pre-miRNA Information
pre-miRNA hsa-mir-101-1   
Genomic Coordinates chr1: 65058434 - 65058508
Description Homo sapiens miR-101-1 stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-101-2   
Genomic Coordinates chr9: 4850297 - 4850375
Description Homo sapiens miR-101-2 stem-loop
Comment Reference .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-101-3p
Sequence 47| UACAGUACUGUGAUAACUGAA |67
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 1 - 65058459 29233923 MiREDiBase
A-to-I 20 1 - 65058443 29233923 MiREDiBase
A-to-I 13 9 + 4850359 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1465115600 3 dbSNP
rs1430733904 4 dbSNP
rs368898585 4 dbSNP
rs778893471 12 dbSNP
rs1359996956 19 dbSNP
rs1243236452 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B9KM6E miR-101-3p Predictive Biomarker (PRD) Clinical/Experimental Data Expression Higher Blood Quantitative real-time PCR
Gene Information
Gene Symbol RAB8B   
Synonyms -
Description RAB8B, member RAS oncogene family
Transcript NM_016530   
Expression
Putative miRNA Targets on RAB8B
3'UTR of RAB8B
(miRNA target sites are highlighted)
>RAB8B|NM_016530|3'UTR
   1 TGAACTCTTTCTGAGAGACTGCAGCACACCTAGAGGGCCCTTTCCTGCTTCTCTGAAAGCACAGGTCACCCAGCCTCAGA
  81 ATCACACCTCCCGGCTGCTGCTGAGAGCACCACTGAACTTAGACCTCTCAACACAGTATGCCAAGTGGATTCCAGCCTCA
 161 TGGCCTAGCAAAAGAACAGACTCCCTTTTTCAAACATGGAAGCAATGAAGTGGAGACACATGCAGGACCTAACTCGTTTT
 241 TTCCTTGTTTTATTACCTGTTGCAGAAGCGGTTATCTTTCTTTTTTACTTTGCACATCAGTGTTAGCCTTTCCCTATTTC
 321 AGCACAATCTTAGACTCATATTTGCACACTTTTGTGTCGTGAAGTTCTAGACAAATTTGTACATGTGGCAATGTTAAAAG
 401 AGCATTTACAGCAGAGGTTAATATACTAAAATTAAAGGGTATTTGGTCTGGTTCATATGGTCAAATATTACTGCCTTGGT
 481 AGCATTTATTTAAGGGCTTTTTCTTAAATAAGAATCATTAAAGTCATTAAAAAAATTTACTGAAATGCCCATCTTGTCAT
 561 CAAAGGCCACAATTTCTTTATTTCTTCAGATTAAGAGCTTTGCCTCATCCCCGACCTGTTTTCCAGAGTCTGGGTAGCTG
 641 AATGAATCACTTTAAAATGATTACCTCTGCCTAATCTATAGAAACTGCATTTGGAAATCACCATAATCTCATTTTTCCCT
 721 GGGGTTTGTATTTGCTATTCTTTCCCATGTTTGACTTAAGTGTAATCACTCTTAAGTAATATTTGAACATTATTATCTGT
 801 TTCTATTTGTGAACTTCTTGAGCTGAAATTTTACGTGGGCTGAGAGATATACCATTTAGGGTTTTAGTGCAGCATCTAAC
 881 TGTGATTCTGTCAATAAGGATATGTAATATATTTTTTCTTAGGTTCACTCCTTAGCTGGCTGGTTTAGTTGTAATACCAA
 961 ATTCCTACCATAATCCCTGTCTACAAAAGTTAGGTTTAGATTTTAGTTTGCGGAAACCTTCCCTATATAGAGACAGATTA
1041 ACTTGTTGATATAAATTTAATAGAGCTAGCTCTTGGTAATGGTGAAAATAATGAGTTTTGGTTGGTTTTATTTGGCAGAT
1121 GTTTTTAGAAATAAAAGTACTTAGACCTAGTGCAGCCTCTAGGAAAAGTCTTGCCTTTTCATTAGAGAAAACAGGACCAA
1201 GGTTTCAGTTTTCAAACAGCTGTTGTTGATTGTGTAGAACCCAGTTCCATCTGTTTTGGTTCATTGTTACAGAACTTAGT
1281 CCAGTCATTTGGGCTAAAGCCAACCAAAAGCTTAGTTGCCTTTCTCAACAAACACTGGTACTGGTATACTTTTGTAGATG
1361 AAACCATCACAAGGTATTTAGTGTTAACTTGTGTGCCAAATTCAGATCACTATGTCGTTGTTGCTCTAGCCTTCAGTGTC
1441 ATAACACAGGGGGGATAAAACAGAGGGGATGAGGGAAATGAATTCTGTTAATAATTATTCTTCCTGGTATGCCTGTTTTG
1521 CTTCACAAAGGCTACTATCATGCTGGATAGATAAGAACAGGAGATGGCAGTGGAAAGGGATTGCTTGTTACCACAGAGAA
1601 TTCTCTTCAAATTAAGATATGTCATTAGAATGCTTGGACCAGTCAATCTTTTGTACTTATