345 dbSNP
rs1293298130 349 dbSNP
rs555742735 351 dbSNP
rs979878221 357 dbSNP
rs1164720340 363 dbSNP
rs966727059 365 dbSNP
rs1301652907 367 dbSNP
rs1370810243 368 dbSNP
rs1194758047 373 dbSNP
rs1230208051 375 dbSNP
rs1428735299 378 dbSNP
rs1266317661 387 dbSNP
rs1219804243 395 dbSNP
rs1339215532 396 dbSNP
rs764740196 401 dbSNP
rs1292260546 404 dbSNP
rs1443525232 404 dbSNP
rs1006781143 406 dbSNP
rs1189515455 407 dbSNP
rs1337416951 408 dbSNP
rs1373423936 409 dbSNP
rs749899080 410 dbSNP
rs1013660300 416 dbSNP
rs1165949974 418 dbSNP
rs960758763 423 dbSNP
rs761525685 424 dbSNP
rs1327105314 425 dbSNP
rs192924147 426 dbSNP
rs764253029 432 dbSNP
rs1422948211 434 dbSNP
rs778627082 439 dbSNP
rs1403326633 444 dbSNP
rs1347728785 445 dbSNP
rs1304173641 450 dbSNP
rs1429647320 452 dbSNP
rs566376747 454 dbSNP
rs1805117 457 dbSNP
rs1461993595 461 dbSNP
rs539179739 466 dbSNP
rs1196776895 468 dbSNP
rs138858788 470 dbSNP
rs1197896898 471 dbSNP
rs1269297802 474 dbSNP
rs1225637613 477 dbSNP
rs1181250327 478 dbSNP
rs896901893 479 dbSNP
rs1436001505 482 dbSNP
rs41313401 487 dbSNP
rs768188215 488 dbSNP
rs1291591611 492 dbSNP
rs762263808 494 dbSNP
rs1466360462 499 dbSNP
rs550771540 500 dbSNP
rs1193664231 501 dbSNP
rs529485848 503 dbSNP
rs1221880373 508 dbSNP
rs751804044 514 dbSNP
rs1258106554 515 dbSNP
rs941020330 516 dbSNP
rs1442021984 520 dbSNP
rs1334359977 522 dbSNP
rs909524269 523 dbSNP
rs1480708600 525 dbSNP
rs1050620 526 dbSNP
rs1392502673 537 dbSNP
rs1400827947 541 dbSNP
rs561926024 542 dbSNP
rs1458306821 553 dbSNP
rs1288964346 557 dbSNP
rs772550023 560 dbSNP
rs1429631596 563 dbSNP
rs1157962437 566 dbSNP
rs764530840 567 dbSNP
rs1234413458 568 dbSNP
rs912279397 569 dbSNP
rs1050621 570 dbSNP
rs1050623 571 dbSNP
rs763034502 573 dbSNP
rs547012723 577 dbSNP
rs932830931 583 dbSNP
rs1346605961 584 dbSNP
rs775809577 587 dbSNP
rs764419888 589 dbSNP
rs145038062 596 dbSNP
rs564347164 598 dbSNP
rs1223444813 604 dbSNP
rs1348925385 606 dbSNP
rs1239796504 624 dbSNP
rs1050624 627 dbSNP
rs1260250186 628 dbSNP
rs950217198 644 dbSNP
rs966722021 645 dbSNP
rs570933377 650 dbSNP
rs1454051498 653 dbSNP
rs1270759823 656 dbSNP
rs1406187513 664 dbSNP
rs1317132797 666 dbSNP
rs1398623141 668 dbSNP
rs992132366 674 dbSNP
rs1409848601 675 dbSNP
rs1158980146 679 dbSNP
rs1198439554 684 dbSNP
rs1266625168 685 dbSNP
rs960791387 692 dbSNP
rs1472418837 694 dbSNP
rs1473550295 698 dbSNP
rs1159159629 704 dbSNP
rs773116819 710 dbSNP
rs1033725764 711 dbSNP
rs1001813427 715 dbSNP
rs1467176628 724 dbSNP
rs772068416 727 dbSNP
rs186509687 729 dbSNP
rs985375547 732 dbSNP
rs182258756 733 dbSNP
rs1215283010 737 dbSNP
rs1445539304 740 dbSNP
rs1029950115 768 dbSNP
rs998012817 772 dbSNP
rs1224747566 775 dbSNP
rs1359349511 777 dbSNP
rs1313478384 779 dbSNP
rs563815973 780 dbSNP
rs1247093075 783 dbSNP
rs374704929 790 dbSNP
rs1292703045 792 dbSNP
rs1248825782 794 dbSNP
rs1382831733 798 dbSNP
rs773962728 809 dbSNP
rs1428187981 810 dbSNP
rs1359024076 816 dbSNP
rs1346655181 817 dbSNP
rs542342250 819 dbSNP
rs1179271138 828 dbSNP
rs1221411965 834 dbSNP
rs1423686459 835 dbSNP
rs897048176 842 dbSNP
rs1363501966 845 dbSNP
rs760097803 846 dbSNP
rs1238316838 849 dbSNP
rs1165340344 851 dbSNP
rs896928381 855 dbSNP
rs573907130 857 dbSNP
rs555519876 858 dbSNP
rs1186057664 863 dbSNP
rs1474543567 864 dbSNP
rs1416722027 866 dbSNP
rs1244125141 867 dbSNP
rs1216784012 869 dbSNP
rs1277137357 869 dbSNP
rs190787610 876 dbSNP
rs1423637541 877 dbSNP
rs374069443 882 dbSNP
rs1162022314 889 dbSNP
rs1372846625 895 dbSNP
rs890912642 899 dbSNP
rs1049481220 900 dbSNP
rs771282350 907 dbSNP
rs932840587 910 dbSNP
rs1360852154 923 dbSNP
rs755664359 925 dbSNP
rs1298172355 926 dbSNP
rs1371830768 934 dbSNP
rs904000217 935 dbSNP
rs1212358015 949 dbSNP
rs186173500 961 dbSNP
rs1270356189 965 dbSNP
rs1244122755 968 dbSNP
rs780853579 974 dbSNP
rs1276946361 981 dbSNP
rs1309111584 982 dbSNP
rs1343371282 991 dbSNP
rs1204966320 992 dbSNP
rs1304775127 994 dbSNP
rs557470398 999 dbSNP
rs1353925152 1004 dbSNP
rs1169827015 1006 dbSNP
rs149171541 1008 dbSNP
rs1376427600 1011 dbSNP
rs1421763281 1016 dbSNP
rs568502404 1019 dbSNP
rs1194601788 1020 dbSNP
rs1480254105 1031 dbSNP
rs1449104416 1032 dbSNP
rs1357447163 1033 dbSNP
rs1333459775 1034 dbSNP
rs1414939013 1037 dbSNP
rs760799851 1044 dbSNP
rs1427063991 1045 dbSNP
rs145149335 1045 dbSNP
rs992164901 1047 dbSNP
rs780868960 1052 dbSNP
rs1202117828 1055 dbSNP
rs990 1060 dbSNP
rs1490654558 1065 dbSNP
rs768112880 1067 dbSNP
rs1251180166 1068 dbSNP
rs902 1069 dbSNP
rs1380535960 1070 dbSNP
rs746505769 1073 dbSNP
rs1273137391 1080 dbSNP
rs568332656 1089 dbSNP
rs1405517532 1096 dbSNP
rs1321034276 1101 dbSNP
rs752837120 1102 dbSNP
rs1405403782 1105 dbSNP
rs926735036 1109 dbSNP
rs1372357299 1110 dbSNP
rs1296326704 1120 dbSNP
rs1444325874 1121 dbSNP
rs149986478 1123 dbSNP
rs1459608945 1125 dbSNP
rs1356321411 1133 dbSNP
rs1171533062 1138 dbSNP
rs1469468558 1142 dbSNP
rs1427542028 1143 dbSNP
rs140877088 1144 dbSNP
rs1434066607 1145 dbSNP
rs765497918 1146 dbSNP
rs1175951165 1148 dbSNP
rs970319607 1150 dbSNP
rs1238230906 1155 dbSNP
rs1202553852 1158 dbSNP
rs1459699115 1160 dbSNP
rs1264545563 1169 dbSNP
rs1026831860 1170 dbSNP
rs913361987 1171 dbSNP
rs759611426 1173 dbSNP
rs1243442735 1175 dbSNP
rs1316072972 1181 dbSNP
rs528786379 1182 dbSNP
rs1304645643 1189 dbSNP
rs973842190 1206 dbSNP
rs776629862 1209 dbSNP
rs988911167 1210 dbSNP
rs961279435 1213 dbSNP
rs779777966 1226 dbSNP
rs1186262763 1237 dbSNP
rs564763331 1238 dbSNP
rs936029681 1239 dbSNP
rs147653232 1246 dbSNP
rs1332121428 1247 dbSNP
rs1451918373 1250 dbSNP
rs1404018131 1257 dbSNP
rs1177877988 1258 dbSNP
rs766463714 1260 dbSNP
rs1466774093 1266 dbSNP
rs1363553594 1268 dbSNP
rs1015462425 1272 dbSNP
rs1157441911 1276 dbSNP
rs1804506 1283 dbSNP
rs925950489 1284 dbSNP
rs1320391312 1285 dbSNP
rs1345968465 1286 dbSNP
rs1353363607 1290 dbSNP
rs1381550881 1293 dbSNP
rs774378714 1296 dbSNP
rs563648018 1301 dbSNP
rs985449139 1303 dbSNP
rs890776311 1304 dbSNP
rs887401863 1306 dbSNP
rs954124488 1307 dbSNP
rs1242527241 1309 dbSNP
rs34978889 1309 dbSNP
rs1221113641 1311 dbSNP
rs768305985 1311 dbSNP
rs749158044 1313 dbSNP
rs368181429 1314 dbSNP
rs59188054 1314 dbSNP
rs1479758126 1320 dbSNP
rs1160339731 1324 dbSNP
rs1448741588 1328 dbSNP
rs1028512535 1329 dbSNP
rs1200641341 1329 dbSNP
rs1360821473 1330 dbSNP
rs769504166 1330 dbSNP
rs762750274 1331 dbSNP
rs76721579 1331 dbSNP
rs1418883334 1332 dbSNP
rs1485366963 1333 dbSNP
rs1491444980 1334 dbSNP
rs1029568541 1335 dbSNP
rs1280775002 1335 dbSNP
rs1303568719 1335 dbSNP
rs1344770090 1335 dbSNP
rs1352834970 1335 dbSNP
rs1434279565 1335 dbSNP
rs200216410 1335 dbSNP
rs746377582 1335 dbSNP
rs768087199 1335 dbSNP
rs780727991 1335 dbSNP
rs779579345 1336 dbSNP
rs1217761774 1337 dbSNP
rs977048629 1337 dbSNP
rs757633551 1338 dbSNP
rs996625270 1342 dbSNP
rs17883810 1343 dbSNP
rs1314220880 1344 dbSNP
rs1005267026 1346 dbSNP
rs903574510 1347 dbSNP
rs1364797478 1348 dbSNP
rs888189952 1349 dbSNP
rs1043910228 1350 dbSNP
rs1380625220 1352 dbSNP
rs1317303612 1355 dbSNP
rs1396807108 1356 dbSNP
rs1442361731 1361 dbSNP
rs745527810 1371 dbSNP
rs72714407 1375 dbSNP
rs28394336 1380 dbSNP
rs1056723569 1381 dbSNP
rs1361591685 1383 dbSNP
rs530180883 1387 dbSNP
rs1443365560 1389 dbSNP
rs778737112 1398 dbSNP
rs926626793 1402 dbSNP
rs1427548059 1406 dbSNP
rs1040121924 1411 dbSNP
rs1187915640 1421 dbSNP
rs184187810 1428 dbSNP
rs28698523 1432 dbSNP
rs111695686 1436 dbSNP
rs1488183596 1449 dbSNP
rs891963323 1450 dbSNP
rs1220118608 1462 dbSNP
rs920636840 1463 dbSNP
rs778390099 1465 dbSNP
rs1245702092 1479 dbSNP
rs540375214 1494 dbSNP
rs936103253 1499 dbSNP
rs758672781 1502 dbSNP
rs1293632070 1503 dbSNP
rs1384161959 1505 dbSNP
rs973915904 1506 dbSNP
rs1287148281 1510 dbSNP
rs1383626037 1513 dbSNP
rs753168518 1514 dbSNP
rs1302971537 1515 dbSNP
rs1320127908 1521 dbSNP
rs573063340 1522 dbSNP
rs1368077245 1523 dbSNP
rs1312182016 1524 dbSNP
rs1164345941 1525 dbSNP
rs1460991935 1526 dbSNP
rs1370865905 1528 dbSNP
rs1194827047 1538 dbSNP
rs765594185 1544 dbSNP
rs1228966971 1546 dbSNP
rs1452907697 1549 dbSNP
rs755139754 1551 dbSNP
rs926009658 1555 dbSNP
rs1381357165 1556 dbSNP
rs558071969 1556 dbSNP
rs766408784 1558 dbSNP
rs1490819634 1560 dbSNP
rs1267896056 1562 dbSNP
rs1195174710 1568 dbSNP
rs1338776422 1569 dbSNP
rs1249727539 1571 dbSNP
rs760851199 1574 dbSNP
rs1271180037 1575 dbSNP
rs1318937553 1578 dbSNP
rs1283032647 1581 dbSNP
rs1015491811 1582 dbSNP
rs1339279636 1584 dbSNP
rs75861863 1586 dbSNP
rs1333203392 1588 dbSNP
rs191543210 1597 dbSNP
rs1461775133 1612 dbSNP
rs556505387 1613 dbSNP
rs1391353789 1614 dbSNP
rs1203130363 1623 dbSNP
rs1241475180 1623 dbSNP
rs762651450 1630 dbSNP
rs922574615 1631 dbSNP
rs1465807392 1633 dbSNP
rs1028004611 1634 dbSNP
rs996883803 1635 dbSNP
rs775366817 1638 dbSNP
rs1173822891 1643 dbSNP
rs1481263893 1644 dbSNP
rs1475034345 1645 dbSNP
rs1378014897 1648 dbSNP
rs976700065 1652 dbSNP
rs1436055293 1654 dbSNP
rs1248487212 1656 dbSNP
rs961555556 1661 dbSNP
rs375232472 1663 dbSNP
rs903607114 1665 dbSNP
rs370676839 1668 dbSNP
rs1262681746 1673 dbSNP
rs1319375520 1677 dbSNP
rs1221934483 1679 dbSNP
rs1022463466 1682 dbSNP
rs952487089 1684 dbSNP
rs1324913503 1685 dbSNP
rs1222944153 1688 dbSNP
rs1033375502 1692 dbSNP
rs1275851712 1693 dbSNP
rs756338808 1694 dbSNP
rs778095946 1694 dbSNP
rs759221609 1696 dbSNP
rs1334572696 1698 dbSNP
rs756382683 1701 dbSNP
rs368850678 1702 dbSNP
rs1056757523 1703 dbSNP
rs1404742867 1719 dbSNP
rs1265096375 1727 dbSNP
rs1334234834 1728 dbSNP
rs139697752 1734 dbSNP
rs905409365 1736 dbSNP
rs1406603431 1746 dbSNP
rs1000353943 1747 dbSNP
rs1468528468 1751 dbSNP
rs770321440 1753 dbSNP
rs1179191816 1756 dbSNP
rs1440340062 1758 dbSNP
rs746584073 1763 dbSNP
rs904665364 1765 dbSNP
rs1201973764 1773 dbSNP
rs1049859859 1783 dbSNP
rs932688980 1786 dbSNP
rs1279768967 1788 dbSNP
rs1204984522 1792 dbSNP
rs922635899 1793 dbSNP
rs74923072 1801 dbSNP
rs1312027924 1802 dbSNP
rs1045073763 1806 dbSNP
rs778134022 1813 dbSNP
rs1381356011 1823 dbSNP
rs752764596 1826 dbSNP
rs75692888 1828 dbSNP
rs74896573 1830 dbSNP
rs1384868635 1831 dbSNP
rs201044103 1839 dbSNP
rs752904515 1839 dbSNP
rs1190611661 1847 dbSNP
rs1265191117 1852 dbSNP
rs1293780173 1856 dbSNP
rs1036389795 1860 dbSNP
rs1181935422 1861 dbSNP
rs1359445220 1864 dbSNP
rs939878076 1868 dbSNP
rs1317197557 1873 dbSNP
rs908401123 1874 dbSNP
rs908447240 1877 dbSNP
rs553301669 1879 dbSNP
rs1398797516 1881 dbSNP
rs1362197677 1882 dbSNP
rs1159222597 1894 dbSNP
rs1423884307 1896 dbSNP
rs1384711156 1897 dbSNP
rs1181769051 1903 dbSNP
rs986565888 1907 dbSNP
rs955327756 1909 dbSNP
rs376306385 1913 dbSNP
rs1192725833 1914 dbSNP
rs975147355 1915 dbSNP
rs1288557684 1917 dbSNP
rs1424974818 1918 dbSNP
rs952560102 1921 dbSNP
rs1359282126 1927 dbSNP
rs968112857 1928 dbSNP
rs1248518842 1937 dbSNP
rs1316886071 1947 dbSNP
rs1288970398 1954 dbSNP
rs1022083307 1962 dbSNP
rs772559613 1964 dbSNP
rs1269284631 1977 dbSNP
rs111911073 1978 dbSNP
rs956421223 1979 dbSNP
rs1428180601 1981 dbSNP
rs186980840 1989 dbSNP
rs554390769 1990 dbSNP
rs1404272096 1991 dbSNP
rs552935952 1994 dbSNP
rs905482451 1999 dbSNP
rs1024675733 2004 dbSNP
rs767531327 2007 dbSNP
rs1009642832 2016 dbSNP
rs1414595527 2023 dbSNP
rs1167596537 2025 dbSNP
rs1476939491 2026 dbSNP
rs796264375 2032 dbSNP
rs1375244089 2057 dbSNP
rs1045716858 2062 dbSNP
rs1462980803 2062 dbSNP
rs767630579 2065 dbSNP
rs1490288553 2071 dbSNP
rs1267455343 2072 dbSNP
rs1224402759 2080 dbSNP
rs1031943670 2106 dbSNP
rs1321840184 2107 dbSNP
rs779202869 2108 dbSNP
rs994874540 2111 dbSNP
rs755370800 2112 dbSNP
rs899140859 2122 dbSNP
rs1036295833 2128 dbSNP
rs1278613589 2135 dbSNP
rs371215513 2144 dbSNP
rs538787765 2145 dbSNP
rs1295269424 2151 dbSNP
rs1456021541 2154 dbSNP
rs1243318763 2155 dbSNP
rs1437067086 2155 dbSNP
rs1482740971 2158 dbSNP
rs911944835 2159 dbSNP
rs1050889249 2161 dbSNP
rs1180447740 2165 dbSNP
rs534412268 2175 dbSNP
rs1464271282 2177 dbSNP
rs1220650299 2188 dbSNP
rs1479451407 2190 dbSNP
rs921227296 2196 dbSNP
rs1000427685 2197 dbSNP
rs1422126917 2198 dbSNP
rs1171639813 2199 dbSNP
rs1480344037 2203 dbSNP
rs1446901667 2208 dbSNP
rs1423468319 2211 dbSNP
rs1470969587 2213 dbSNP
rs1193459853 2225 dbSNP
rs780305406 2226 dbSNP
rs975722763 2228 dbSNP
rs967763925 2229 dbSNP
rs1231828755 2235 dbSNP
rs1177287881 2249 dbSNP
rs756134998 2251 dbSNP
rs750584816 2252 dbSNP
rs377444926 2261 dbSNP
rs1258369145 2265 dbSNP
rs1222498094 2267 dbSNP
rs1446158135 2273 dbSNP
rs914930449 2277 dbSNP
rs1401780311 2281 dbSNP
rs1363888400 2283 dbSNP
rs1382573326 2296 dbSNP
rs1300453132 2304 dbSNP
rs1321203076 2313 dbSNP
rs1303082400 2314 dbSNP
rs1316010646 2317 dbSNP
rs373115808 2321 dbSNP
rs1219759024 2322 dbSNP
rs1311228741 2328 dbSNP
rs987777752 2330 dbSNP
rs1372451962 2337 dbSNP
rs1279034089 2340 dbSNP
rs1486365352 2344 dbSNP
rs751440711 2344 dbSNP
rs755707185 2344 dbSNP
rs376113740 2345 dbSNP
rs996975677 2345 dbSNP
rs181125491 2348 dbSNP
rs1332348921 2350 dbSNP
rs1469450230 2352 dbSNP
rs940001915 2352 dbSNP
rs887080850 2354 dbSNP
rs759637948 2356 dbSNP
rs1003748491 2357 dbSNP
rs1297386044 2364 dbSNP
rs1407978253 2365 dbSNP
rs1177298923 2370 dbSNP
rs1441052490 2371 dbSNP
rs1406747466 2372 dbSNP
rs762898642 2373 dbSNP
rs931191679 2375 dbSNP
rs6669888 2379 dbSNP
rs1023911330 2381 dbSNP
rs766308427 2385 dbSNP
rs1317175187 2386 dbSNP
rs1256436119 2399 dbSNP
rs17571088 2406 dbSNP
rs1304851559 2411 dbSNP
rs763355562 2413 dbSNP
rs917639230 2414 dbSNP
rs773508844 2416 dbSNP
rs1452211186 2424 dbSNP
rs1377166904 2425 dbSNP
rs1004801942 2426 dbSNP
rs1223967893 2430 dbSNP
rs759450328 2436 dbSNP
rs1466927950 2440 dbSNP
rs1246648474 2445 dbSNP
rs545353127 2446 dbSNP
rs746593487 2448 dbSNP
rs776406969 2449 dbSNP
rs147408871 2453 dbSNP
rs1182376769 2454 dbSNP
rs1051792537 2456 dbSNP
rs1257915378 2460 dbSNP
rs1157806418 2466 dbSNP
rs1358453096 2470 dbSNP
rs775295275 2478 dbSNP
rs899646256 2479 dbSNP
rs1283572499 2480 dbSNP
rs748205328 2483 dbSNP
rs1354257980 2484 dbSNP
rs1286835196 2485 dbSNP
rs1245425213 2486 dbSNP
rs1319987628 2487 dbSNP
rs745400222 2492 dbSNP
rs1349247386 2493 dbSNP
rs1315164511 2494 dbSNP
rs1280821533 2495 dbSNP
rs1396793011 2499 dbSNP
rs1377151299 2507 dbSNP
rs1361735670 2509 dbSNP
rs1296681772 2513 dbSNP
rs1436989660 2514 dbSNP
rs1358973700 2519 dbSNP
rs1239049448 2521 dbSNP
rs968954409 2523 dbSNP
rs946639945 2527 dbSNP
rs1361950815 2533 dbSNP
rs915120549 2548 dbSNP
rs1223712185 2552 dbSNP
rs1361653988 2553 dbSNP
rs1163496540 2562 dbSNP
rs531865952 2566 dbSNP
rs373652155 2572 dbSNP
rs1455980052 2575 dbSNP
rs188735272 2577 dbSNP
rs1165081166 2578 dbSNP
rs1233574319 2581 dbSNP
rs1365664015 2583 dbSNP
rs541156474 2585 dbSNP
rs528335137 2586 dbSNP
rs1446178489 2587 dbSNP
rs1195497735 2589 dbSNP
rs1488492429 2590 dbSNP
rs901284830 2592 dbSNP
rs771508847 2595 dbSNP
rs1020128274 2601 dbSNP
rs1354381528 2611 dbSNP
rs778876583 2615 dbSNP
rs1245825681 2618 dbSNP
rs1400472431 2620 dbSNP
rs1317457948 2621 dbSNP
rs55667079 2625 dbSNP
rs1212874544 2627 dbSNP
rs887110350 2629 dbSNP
rs1487203780 2635 dbSNP
rs1245939768 2637 dbSNP
rs545708974 2639 dbSNP
rs1284018634 2641 dbSNP
rs779439568 2643 dbSNP
rs1354837017 2662 dbSNP
rs1048348656 2663 dbSNP
rs757188919 2664 dbSNP
rs56404248 2666 dbSNP
rs1303126299 2670 dbSNP
rs185197797 2671 dbSNP
rs1245153865 2674 dbSNP
rs749712255 2678 dbSNP
rs541386059 2684 dbSNP
rs949256749 2689 dbSNP
rs917735277 2691 dbSNP
rs34364530 2707 dbSNP
rs1172357817 2708 dbSNP
rs756293851 2710 dbSNP
rs750631155 2715 dbSNP
rs1428300686 2716 dbSNP
rs1196704782 2719 dbSNP
rs1453205428 2733 dbSNP
rs1004875520 2734 dbSNP
rs890444995 2739 dbSNP
rs1210436262 2744 dbSNP
rs1424260454 2745 dbSNP
rs762695050 2752 dbSNP
rs1340488985 2753 dbSNP
rs781291511 2756 dbSNP
rs1200729809 2759 dbSNP
rs757318985 2764 dbSNP
rs1274582500 2765 dbSNP
rs1231728706 2766 dbSNP
rs752658461 2769 dbSNP
rs1302584141 2773 dbSNP
rs900556970 2777 dbSNP
rs79001261 2780 dbSNP
rs1332997275 2781 dbSNP
rs1465782624 2790 dbSNP
rs946528410 2794 dbSNP
rs759398951 2803 dbSNP
rs1478969173 2804 dbSNP
rs1378197534 2806 dbSNP
rs893761266 2812 dbSNP
rs1052339015 2821 dbSNP
rs1387420117 2825 dbSNP
rs1440418989 2828 dbSNP
rs534401333 2839 dbSNP
rs1236393318 2843 dbSNP
rs927630456 2847 dbSNP
rs1477479544 2848 dbSNP
rs755904238 2854 dbSNP
rs1190031375 2856 dbSNP
rs1458341551 2868 dbSNP
rs1278371397 2870 dbSNP
rs376911402 2874 dbSNP
rs765062293 2874 dbSNP
rs947802603 2876 dbSNP
rs752872500 2878 dbSNP
rs1004259743 2879 dbSNP
rs1347566389 2884 dbSNP
rs1257147904 2888 dbSNP
rs1240018564 2889 dbSNP
rs1374056391 2890 dbSNP
rs1448451021 2900 dbSNP
rs767762057 2902 dbSNP
rs866467632 2908 dbSNP
rs1398757115 2912 dbSNP
rs1447076437 2914 dbSNP
rs1285263481 2923 dbSNP
rs1339441407 2928 dbSNP
rs766096612 2930 dbSNP
rs916291099 2932 dbSNP
rs746829560 2935 dbSNP
rs1273247982 2936 dbSNP
rs1402610717 2938 dbSNP
rs77378509 2939 dbSNP
rs1417737738 2940 dbSNP
rs1378565275 2947 dbSNP
rs1286538692 2951 dbSNP
rs1235734780 2952 dbSNP
rs1180516799 2953 dbSNP
rs1316587322 2955 dbSNP
rs1440394708 2958 dbSNP
rs1237179929 2959 dbSNP
rs1185663701 2960 dbSNP
rs1185683928 2960 dbSNP
rs113200221 2961 dbSNP
rs1197577306 2963 dbSNP
rs1257253070 2964 dbSNP
rs1401004363 2967 dbSNP
rs116500181 2968 dbSNP
rs761363032 2969 dbSNP
rs1287546090 2970 dbSNP
rs376434814 2971 dbSNP
rs1355018189 2972 dbSNP
rs1013464589 2973 dbSNP
rs996159873 2975 dbSNP
rs1392106481 2985 dbSNP
rs1449723045 2988 dbSNP
rs1340871789 2989 dbSNP
rs1297293558 2997 dbSNP
rs1386247242 3000 dbSNP
rs1398080645 3009 dbSNP
rs1362457082 3013 dbSNP
rs1159167998 3015 dbSNP
rs113820201 3017 dbSNP
rs1413129335 3018 dbSNP
rs1161712201 3020 dbSNP
rs1309711211 3022 dbSNP
rs1352629827 3024 dbSNP
rs1464062899 3025 dbSNP
rs1237704407 3027 dbSNP
rs1267093176 3035 dbSNP
rs1488789349 3035 dbSNP
rs1208703607 3038 dbSNP
rs1473869540 3040 dbSNP
rs1369423557 3041 dbSNP
rs1193312609 3042 dbSNP
rs1487508072 3043 dbSNP
rs1458810996 3044 dbSNP
rs1021703296 3045 dbSNP
rs1052259733 3051 dbSNP
rs1266042438 3054 dbSNP
rs1010773453 3058 dbSNP
rs763437847 3062 dbSNP
rs1052241666 3065 dbSNP
rs1438163619 3066 dbSNP
rs1450578314 3068 dbSNP
rs774838846 3073 dbSNP
rs1229693216 3075 dbSNP
rs1043442464 3078 dbSNP
rs1291847292 3078 dbSNP
rs1398816013 3079 dbSNP
rs1356535041 3080 dbSNP
rs1277179630 3087 dbSNP
rs1216634502 3092 dbSNP
rs570314767 3096 dbSNP
rs906414274 3098 dbSNP
rs1435624732 3099 dbSNP
rs1374984185 3101 dbSNP
rs1349392384 3102 dbSNP
rs1244729635 3103 dbSNP
rs1321605539 3104 dbSNP
rs1407298990 3106 dbSNP
rs749801851 3107 dbSNP
rs1170218004 3111 dbSNP
rs761492490 3116 dbSNP
rs56247486 3117 dbSNP
rs1426186512 3128 dbSNP
rs1046489373 3129 dbSNP
rs931647332 3131 dbSNP
rs1477956817 3133 dbSNP
rs921589760 3134 dbSNP
rs770086149 3135 dbSNP
rs773775119 3136 dbSNP
rs1257087945 3146 dbSNP
rs965621544 3147 dbSNP
rs912756470 3156 dbSNP
rs1237144229 3160 dbSNP
rs1196331854 3162 dbSNP
rs878963168 3170 dbSNP
rs746070050 3185 dbSNP
rs1451805024 3190 dbSNP
rs1183946333 3194 dbSNP
rs1257375012 3197 dbSNP
rs1278551562 3203 dbSNP
rs982909415 3206 dbSNP
rs951487610 3212 dbSNP
rs1276541472 3219 dbSNP
rs1438768566 3226 dbSNP
rs1456886918 3229 dbSNP
rs1395275804 3230 dbSNP
rs373535351 3231 dbSNP
rs781316968 3232 dbSNP
rs180780531 3233 dbSNP
rs1464225128 3235 dbSNP
rs995526681 3237 dbSNP
rs757995859 3238 dbSNP
rs548611386 3239 dbSNP
rs1414260679 3240 dbSNP
rs1423756873 3246 dbSNP
rs1193407456 3247 dbSNP
rs1023602296 3248 dbSNP
rs1236993115 3251 dbSNP
rs1176419784 3253 dbSNP
rs188411829 3254 dbSNP
rs1310426544 3255 dbSNP
rs1044001746 3256 dbSNP
rs1342321545 3267 dbSNP
rs565936194 3268 dbSNP
rs765639657 3270 dbSNP
rs896402675 3277 dbSNP
rs1256927510 3278 dbSNP
rs1315673930 3279 dbSNP
rs1310204305 3280 dbSNP
rs1280708442 3290 dbSNP
rs1211887066 3291 dbSNP
rs1219702767 3293 dbSNP
rs1371853781 3296 dbSNP
rs754901024 3297 dbSNP
rs1444849724 3302 dbSNP
rs1202165770 3306 dbSNP
rs762290500 3310 dbSNP
rs1180503068 3314 dbSNP
rs1265925488 3319 dbSNP
rs1052292511 3323 dbSNP
rs999349218 3342 dbSNP
rs1465901350 3345 dbSNP
rs1421660792 3355 dbSNP
rs547898508 3361 dbSNP
rs776209113 3364 dbSNP
rs1176983444 3373 dbSNP
rs1435834197 3377 dbSNP
rs1358824147 3378 dbSNP
rs1465321696 3378 dbSNP
rs954966881 3378 dbSNP
rs766162194 3379 dbSNP
rs1277017391 3381 dbSNP
rs532466392 3382 dbSNP
rs964728278 3384 dbSNP
rs564328488 3387 dbSNP
rs551908322 3388 dbSNP
rs74103025 3389 dbSNP
rs1250867487 3391 dbSNP
rs1180897301 3392 dbSNP
rs1288672647 3396 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7049.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aagucaauaguguCAUGACAu 5'
                       ||||||| 
Target 5' ------------uGUACUGUa 3'
 		1 - 9
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000212355.4 | 3UTR | UGUACUGUAACUACCUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000212355.4 | 3UTR | UGUACUGUAACUACCUCAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER- ER- breast cancer 0.311 2.6e-3 0.259 1.1e-2 79 Click to see details
GSE21687 Ependynoma primary tumors 0.316 5.5e-3 0.288 1.1e-2 64 Click to see details
GSE19536 Breast cancer 0.24 8.1e-3 0.195 2.6e-2 100 Click to see details
GSE17498 Multiple myeloma 0.258 5.4e-2 -0.235 7.2e-2 40 Click to see details
GSE17306 Multiple myeloma -0.22 6.4e-2 -0.208 7.6e-2 49 Click to see details
GSE28544 Breast cancer 0.316 6.6e-2 0.259 1.1e-1 24 Click to see details
GSE21849 B cell lymphoma 0.283 6.8e-2 0.457 6.3e-3 29 Click to see details
GSE14794 Lymphoblastoid cells 0.127 1.2e-1 0.145 8.6e-2 90 Click to see details
GSE38226 Liver fibrosis -0.26 1.3e-1 -0.310 8.6e-2 21 Click to see details
GSE32688 Pancreatic cancer -0.207 1.3e-1 -0.007 4.8e-1 32 Click to see details
GSE19783 ER+ ER+ breast cancer 0.248 1.5e-1 0.135 2.9e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.162 2.2e-1 0.116 2.9e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.171 2.4e-1 -0.129 2.9e-1 20 Click to see details
GSE21032 Prostate cancer 0.066 2.8e-1 0.023 4.2e-1 83 Click to see details
GSE19350 CNS germ cell tumors 0.153 3.2e-1 0.079 4.0e-1 12 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.094 3.3e-1 0.149 2.4e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.072 4.0e-1 -0.009 4.9e-1 16 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.079 4.2e-1 -0.050 4.5e-1 9 Click to see details
GSE26953 Aortic valvular endothelial cells 0.043 4.2e-1 -0.026 4.5e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.029 4.5e-1 -0.032 4.4e-1 23 Click to see details
GSE28260 Renal cortex and medulla -0.004 4.9e-1 0.126 3.4e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.355 0.01 0.383 0 49 Click to see details
KIRP 0.436 0.01 0.419 0.01 32 Click to see details
LUAD 0.674 0.01 0.748 0 12 Click to see details
KIRC 0.234 0.03 0.216 0.04 68 Click to see details
STAD -0.282 0.06 -0.254 0.08 32 Click to see details
BRCA 0.166 0.07 0.141 0.1 84 Click to see details
KICH 0.301 0.07 0.251 0.11 25 Click to see details
COAD -0.552 0.08 -0.619 0.05 8 Click to see details
PCPG 0.911 0.14 0.500 0.33 3 Click to see details
BLCA 0.272 0.14 0.133 0.3 18 Click to see details
PAAD 0.701 0.15 0.800 0.1 4 Click to see details
UCEC 0.23 0.17 0.282 0.12 19 Click to see details
HNSC 0.142 0.18 0.097 0.27 42 Click to see details
THCA 0.113 0.2 0.004 0.49 59 Click to see details
LUSC 0.057 0.37 0.081 0.31 38 Click to see details
PRAD -0.049 0.37 -0.076 0.3 50 Click to see details
CHOL 0.1 0.4 -0.217 0.29 9 Click to see details
ESCA -0.024 0.47 -0.073 0.42 11 Click to see details
CESC 0.011 0.5 0.500 0.33 3 Click to see details
CESC 0.011 0.5 0.500 0.33 3 Click to see details
CESC 0.011 0.5 0.500 0.33 3 Click to see details
360 hsa-miR-101-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000378 MYCN MYCN proto-oncogene, bHLH transcription factor 5 6
MIRT000379 ATXN1 ataxin 1 5 2
MIRT000381 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 8 17
MIRT000430 APP amyloid beta precursor protein 6 4
MIRT001219 FOS Fos proto-oncogene, AP-1 transcription factor subunit 4 6
MIRT002436 ICOS inducible T-cell costimulator 1 1
MIRT003921 MCL1 MCL1, BCL2 family apoptosis regulator 6 7
MIRT003965 COX2 cytochrome c oxidase subunit II 4 2
MIRT004012 FBN2 fibrillin 2 2 1
MIRT004027 ARID1A AT-rich interaction domain 1A 4 3
MIRT004084 SUZ12 SUZ12 polycomb repressive complex 2 subunit 2 1
MIRT004086 EED embryonic ectoderm development 2 1
MIRT004297 PTGS2 prostaglandin-endoperoxide synthase 2 4 4
MIRT005560 ATM ATM serine/threonine kinase 3 1
MIRT005602 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 4 1
MIRT005876 DUSP1 dual specificity phosphatase 1 3 1
MIRT006149 STMN1 stathmin 1 4 2
MIRT006150 RAB5A RAB5A, member RAS oncogene family 5 3
MIRT006151 ATG4D autophagy related 4D cysteine peptidase 4 1
MIRT007091 SOX9 SRY-box 9 3 1
MIRT007188 DNMT3A DNA methyltransferase 3 alpha 3 1
MIRT007375 FMR1 fragile X mental retardation 1 1 1
MIRT027240 PPP4R1 protein phosphatase 4 regulatory subunit 1 1 1
MIRT027241 CERK ceramide kinase 1 1
MIRT027242 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT027243 GMEB2 glucocorticoid modulatory element binding protein 2 1 1
MIRT027244 TGFBR3 transforming growth factor beta receptor 3 2 3
MIRT027245 MRPL44 mitochondrial ribosomal protein L44 1 1
MIRT027246 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT027247 UBE2B ubiquitin conjugating enzyme E2 B 1 1
MIRT027248 VEGFA vascular endothelial growth factor A 3 2
MIRT027249 CDC123 cell division cycle 123 1 1
MIRT027250 TOR1AIP1 torsin 1A interacting protein 1 1 1
MIRT027251 MSH2 mutS homolog 2 1 1
MIRT027252 ZNF567 zinc finger protein 567 1 1
MIRT027253 TMEM192 transmembrane protein 192 2 4
MIRT027254 PRPF38B pre-mRNA processing factor 38B 1 1
MIRT027255 CDC7 cell division cycle 7 1 1
MIRT027256 LYSMD3 LysM domain containing 3 1 1
MIRT027257 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT027258 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT027259 KLHL23 kelch like family member 23 1 1
MIRT027260 SLC7A2 solute carrier family 7 member 2 2 4
MIRT027261 SLC38A2 solute carrier family 38 member 2 2 5
MIRT027262 REEP5 receptor accessory protein 5 1 1
MIRT027263 ZNF792 zinc finger protein 792 1 1
MIRT027264 LIN7C lin-7 homolog C, crumbs cell polarity complex component 1 1
MIRT027265 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT027266 TMEM168 transmembrane protein 168 1 1
MIRT027267 DIMT1 DIM1 dimethyladenosine transferase 1 homolog 1 1
MIRT027268 INA internexin neuronal intermediate filament protein alpha 1 1
MIRT027269 XIAP X-linked inhibitor of apoptosis 1 1
MIRT027270 NR2F2 nuclear receptor subfamily 2 group F member 2 2 5
MIRT027271 KCNG3 potassium voltage-gated channel modifier subfamily G member 3 1 1
MIRT027272 CCDC125 coiled-coil domain containing 125 1 1
MIRT027273 RAB11FIP1 RAB11 family interacting protein 1 1 1
MIRT027274 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 1
MIRT027275 CHAMP1 chromosome alignment maintaining phosphoprotein 1 1 1
MIRT027276 MNX1 motor neuron and pancreas homeobox 1 2 4
MIRT027277 FRMD6 FERM domain containing 6 1 1
MIRT027278 PLAG1 PLAG1 zinc finger 1 1
MIRT027279 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT027280 MPPE1 metallophosphoesterase 1 1 1
MIRT027281 MRPL42 mitochondrial ribosomal protein L42 1 1
MIRT027282 RAC1 Rac family small GTPase 1 2 10
MIRT027283 SREK1IP1 SREK1 interacting protein 1 1 1
MIRT027284 OTUD4 OTU deubiquitinase 4 1 1
MIRT027285 C10orf88 chromosome 10 open reading frame 88 1 1
MIRT027286 KIAA1462 junctional cadherin 5 associated 2 3
MIRT027287 MORC3 MORC family CW-type zinc finger 3 2 3
MIRT027288 TGIF2 TGFB induced factor homeobox 2 1 1
MIRT027289 AKAP11 A-kinase anchoring protein 11 1 1
MIRT027290 AP1S3 adaptor related protein complex 1 sigma 3 subunit 1 1
MIRT027291 STAMBP STAM binding protein 2 3
MIRT027292 UBE2D3 ubiquitin conjugating enzyme E2 D3 1 1
MIRT027293 AP1G1 adaptor related protein complex 1 gamma 1 subunit 2 3
MIRT027294 KDM3B lysine demethylase 3B 1 1
MIRT027295 NUPL2 nucleoporin like 2 1 1
MIRT027296 KDM6B lysine demethylase 6B 1 1
MIRT027297 MBNL2 muscleblind like splicing regulator 2 1 1
MIRT027298 RANBP9 RAN binding protein 9 1 1
MIRT027299 ICK intestinal cell kinase 1 1
MIRT027300 MTSS1L MTSS1L, I-BAR domain containing 1 1
MIRT027301 ZBTB21 zinc finger and BTB domain containing 21 1 1
MIRT027302 ARID5B AT-rich interaction domain 5B 1 1
MIRT027303 ABHD17C abhydrolase domain containing 17C 1 1
MIRT027304 MRGBP MRG domain binding protein 1 1
MIRT027305 MOB4 MOB family member 4, phocein 2 2
MIRT027306 INO80D INO80 complex subunit D 2 4
MIRT027307 MEIS1 Meis homeobox 1 1 1
MIRT027308 DCTD dCMP deaminase 1 1
MIRT027309 KCTD14 potassium channel tetramerization domain containing 14 1 1
MIRT027310 BIRC5 baculoviral IAP repeat containing 5 2 1
MIRT027311 ZCCHC2 zinc finger CCHC-type containing 2 2 5
MIRT027312 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT027313 ACVR2B activin A receptor type 2B 1 1
MIRT027314 MKLN1 muskelin 1 1 1
MIRT027315 MBTD1 mbt domain containing 1 1 1
MIRT027316 AMMECR1L AMMECR1 like 1 1
MIRT027317 KIF2C kinesin family member 2C 1 1
MIRT027318 JUN Jun proto-oncogene, AP-1 transcription factor subunit 1 1
MIRT027319 USP25 ubiquitin specific peptidase 25 1 1
MIRT027320 RARS2 arginyl-tRNA synthetase 2, mitochondrial 1 1
MIRT027321 CD46 CD46 molecule 1 1
MIRT027322 NOP2 NOP2 nucleolar protein 1 1
MIRT027323 LTN1 listerin E3 ubiquitin protein ligase 1 1 1
MIRT027324 FZD6 frizzled class receptor 6 2 8
MIRT027325 VAPA VAMP associated protein A 1 1
MIRT027326 XPO7 exportin 7 1 1
MIRT027327 BTG2 BTG anti-proliferation factor 2 1 1
MIRT027328 MMS22L MMS22 like, DNA repair protein 1 1
MIRT027329 FOXP4 forkhead box P4 1 1
MIRT027330 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT027331 SPATA2 spermatogenesis associated 2 2 6
MIRT027332 FBXO11 F-box protein 11 1 1
MIRT027333 RNF44 ring finger protein 44 1 1
MIRT027334 E2F3 E2F transcription factor 3 1 1
MIRT027335 LMNB1 lamin B1 1 1
MIRT027336 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 6
MIRT027337 HOXA9 homeobox A9 1 1
MIRT027338 FAR1 fatty acyl-CoA reductase 1 1 1
MIRT027339 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 2 3
MIRT027340 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT027341 RTN4 reticulon 4 1 1
MIRT027342 ELAVL2 ELAV like RNA binding protein 2 1 1
MIRT027343 CTR9 CTR9 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT027344 CERS2 ceramide synthase 2 1 1
MIRT027345 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT027346 VEZT vezatin, adherens junctions transmembrane protein 1 1
MIRT027347 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT027348 RIOK2 RIO kinase 2 1 1
MIRT027349 CBX4 chromobox 4 1 1
MIRT027350 SEPT11 septin 11 1 1
MIRT027351 QSER1 glutamine and serine rich 1 1 1
MIRT027352 MYO9A myosin IXA 1 1
MIRT027353 CAPN2 calpain 2 1 1
MIRT027354 TFAP4 transcription factor AP-4 2 4
MIRT027355 SSFA2 sperm specific antigen 2 1 1
MIRT027356 TBC1D12 TBC1 domain family member 12 1 1
MIRT027357 SPAG1 sperm associated antigen 1 2 2
MIRT027358 ZNF800 zinc finger protein 800 1 1
MIRT027359 C7orf60 base methyltransferase of 25S rRNA 2 homolog 1 1
MIRT027360 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 1 1
MIRT027361 SPIRE1 spire type actin nucleation factor 1 1 1
MIRT027362 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT027363 TMEM170B transmembrane protein 170B 1 1
MIRT027364 AFF4 AF4/FMR2 family member 4 1 1
MIRT027365 GNB1 G protein subunit beta 1 2 3
MIRT027366 LBR lamin B receptor 1 1
MIRT027367 ZFX zinc finger protein, X-linked 2 5
MIRT027368 KLF12 Kruppel like factor 12 1 1
MIRT027369 PHF3 PHD finger protein 3 2 2
MIRT027370 C1orf52 chromosome 1 open reading frame 52 1 1
MIRT027371 TSPAN12 tetraspanin 12 1 1
MIRT027372 FAM217B family with sequence similarity 217 member B 1 1
MIRT027373 SUB1 SUB1 homolog, transcriptional regulator 2 3
MIRT027374 BCL9 B-cell CLL/lymphoma 9 1 1
MIRT027375 SACM1L SAC1 like phosphatidylinositide phosphatase 1 1
MIRT027376 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 3
MIRT027377 TRERF1 transcriptional regulating factor 1 1 1
MIRT027378 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 1
MIRT027379 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma 1 1
MIRT027380 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT027381 DDIT4 DNA damage inducible transcript 4 1 1
MIRT027382 TGFBR1 transforming growth factor beta receptor 1 5 2
MIRT027383 LRCH2 leucine rich repeats and calponin homology domain containing 2 1 1
MIRT027384 LIFR LIF receptor alpha 1 1
MIRT027385 FBXW7 F-box and WD repeat domain containing 7 4 1
MIRT027386 POU2F1 POU class 2 homeobox 1 2 2
MIRT027387 CBFA2T2 CBFA2/RUNX1 translocation partner 2 1 1
MIRT027388 LCOR ligand dependent nuclear receptor corepressor 2 8
MIRT027389 AEBP2 AE binding protein 2 1 1
MIRT027390 NEK7 NIMA related kinase 7 1 1
MIRT027391 MFSD6 major facilitator superfamily domain containing 6 2 6
MIRT053051 CDH5 cadherin 5 2 1
MIRT053160 ZEB1 zinc finger E-box binding homeobox 1 2 1
MIRT053339 PTGER4 prostaglandin E receptor 4 3 1
MIRT053584 CPEB1 cytoplasmic polyadenylation element binding protein 1 4 1
MIRT054040 MTOR mechanistic target of rapamycin kinase 4 2
MIRT054057 CFTR cystic fibrosis transmembrane conductance regulator 2 1
MIRT054869 KLF6 Kruppel like factor 6 3 2
MIRT054930 ZEB2 zinc finger E-box binding homeobox 2 2 1
MIRT068842 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT082058 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT086535 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT097055 TNPO1 transportin 1 2 2
MIRT102616 UBN2 ubinuclein 2 2 2
MIRT112563 MLEC malectin 2 2
MIRT145022 TNFAIP1 TNF alpha induced protein 1 2 2
MIRT147277 KPNA2 karyopherin subunit alpha 2 2 10
MIRT188232 RAP1B RAP1B, member of RAS oncogene family 3 1
MIRT194216 FAM103A1 family with sequence similarity 103 member A1 2 2
MIRT196792 ZNF207 zinc finger protein 207 2 2
MIRT200053 ZNF431 zinc finger protein 431 2 2
MIRT208757 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT210927 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT211237 FGF2 fibroblast growth factor 2 2 2
MIRT211639 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT218854 CDKN1A cyclin dependent kinase inhibitor 1A 2 4
MIRT218892 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT303303 SNRNP27 small nuclear ribonucleoprotein U4/U6.U5 subunit 27 2 2
MIRT308546 ZNF654 zinc finger protein 654 2 2
MIRT338018 DAZAP2 DAZ associated protein 2 2 2
MIRT379479 JAK2 Janus kinase 2 3 1
MIRT399110 RNF213 ring finger protein 213 2 2
MIRT437858 MET MET proto-oncogene, receptor tyrosine kinase 2 1
MIRT438193 NLK nemo like kinase 1 1
MIRT438717 MITF melanogenesis associated transcription factor 3 1
MIRT444392 ZNF480 zinc finger protein 480 2 2
MIRT449015 ANKRD17 ankyrin repeat domain 17 2 2
MIRT451770 USP36 ubiquitin specific peptidase 36 2 2
MIRT452413 QDPR quinoid dihydropteridine reductase 2 2
MIRT458487 RMI1 RecQ mediated genome instability 1 2 10
MIRT459618 SLC25A33 solute carrier family 25 member 33 2 2
MIRT460768 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 2
MIRT461158 SLC11A2 solute carrier family 11 member 2 2 4
MIRT461268 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 2
MIRT463488 ZC3H11A zinc finger CCCH-type containing 11A 2 12
MIRT465090 TSN translin 2 2
MIRT466390 TGOLN2 trans-golgi network protein 2 2 2
MIRT466406 TGFBR2 transforming growth factor beta receptor 2 2 4
MIRT466804 STYX serine/threonine/tyrosine interacting protein 2 2
MIRT466883 STX16 syntaxin 16 2 2
MIRT467147 SREBF2 sterol regulatory element binding transcription factor 2 2 2
MIRT468154 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT468832 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT469425 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT470123 PSPC1 paraspeckle component 1 2 4
MIRT470274 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 2
MIRT470359 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT470432 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 6
MIRT470518 PPP1CC protein phosphatase 1 catalytic subunit gamma 2 4
MIRT471100 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT471629 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 2
MIRT472408 NCKAP1 NCK associated protein 1 2 2
MIRT472556 NACC1 nucleus accumbens associated 1 2 4
MIRT475275 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT475569 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 4
MIRT476590 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT478914 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT479637 CD81 CD81 molecule 2 2
MIRT479712 CCNF cyclin F 2 2
MIRT480226 C9orf41 carnosine N-methyltransferase 1 2 2
MIRT480283 C8orf4 chromosome 8 open reading frame 4 2 2
MIRT480577 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT480914 BCL2L11 BCL2 like 11 2 2
MIRT481937 ANKRD11 ankyrin repeat domain 11 2 12
MIRT485643 DICER1 dicer 1, ribonuclease III 2 4
MIRT492248 SLC35F5 solute carrier family 35 member F5 2 2
MIRT493269 MAP3K4 mitogen-activated protein kinase kinase kinase 4 2 2
MIRT496253 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT497710 ZNF645 zinc finger protein 645 2 2
MIRT502490 FAM84B family with sequence similarity 84 member B 2 2
MIRT503888 PGBD4 piggyBac transposable element derived 4 2 2
MIRT504261 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT507720 CLIC4 chloride intracellular channel 4 2 4
MIRT512042 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 6
MIRT512876 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 4
MIRT513078 IL20RB interleukin 20 receptor subunit beta 2 6
MIRT513562 FKBP14 FK506 binding protein 14 2 2
MIRT513632 UBE2A ubiquitin conjugating enzyme E2 A 2 4
MIRT513691 RNF111 ring finger protein 111 2 2
MIRT513760 PEX5L peroxisomal biogenesis factor 5 like 2 4
MIRT516746 ZNF100 zinc finger protein 100 2 2
MIRT520784 TBX18 T-box 18 2 4
MIRT521024 SLC30A5 solute carrier family 30 member 5 2 2
MIRT521902 PIAS1 protein inhibitor of activated STAT 1 2 6
MIRT522364 NAP1L1 nucleosome assembly protein 1 like 1 2 6
MIRT523400 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 4
MIRT525712 DCAF12L2 DDB1 and CUL4 associated factor 12 like 2 2 2
MIRT526325 UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus 2 2
MIRT526565 UGT2A2 UDP glucuronosyltransferase family 2 member A2 2 2
MIRT526793 ZNF223 zinc finger protein 223 2 2
MIRT527746 NANOGNB NANOG neighbor homeobox 2 2
MIRT528459 NXT2 nuclear transport factor 2 like export factor 2 2 2
MIRT532825 ZNF827 zinc finger protein 827 2 2
MIRT534604 RORA RAR related orphan receptor A 2 2
MIRT534670 RNF152 ring finger protein 152 2 2
MIRT535722 N4BP1 NEDD4 binding protein 1 2 2
MIRT536332 LEFTY1 left-right determination factor 1 2 2
MIRT536625 IPO7 importin 7 2 2
MIRT537095 GPR135 G protein-coupled receptor 135 2 2
MIRT537901 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 4
MIRT541193 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT545416 SLC39A6 solute carrier family 39 member 6 2 2
MIRT546237 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 2 4
MIRT547360 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT547538 MAML3 mastermind like transcriptional coactivator 3 2 2
MIRT548060 GOLGA7 golgin A7 2 2
MIRT549247 ATXN1L ataxin 1 like 2 4
MIRT551438 ZNF490 zinc finger protein 490 2 4
MIRT552563 ZFP36L2 ZFP36 ring finger protein like 2 2 4
MIRT553238 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT554919 RAP2C RAP2C, member of RAS oncogene family 2 2
MIRT555004 RAB39B RAB39B, member RAS oncogene family 2 2
MIRT555005 RAB33B RAB33B, member RAS oncogene family 2 2
MIRT555110 PURB purine rich element binding protein B 2 2
MIRT555439 NT5C3A 5'-nucleotidase, cytosolic IIIA 2 2
MIRT555536 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555561 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT557624 GLRX5 glutaredoxin 5 2 2
MIRT558189 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 2 4
MIRT558369 DIDO1 death inducer-obliterator 1 2 4
MIRT559235 BICD2 BICD cargo adaptor 2 2 4
MIRT559244 BEND4 BEN domain containing 4 2 2
MIRT561655 RNF219 ring finger protein 219 2 2
MIRT561719 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT562682 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT562889 NACA2 nascent polypeptide associated complex alpha subunit 2 2 2
MIRT563555 KIAA1586 KIAA1586 2 2
MIRT564994 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT565180 TTC37 tetratricopeptide repeat domain 37 2 2
MIRT565943 RREB1 ras responsive element binding protein 1 2 2
MIRT566486 PCCB propionyl-CoA carboxylase beta subunit 2 2
MIRT566865 LRRC1 leucine rich repeat containing 1 2 2
MIRT567244 HSPA13 heat shock protein family A (Hsp70) member 13 2 2
MIRT567291 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 2 2
MIRT570699 FAM69A family with sequence similarity 69 member A 2 2
MIRT570927 ZNF284 zinc finger protein 284 2 2
MIRT571063 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT571646 SIX4 SIX homeobox 4 2 2
MIRT573692 RBM12B RNA binding motif protein 12B 2 2
MIRT574265 ZNF350 zinc finger protein 350 2 2
MIRT574300 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT574584 NACA nascent polypeptide-associated complex alpha subunit 2 2
MIRT574844 CADM1 cell adhesion molecule 1 2 2
MIRT608127 TSC22D2 TSC22 domain family member 2 2 2
MIRT609020 WNT7A Wnt family member 7A 2 4
MIRT618890 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 2
MIRT644803 NKX3-2 NK3 homeobox 2 2 2
MIRT662979 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT668624 EEA1 early endosome antigen 1 2 2
MIRT679150 ZDHHC15 zinc finger DHHC-type containing 15 2 2
MIRT697516 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT701145 PANK1 pantothenate kinase 1 2 2
MIRT704285 DENND5B DENN domain containing 5B 2 2
MIRT704542 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT705741 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT707679 GPR50 G protein-coupled receptor 50 2 2
MIRT710016 KCNQ5 potassium voltage-gated channel subfamily Q member 5 2 2
MIRT731782 PRDM1 PR/SET domain 1 3 1
MIRT732064 VEGFC vascular endothelial growth factor C 3 2
MIRT732470 SKP1 S-phase kinase associated protein 1 1 0
MIRT733128 FN1 fibronectin 1 1 0
MIRT733278 LINC00943 long intergenic non-protein coding RNA 943 2 0
MIRT733919 TRIB1 tribbles pseudokinase 1 3 0
MIRT734457 BCL6 B-cell CLL/lymphoma 6 4 0
MIRT734877 HIF1A hypoxia inducible factor 1 alpha subunit 3 0
MIRT734878 FOXP3 forkhead box P3 3 0
MIRT735315 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 2 0
MIRT735316 ROS1 ROS proto-oncogene 1, receptor tyrosine kinase 2 0
MIRT735656 ETV1 ETS variant 1 3 0
MIRT736117 NFE2L2 nuclear factor, erythroid 2 like 2 3 0
MIRT736402 PRKDC protein kinase, DNA-activated, catalytic polypeptide 3 0
MIRT736516 ANXA2 annexin A2 3 0
MIRT736655 SRRM4 serine/arginine repetitive matrix 4 1 0
MIRT737510 TBR1 T-box, brain 1 3 0
MIRT755331 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT755564 E2F2 E2F transcription factor 2 1 1
MIRT755567 USP47 ubiquitin specific peptidase 47 6 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-101 Cyclosporin A(CsA) approved 5284373 Quantitative real-time PCR human trophoblast (HT) cells 24453045 2014 down-regulated
miR-101 Sodium butyrate NULL 5222465 Quantitative real-time PCR Burkitt lymphoma cells 24577510 2014 up-regulated
miR-101 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-101 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-101 Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-101 Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-101 CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer cells 22108826 2012 up-regulated
miR-101 Progesterone approved 5994 Microarray Breast cancer 22330642 2012 down-regulated
miR-101 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miR-101 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) NULL 47289 Microarray rat lung 18780894 2008 down-regulated
miR-101 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) NULL 47289 Northern blot rat lung 18780894 2008 down-regulated
miR-101 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) NULL 47289 Quantitative real-time PCR rat lung 18780894 2008 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-101-3p -d-xylose 24203222 NSC727221 sensitive
hsa-miR-101-3p (-)-dactylolide 11222845 NSC740028 sensitive
hsa-miR-101-3p (1'R,3'S,3'aS,8'bS)-1',3'-diphenylspiro[1,3-dihydroindene-2,2'-3,3a,4,8b-tetrahydro-1H-cyclopenta[a]indene]-1,4'-diol 385850 NSC677249 sensitive
hsa-miR-101-3p (1,1,3-trioxo-1,2-benzothiazol-2-yl)methyl 4-methylpiperazine-1-carbodithioate 16072473 NSC735181 sensitive
hsa-miR-101-3p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-101-3p (10Z)-10-[bromo(iodo)methylidene]phenanthren-9-one 3005079 NSC670789 sensitive
hsa-miR-101-3p (11r,15s,17s)-17-methyl-14,16-dioxatetracyclo[8.7.0.03,8.011,15]heptadeca-1(10),3,5,7-tetraene-2,9-dione 54611663 NSC722392 sensitive
hsa-miR-101-3p (14r,15r)-15-methyl-14-[(2r)-6-methylheptan-2-yl]-2,7-diazatetracyclo[8.7.0.02,7.011,15]heptadeca-4,9-diene-3,6-dione 54613624 NSC750441 sensitive
hsa-miR-101-3p (1r)-(-)-3-nitromethine-6-endo-acetoxycamphor 3004516 NSC657829 sensitive
hsa-miR-101-3p (1r)-3,3-dibromocamphor 376765 NSC657822 sensitive
hsa-miR-101-3p (1R,12S)-20-[2-(dimethylamino)ethyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene-11,19-dione 45027831 NSC726770 sensitive
hsa-miR-101-3p (1R,4S,5R,8S,12R,13R)-9-[[(E)-4-[[(1R,4S,5R,8S,12R,13R)-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadec-9-en-9-yl]methoxy]but-2-enoxy]methyl]-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3 54612586 NSC724781 sensitive
hsa-miR-101-3p (1R,4S,5R,8S,12R,13R)-9-[2-[[(1R,4S,5R,8S,12R,13R)-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadec-9-en-9-yl]methoxy]ethoxymethyl]-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08 54612640 NSC724780 sensitive
hsa-miR-101-3p (1R,5S,8E)-8-benzylidene-5-(3-hydroxyphenyl)-2-methyl-2-azabicyclo[3.3.1]nonan-7-one;perchloric acid 45489959 NSC678345 sensitive
hsa-miR-101-3p (1s,4s,6s,9r,11r,14r,15r)-14-hydroxy-4,9,14-trimethyl-18-methylidene-5,10,16-trioxatetracyclo[13.3.1.04,6.09,11]nonadecan-17-one 24205276 NSC734913 sensitive
hsa-miR-101-3p (2-methoxyphenyl) (e)-3-(4-methoxyphenyl)prop-2-enoate 5928358 NSC700136 sensitive
hsa-miR-101-3p (2-methoxyphenyl)(naphthalen-2-yl)methanone 246624 NSC59937 sensitive
hsa-miR-101-3p (2-nitrophenyl)methyl (1s,5s,8z,12s,20r)-21-oxa-13-azapentacyclo[10.9.0.01,20.05,20.014,19]henicosa-8,14,16,18-tetraen-6,10-diyne-13-carboxylate 5469103 NSC683252 sensitive
hsa-miR-101-3p (2e)-2-(1,3-benzodioxol-5-ylmethylidene)-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516904 NSC639981 sensitive
hsa-miR-101-3p (2E)-2-[(2-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516827 NSC639520 sensitive
hsa-miR-101-3p (2e)-2-[(4-chloroanilino)methylidene]-3-methyl-1-oxopyrido[1,2-a]benzimidazole-4-carbonitrile 5456998 NSC712423 resistant
hsa-miR-101-3p (2E)-2-[(4-chlorophenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988453 NSC639517 sensitive
hsa-miR-101-3p (2E)-2-[(4-hydroxyphenyl)methylidene]-6-(piperidin-1-ylmethyl)cyclohexan-1-one;hydrochloride 5469353 NSC687002 sensitive
hsa-miR-101-3p (2E)-2-[(6aS)-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-8-ylidene]-N-[5-[[(2E)-2-[(6aS)-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-8-ylidene]acetyl]amino]pentyl]acetamide 5471190 NSC709362 sensitive
hsa-miR-101-3p (2E)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(piperidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54605003 NSC639978 sensitive
hsa-miR-101-3p (2e)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(pyrrolidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608909 NSC639977 sensitive
hsa-miR-101-3p (2E)-2-benzylidene-6-[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 5468410 NSC669732 sensitive
hsa-miR-101-3p (2E)-2-pentylidene-5-(piperidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608096 NSC639501 sensitive
hsa-miR-101-3p (2e,4e,6z,8e)-n-(1,3-benzodioxol-5-yl)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenamide 24202490 NSC672131 sensitive
hsa-miR-101-3p (2E,6E)-2,6-bis[(4-bromophenyl)methylidene]cyclohexan-1-one 5716584 NSC632831 sensitive
hsa-miR-101-3p (2r,13r,17s,18s)-7-(4-fluorophenyl)-2,18-dimethyl-6,7,9-triazapentacyclo[11.7.0.02,10.04,8.014,18]icosa-4(8),5-dien-17-ol 376242 NSC656925 sensitive
hsa-miR-101-3p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 sensitive
hsa-miR-101-3p (2s)-1-[(2-phenylmethoxynaphtho[1,2-f][1,3]benzodioxol-5-yl)methyl]piperidine-2-carboxylic acid 24205345 NSC735209 resistant
hsa-miR-101-3p (2S)-2-[(E,2S)-2-hydroxy-4-oxo-6-phenylhex-5-enyl]-2,3-dihydropyran-6-one 5468230 NSC666388 sensitive
hsa-miR-101-3p (2s)-2-[2,2-bis(4-chlorophenyl)ethyl]-2-(4-chlorophenyl)-1,3-thiazolidin-4-one 402438 NSC716408 sensitive
hsa-miR-101-3p (2z)-2-[(4-hydroxyphenyl)methylidene]-5-methoxy-1-benzofuran-3-one 54613041 NSC747169 sensitive
hsa-miR-101-3p (2z)-2-[(4z)-3-chloro-4-hydroxyiminocyclohexa-2,5-dien-1-ylidene]-2-(4-chlorophenyl)acetonitrile 5715133 NSC102225 sensitive
hsa-miR-101-3p (2z)-5-methoxy-2-[(3-phenacyloxyphenyl)methylidene]-1-benzofuran-3-one 45028682 NSC743694 sensitive
hsa-miR-101-3p (2Z,6Z)-2,6-bis[[3-[(dimethylamino)methyl]-4-hydroxyphenyl]methylidene]cyclohexan-1-one 6067712 NSC683834 sensitive
hsa-miR-101-3p (3-hydroxy-4-methoxyphenyl)-(7-methoxy-1,3-benzodioxol-5-yl)methanone 46949031 NSC758027 sensitive
hsa-miR-101-3p (3,7,7-trimethyl-5,14-dioxo-13-propan-2-yl-4-oxatricyclo[9.4.0.03,8]pentadeca-1(15),8,10,12-tetraen-15-yl) acetate 363975 NSC629595 sensitive
hsa-miR-101-3p (3e)-3-[(2-chloro-1-methylindol-3-yl)methylidene]-1h-indol-2-one 24203155 NSC726904 sensitive
hsa-miR-101-3p (3e)-3-[(2-chloro-1-phenylindol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471471 NSC711611 sensitive
hsa-miR-101-3p (3e)-3-[(2-chloro-5-methoxy-1,6-dimethylindol-3-yl)methylidene]-5-hydroxy-6-methyl-1h-indol-2-one 16738491 NSC734207 sensitive
hsa-miR-101-3p (3e)-3-[(2-chloro-5-methoxy-1h-indol-3-yl)methylidene]-1-phenylindol-2-one 5471475 NSC711615 sensitive
hsa-miR-101-3p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1-methylindol-2-one 24205817 NSC736793 sensitive
hsa-miR-101-3p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471419 NSC711074 sensitive
hsa-miR-101-3p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-5-fluoro-1h-indol-2-one NSC737697 sensitive
hsa-miR-101-3p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-101-3p (3e)-3-[(6-methylimidazo[2,1-b]thiazol-5-yl)methylene]-1,3-dihydro-2h-indol-2-one 10755270 NSC726902 sensitive
hsa-miR-101-3p (3E)-3-[[3-[1-(4-fluorophenyl)sulfonylpiperidin-4-yl]imidazo[1,5-a]pyridin-1-yl]methylidene]-1H-indol-2-one 54613720 NSC750970 resistant
hsa-miR-101-3p (3E)-3-[1-(4-chloroanilino)ethylidene]oxolan-2-one 820318 NSC680781 sensitive
hsa-miR-101-3p (3e)-4-chloro-3-(pyridin-3-ylmethylidene)-1h-indol-2-one 5473204 NSC724435 sensitive
hsa-miR-101-3p (3e)-4-chloro-3-[(6-chloroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471415 NSC711070 resistant
hsa-miR-101-3p (3e)-5-methoxy-3-[(6-phenyl-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471411 NSC711066 sensitive
hsa-miR-101-3p (3e)-7-chloro-4-hydroxy-1-oxido-3-(p-tolylimino)quinoxalin-1-ium-2-carbonitrile 135457335 NSC693867 sensitive
hsa-miR-101-3p (3e)-n'-(4-nitrophenyl)-3-[(4-nitrophenyl)hydrazinylidene]butanehydrazide 6180765 NSC158088 sensitive
hsa-miR-101-3p (3E,5E)-1-acetyl-3,5-dibenzylidenepiperidin-4-one 5387998 NSC630599 sensitive
hsa-miR-101-3p (3E,5E)-3,5-bis[[4-(dimethylamino)phenyl]methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 5386914 NSC618757 sensitive
hsa-miR-101-3p (3E,5Z)-3,5-bis[(3,4-dimethoxyphenyl)methylidene]thian-4-one 6477009 NSC144310 sensitive
hsa-miR-101-3p (3s,5s)-4-benzyl-3,5-bis(2-methoxyphenyl)hexahydro-1h-pyrrolizinium chloride 402114 NSC715973 sensitive
hsa-miR-101-3p (3s,8r,9s,10r,13s,14s,16e)-3-hydroxy-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-17-one 5472098 NSC716261 resistant
hsa-miR-101-3p (3z)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-5-hydroxy-1-methylindol-2-one 24205836 NSC736818 sensitive
hsa-miR-101-3p (3Z)-3-[(3-nitrophenyl)methylidene]chromen-4-one 1550197 NSC646498 sensitive
hsa-miR-101-3p (3z)-3-[[3-[2-(4-chlorophenyl)-2-oxoethoxy]phenyl]methylidene]-6-methylthiochromen-4-one 45028771 NSC744076 sensitive
hsa-miR-101-3p (3z)-3-[[3-[2-(4-methoxyphenyl)-2-oxoethoxy]phenyl]methylidene]-6-methylthiochromen-4-one 45028770 NSC744075 sensitive
hsa-miR-101-3p (3z)-5-chloro-3-[(2,6-dimethylimidazo[2,1-b][1,3,4]thiadiazol-5-yl)methylidene]-1h-indol-2-one 24205825 NSC736807 sensitive
hsa-miR-101-3p (3z)-5-hydroxy-3-[(3,4,5-trimethoxyphenyl)methylidene]-1h-indol-2-one 24205822 NSC736802 sensitive
hsa-miR-101-3p (3Z,5E)-3,5-bis[(4-methoxyphenyl)methylidene]piperidin-4-one 6477975 NSC632840 sensitive
hsa-miR-101-3p (3Z,5Z)-1,1-dimethyl-3,5-bis[(E)-3-phenylprop-2-enylidene]piperidin-1-ium-4-one 6334460 NSC636679 sensitive
hsa-miR-101-3p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-101-3p (3Z,8R,9S,10R,13S,14S,17R)-17-ethynyl-10,13-dimethyl-3-(2-pyrrolidin-1-ylethoxyimino)-2,6,7,8,9,11,12,14,15,16-decahydro-1H-cyclopenta[a]phenanthren-17-ol 6520040 NSC701574 sensitive
hsa-miR-101-3p (4-methoxyphenyl)-(3,4,5-trimethoxyphenyl)methanol 368140 NSC638483 sensitive
hsa-miR-101-3p (4-methoxyphenyl)(2,3,4-trimethoxyphenyl)methanone 240478 NSC46683 sensitive
hsa-miR-101-3p (4-methylphenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388005 NSC630606 sensitive
hsa-miR-101-3p (4-nitrophenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388007 NSC630608 sensitive
hsa-miR-101-3p (4,4,11,11-tetramethyl-3,5,7,10,12-pentaoxatricyclo[7.3.0.02,6]dodecan-8-yl)methyl 2,2-diphenylacetate 359628 NSC620687 sensitive
hsa-miR-101-3p (4aR,9aR)-9-(4-methylphenyl)sulfonyl-3,4,4a,9a-tetrahydrocarbazole 372866 NSC648556 sensitive
hsa-miR-101-3p (4bS,9bS)-4b,9b-dimethyl-[1]benzoselenolo[3,2-b][1]benzoselenole 370235 NSC643004 sensitive
hsa-miR-101-3p (4e)-2-hydroxy-4-[hydroxy(phenyl)methylidene]-1,5-bis(4-methoxyphenyl)-2-phenacylpyrrolidin-3-one 5471002 NSC707085 sensitive
hsa-miR-101-3p (4e)-4-[(4-chlorophenyl)imino]-1,5-diphenylpyrrolidin-2-one 403390 NSC718191 sensitive
hsa-miR-101-3p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 resistant
hsa-miR-101-3p (4S,5R)-4-(2-methylpropyl)-3-[(1R)-1-phenylethyl]-5-phenylmethoxyoxathiazinane 2,2-dioxide 390837 NSC688895 sensitive
hsa-miR-101-3p (4s,8s,12s,16s)-4,8,12,16-tetrabenzyl-1,9-bis(prop-2-enyl)-1,5,9,13-tetrazacyclohexadecane-2,6,10,14-tetrone 403842 NSC719376 sensitive
hsa-miR-101-3p (4Z)-4-[[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]methylidene]-5-imino-1-phenylpyrazol-3-amine 135276800 NSC763587 sensitive
hsa-miR-101-3p (4z,5z)-1-[(e)-(2-hydroxyphenyl)methyleneamino]-3-phenyl-4,5-bis(phenylimino)imidazolidine-2-thione 135509182 NSC671409 resistant
hsa-miR-101-3p (4Z,9Z,14Z)-2,2,7,7,12,12,17,17-octamethyl-21-oxabicyclo[16.2.1]henicosa-1(20),4,9,14,18-pentaene-3,6,8,11,13,16-hexone 5387611 NSC625154 sensitive
hsa-miR-101-3p (5,7-dibromo-8-hydroxy-3-methyl-2-quinolinyl)(phenyl)methanone 370210 NSC642954 sensitive
hsa-miR-101-3p (5ar,6r,8ar)-6-(1,5-dimethylhexyl)-5a-methyl-2,3,4,5,6,7,8,8a-octahydro-1h-cyclopenta[b]azepine 403828 NSC719362 sensitive
hsa-miR-101-3p (5E)-2-(morpholin-4-ylmethyl)-5-nonylidenecyclopentan-1-one;hydrochloride 54612513 NSC639505 sensitive
hsa-miR-101-3p (5E)-2-[(4-chloroanilino)methyl]-5-[(4-hydroxyphenyl)methylidene]cyclopentan-1-one 5930524 NSC639541 sensitive
hsa-miR-101-3p (5e)-2-[(4-ethoxyanilino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one 5915890 NSC639539 sensitive
hsa-miR-101-3p (5e)-2-[(4-methylphenoxy)methyl]-5-[(5-nitrofuran-2-yl)methylidene]-1,3a-dihydro-[1,3]thiazolo[3,2-b][1,2,4]triazol-6-one 5471975 NSC715682 sensitive
hsa-miR-101-3p (5E)-2-[(dimethylamino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 5387758 NSC626874 sensitive
hsa-miR-101-3p (5E)-2-[(dimethylamino)methyl]-5-[(4-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 21141935 NSC639511 sensitive
hsa-miR-101-3p (5E)-2-[(dimethylamino)methyl]-5-heptylidenecyclopentan-1-one;hydrochloride 5387764 NSC626879 sensitive
hsa-miR-101-3p (5E)-3-(4-chlorophenyl)-1,1-dioxo-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]-1,3-thiazolidin-4-one 5470264 NSC699092 sensitive
hsa-miR-101-3p (5e)-3-benzyl-5-benzylidene-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470510 NSC702359 sensitive
hsa-miR-101-3p (5e)-5-[(3,4-dimethoxyphenyl)methylidene]-3-phenyl-2-propylimino-1,3-thiazolidin-4-one 5471348 NSC710598 resistant
hsa-miR-101-3p (5e)-5-[[(5e)-5-[[5-[(z)-(4,4-dimethyl-5-oxopyrrolidin-2-ylidene)methyl]-4,4-dimethylpyrrol-2-yl]methylidene]-4,4-dimethyl-1-(trifluoromethylsulfonyl)pyrrol-2-yl]methylidene]-2,4,4-trimethyl-1-(triflu 5471912 NSC715335 sensitive
hsa-miR-101-3p (5E,6Z)-5,6-bis[(6,8-dibromoquinazolin-4-yl)hydrazinylidene]hexane-1,2,3,4-tetrol 54611942 NSC716034 sensitive
hsa-miR-101-3p (5r,6s)-5-phenyl-3,4-diazatricyclo[8.4.0.02,6]tetradeca-1(14),2,10,12-tetraene-4-carbothioamide 5467466 NSC652809 sensitive
hsa-miR-101-3p (5z)-3-(4,7-dimethoxy-1,3-benzothiazol-2-yl)-5-[[4-(dimethylamino)phenyl]methylidene]-2-phenylimidazol-4-one 1273997 NSC711830 sensitive
hsa-miR-101-3p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-101-3p (6-acetamido-7-methyl-5,8-dioxo-2,3-dihydro-1H-pyrrolo[1,2-a]benzimidazol-3-yl) 2-methoxyacetate 374010 NSC651084 sensitive
hsa-miR-101-3p (6,6-dibromo-5-oxo-8,9-dihydro-7H-benzo[7]annulen-4-yl) acetate 361590 NSC624771 sensitive
hsa-miR-101-3p (6aS)-3-[5-[4-(2-diethoxyphosphorylethyl)piperazin-1-yl]pentoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 25113728 NSC744025 sensitive
hsa-miR-101-3p (6E)-2-[(dimethylamino)methyl]-6-[(4-methoxyphenyl)methylidene]cyclohexan-1-one;hydrochloride 5468453 NSC670687 sensitive
hsa-miR-101-3p (6Z)-6-[(2-methoxyphenyl)methylidene]-3-(3-nitrophenyl)-[1,3]thiazolo[2,3-b][1,3]thiazol-4-ium-5-one 5847653 NSC657446 sensitive
hsa-miR-101-3p (6Z,10E)-5-hydroxy-6-methyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-10-carbaldehyde 6477353 NSC645998 sensitive
hsa-miR-101-3p (7ar)-1,6-bis(4-methoxyphenyl)-7a-phenyltetrahydroimidazo[1,5-b][1,2,4]oxadiazol-2(1h)-one 402882 NSC717189 sensitive
hsa-miR-101-3p (7E)-6-(methoxymethoxy)-2-methylcyclododec-7-en-3-yn-1-one 5467712 NSC658114 sensitive
hsa-miR-101-3p (7E)-7-benzylidene-2-chloro-5,6-dihydroquinolin-8-one 5470385 NSC700549 sensitive
hsa-miR-101-3p (7z)-6-(4-methoxyphenyl)-3-methyl-7-[[5-(4-nitrophenyl)furan-2-yl]methylidene]-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine 5471358 NSC710779 sensitive
hsa-miR-101-3p (8r,9s,10r,13s,14s,16e)-10,13-dimethyl-16-[(3,4,5-trimethoxyphenyl)methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 5470702 NSC704614 sensitive
hsa-miR-101-3p (8r,9s,10r,13s,14s,16e)-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 5472100 NSC716263 sensitive
hsa-miR-101-3p (8R,9S,10R,13S,14S,16E)-10,13-dimethyl-16-[[3-(2-morpholin-4-ylethoxy)phenyl]methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 24205793 NSC736753 sensitive
hsa-miR-101-3p (8R,9S,13S,14S,16E)-3-hydroxy-13-methyl-16-(pyridin-4-ylmethylidene)-6,7,8,9,11,12,14,15-octahydrocyclopenta[a]phenanthren-17-one 5470644 NSC703823 sensitive
hsa-miR-101-3p (8R,9S,13S,14S,17S)-13-methyl-2-(2,2,2-trifluoroethoxy)-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthrene-3,17-diol 386444 NSC678473 sensitive
hsa-miR-101-3p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 sensitive
hsa-miR-101-3p (8S,9S,10R,13S,14S,17S)-10,13-dimethyl-17-(2-methyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 259211 NSC88916 sensitive
hsa-miR-101-3p (9,10-dioxoanthracen-2-yl)methyl 3-benzamido-2-hydroxy-3-phenylpropanoate 361915 NSC625350 resistant
hsa-miR-101-3p (e)-1-(1,2-dihydroacenaphthylen-5-yl)-3-(4-nitrophenyl)prop-2-en-1-one 6167610 NSC746353 sensitive
hsa-miR-101-3p (e)-1-(1h-benzimidazol-2-yl)-3-(4-methylsulfanylphenyl)prop-2-en-1-one 5472117 NSC716334 sensitive
hsa-miR-101-3p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-101-3p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-(3,4-dimethoxyphenyl)prop-2-en-1-one 5471156 NSC709100 sensitive
hsa-miR-101-3p (E)-1-(7-fluoro-3-methylquinoxalin-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45029310 NSC746087 sensitive
hsa-miR-101-3p (E)-1-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54612660 NSC741738 resistant
hsa-miR-101-3p (e)-1-[(4r,5r)-1,3-dibenzyl-2-oxo-4,5-diphenyl-1,3,2lambda5-diazaphospholidin-2-yl]-3-phenylprop-2-en-1-ol 5470796 NSC705149 sensitive
hsa-miR-101-3p (E)-1-[1-ethyl-4-hydroxy-1-methyl-4-[(E)-2-phenylethenyl]piperidin-1-ium-3-yl]-3-phenylprop-2-en-1-one;bromide 5386939 NSC618770 sensitive
hsa-miR-101-3p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 sensitive
hsa-miR-101-3p (E)-1-[4-[(E)-4,4-dimethyl-3-oxo-5-piperidin-1-ylpent-1-enyl]phenyl]-4,4-dimethyl-5-piperidin-1-ylpent-1-en-3-one;hydrobromide 5386918 NSC618759 sensitive
hsa-miR-101-3p (e)-1-[4-[[4-(4-chloroanilino)-6-(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-[4-(dimethylamino)phenyl]prop-2-en-1-one 45028715 NSC743884 sensitive
hsa-miR-101-3p (e)-1-[4-[[4-anilino-6-(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613477 NSC749379 sensitive
hsa-miR-101-3p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(2-methoxyphenyl)prop-2-en-1-one 24205906 NSC737225 sensitive
hsa-miR-101-3p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 24205912 NSC737231 sensitive
hsa-miR-101-3p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(4-methoxyphenyl)prop-2-en-1-one 24205905 NSC737224 sensitive
hsa-miR-101-3p (e)-2-(benzenesulfonyl)-1-phenyl-3-(2-phenyl-1h-indol-3-yl)prop-2-en-1-one NSC749025 sensitive
hsa-miR-101-3p (e)-2-[4-amino-6-(3,5,5-trimethyl-4h-pyrazol-1-yl)-1,3,5-triazin-2-yl]-3-[4-(diethylamino)phenyl]prop-2-enenitrile 6175750 NSC696923 resistant
hsa-miR-101-3p (e)-3-(1,3-benzodioxol-5-yl)-1-(3,5-ditert-butyl-4-hydroxyphenyl)prop-2-en-1-one 5471158 NSC709102 sensitive
hsa-miR-101-3p (E)-3-(2-nitrophenyl)-1-(3,6,7-trimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)prop-2-en-1-one 5351352 NSC621486 resistant
hsa-miR-101-3p (E)-3-(3,4-dihydroxyphenyl)-N-[(13S)-3-methoxy-13-methyl-8,9,11,12,14,15,16,17-octahydrocyclopenta[a]phenanthren-17-yl]prop-2-enamide 24205536 NSC736118 sensitive
hsa-miR-101-3p (E)-3-(3,4-dimethoxyphenyl)-1-[6-[(E)-3-(3,4-dimethoxyphenyl)prop-2-enoyl]pyridin-2-yl]prop-2-en-1-one 5470456 NSC702045 sensitive
hsa-miR-101-3p (E)-3-(4-chlorophenyl)-1-[4-[(E)-2-(4-chlorophenyl)ethenyl]-1-ethyl-4-hydroxy-1-methylpiperidin-1-ium-3-yl]prop-2-en-1-one;iodide 5469649 NSC691276 sensitive
hsa-miR-101-3p (e)-3-(4-hydroxyphenyl)-1-[5-methyl-1-[8-(trifluoromethyl)quinolin-4-yl]triazol-4-yl]prop-2-en-1-one NSC736153 sensitive
hsa-miR-101-3p (E)-3-(4-methoxyphenyl)-2-(4-oxo-3H-quinazolin-2-yl)prop-2-enenitrile 135454458 NSC684969 resistant
hsa-miR-101-3p (E)-3-[4-(dimethylamino)phenyl]-1-(4-hydroxyphenyl)prop-2-en-1-one 5468166 NSC665694 sensitive
hsa-miR-101-3p (e)-3-[4-[2-oxo-2-(4-phenylpiperazin-1-yl)ethoxy]phenyl]-1-phenyl-prop-2-en-1-one 5466903 NSC645389 sensitive
hsa-miR-101-3p (E)-3-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]-N-(4-chlorophenyl)-2-[[(E)-3-phenylprop-2-enoyl]amino]prop-2-enamide 5920449 NSC645665 sensitive
hsa-miR-101-3p (e)-3-chloro-2-(4-fluorophenyl)-3-(4-methoxyphenyl)prop-2-enal 5387394 NSC623173 sensitive
hsa-miR-101-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 sensitive
hsa-miR-101-3p (E)-5-(diethylamino)-1-[4-[(E)-5-(diethylamino)-4,4-dimethyl-3-oxopent-1-enyl]phenyl]-4,4-dimethylpent-1-en-3-one 5916501 NSC602066 sensitive
hsa-miR-101-3p (e)-5-(diethylamino)-1-phenylpent-1-en-3-one;hydrochloride 6519127 NSC678343 sensitive
hsa-miR-101-3p (e)-but-2-enedioic acid;1-(7,8,9,10-tetrahydrophenanthridin-6-yl)piperidin-4-amine 5471308 NSC710333 sensitive
hsa-miR-101-3p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-methylphenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351426 NSC670225 sensitive
hsa-miR-101-3p (E)-N-[[(17S)-3,17-dihydroxy-13-methyl-7,8,9,11,12,14,15,16-octahydro-6H-cyclopenta[a]phenanthren-17-yl]methyl]-3-(4-hydroxy-3-methoxyphenyl)prop-2-enamide 24205473 NSC735946 sensitive
hsa-miR-101-3p (r,r)-diop 122582 NSC699412 sensitive
hsa-miR-101-3p (z)-(5-bromo-2-oxo-1h-indol-3-ylidene)sulfamic acid 135505239 NSC707054 sensitive
hsa-miR-101-3p (z)-[cyclohexyl-(4-methoxyphenyl)methyl]-methoxycarbonylimino-oxido-ammonium 9556322 NSC692597 sensitive
hsa-miR-101-3p (z)-1-iodo-2-phenyl-1-penten-3-one 5468684 NSC674455 sensitive
hsa-miR-101-3p (Z)-3-(benzenesulfinyl)-N-benzyl-N-tert-butylprop-2-enamide 5470812 NSC705331 sensitive
hsa-miR-101-3p (z)-3-iodo-1,2-diphenyl-2-propen-1-one 5468683 NSC674454 sensitive
hsa-miR-101-3p (z)-n-(1,3-benzodioxol-5-ylmethyl)-n-tert-butyl-3-phenylsulfanylprop-2-enamide 5470808 NSC705327 sensitive
hsa-miR-101-3p (z) 2',3,4,5-tetramethoxystilbene 5388740 NSC638390 sensitive
hsa-miR-101-3p .beta.-phenylethyl 2,4,5-trihydroxycinnamate 5933247 NSC666592 sensitive
hsa-miR-101-3p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 sensitive
hsa-miR-101-3p [(1e,3e)-4-(benzenesulfonyl)buta-1,3-dienyl]sulfinylbenzene 5468034 NSC662784 sensitive
hsa-miR-101-3p [(1h-benzimidazole-2-yl)dithio]-9h-purine 54613148 NSC750485 sensitive
hsa-miR-101-3p [(1r,2r,3r,4r,6r,8s,9e,12s,13s,14r,15s)-3,4,6,12,13-pentaacetyloxy-4,8,11,11-tetramethyl-14-(2-methylpropoxy)-7,18-dioxo-19-oxatricyclo[13.4.0.02,6]nonadec-9-en-15-yl] benzoate 5469441 NSC688228 sensitive
hsa-miR-101-3p [(1R,2S,10S,13S,14R)-7-(4-fluorophenyl)-10,14-dimethyl-6,7,9-triazapentacyclo[11.8.0.02,10.04,8.014,19]henicosa-4(8),5,19-trien-17-yl] acetate 392371 NSC692655 sensitive
hsa-miR-101-3p [(1R,2S,6R,9Z)-9-(acetyloxymethyl)-4-(hydroxymethyl)-14-methylidene-13-oxo-5,12-dioxatricyclo[9.3.0.04,6]tetradec-9-en-2-yl] 2-methylprop-2-enoate 5468206 NSC666113 sensitive
hsa-miR-101-3p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-1,9-dihydroxy-15-[(2r,3s)-2-hydroxy-3-(3-methylbutanoylamino)-3-phenylpropanoyl]oxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]h 6712271 NSC664404 sensitive
hsa-miR-101-3p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-(cyclohexanecarbonylamino)-3-cyclohexyl-2-hydroxypropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10 383477 NSC671869 sensitive
hsa-miR-101-3p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-benzamido-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en- 384061 NSC673186 sensitive
hsa-miR-101-3p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-benzamido-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en- 384061 NSC673186 sensitive
hsa-miR-101-3p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-benzamido-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en- 384061 NSC673186 sensitive
hsa-miR-101-3p [(1s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(3s)-3-(3,3-dimethylbutanoylamino)-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]hep 6712270 NSC664403 sensitive
hsa-miR-101-3p [(1s,4r,5r,6r,7s,8r,11r,13s,17s,18s,19r)-4,5,17-trihydroxy-6,14,18-trimethyl-9,16-dioxo-3,10-dioxapentacyclo[9.8.0.01,7.04,19.013,18]nonadec-14-en-8-yl] 3-hydroxy-2,2-dimethylpropanoate 390662 NSC688274 sensitive
hsa-miR-101-3p [(1S,4S,5R,9R,10S,12R)-1,5,9-trimethyl-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadecan-10-yl] 4-[2-[[2-[7-(dimethylamino)-2-oxochromen-4-yl]acetyl]amino]ethylamino]-4-oxobutanoate 155812944 NSC754329 sensitive
hsa-miR-101-3p [(1s,4s,7r,10s,12r)-4-acetyloxy-15-[(3s)-3-(hexanoylamino)-2-hydroxy-3-phenylpropanoyl]oxy-1,12-dihydroxy-10,14,17,17-tetramethyl-11-oxo-9-(3,4,5-trihydroxyoxan-2-yl)oxy-6-oxatetracyclo[11.3.1.03,10.0 6712194 NSC658831 sensitive
hsa-miR-101-3p [(1s,4s,7r,9s,10s,12r)-4,12-diacetyloxy-15-[3-[(3-chlorobenzoyl)amino]-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-2-y 6712240 NSC662158 sensitive
hsa-miR-101-3p [(3aR,4S,6Z,11aS)-11-acetyloxy-6-(hydroxymethyl)-3,10-dimethylidene-2-oxo-4,5,8,9,11,11a-hexahydro-3aH-cyclodeca[b]furan-4-yl] 2-methylprop-2-enoate 5468207 NSC666114 sensitive
hsa-miR-101-3p [(3aR,6S)-6-(acetyloxymethyl)-9-methyl-3-methylidene-2-oxo-3a,4,5,6,6a,7,9a,9b-octahydroazuleno[4,5-b]furan-4-yl] 2-methylprop-2-enoate 380497 NSC666112 sensitive
hsa-miR-101-3p [(3S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-4,5-dioxo-3-(1-phenylprop-2-enyl)oxolan-3-yl] acetate 386050 NSC677617 sensitive
hsa-miR-101-3p [(3s,8r,9s,10r,13s,14s,16e)-16-(1-acetyloxy-2,2,2-trifluoroethylidene)-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 5351782 NSC45238 sensitive
hsa-miR-101-3p [(3s,8r,9s,10r,13s,14s,16e,17e)-16-[(3,4-dimethoxyphenyl)methylidene]-17-hydroxyimino-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 9572442 NSC716258 sensitive
hsa-miR-101-3p [(3S,8R,9S,10R,13S,14S,16E,17S)-17-acetyloxy-10,13-dimethyl-16-[[3-(2-morpholin-4-ylethoxy)phenyl]methylidene]-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthren-3-yl] acetate 24205801 NSC736761 sensitive
hsa-miR-101-3p [(4S,5R,6S)-4-[(3,4-dimethoxyphenyl)methyl]-6-(2,2-diphenylcyclopentyl)oxy-4-ethyl-2-oxido-5,6-dihydrooxazin-2-ium-5-yl] benzoate 395287 NSC699767 sensitive
hsa-miR-101-3p [(6z)-1-thiacyclodec-6-en-3,8-diyn-5-yl] 9,10-dioxoanthracene-2-carboxylate 5468578 NSC671898 resistant
hsa-miR-101-3p [(6Z,10Z)-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (Z)-4-hydroxy-2-(hydroxymethyl)but-2-enoate 6477984 NSC659936 sensitive
hsa-miR-101-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 sensitive
hsa-miR-101-3p [(E)-1-chlorobutylideneamino] N-[4-(trifluoromethoxy)phenyl]carbamate 5466270 NSC682840 sensitive
hsa-miR-101-3p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(4-bromophenyl)carbamate 9556248 NSC682825 sensitive
hsa-miR-101-3p [(z)-[2-[[6-[[2-[(z)-(carbamothioylhydrazinylidene)methyl]phenoxy]methyl]pyridin-2-yl]methoxy]phenyl]methylideneamino]thiourea 54611756 NSC715648 resistant
hsa-miR-101-3p [(z)-[2-[[6-[[2-[(z)-(carbamoylhydrazinylidene)methyl]phenoxy]methyl]pyridin-2-yl]methoxy]phenyl]methylideneamino]urea 54604867 NSC714407 resistant
hsa-miR-101-3p [(Z)-2-(2,2-diphenylcyclopentyl)oxyethenyl] benzoate 3005428 NSC699766 sensitive
hsa-miR-101-3p [1-(benzenesulfonyloxy)-4,13-dimethyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] acetate 386755 NSC679434 sensitive
hsa-miR-101-3p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]met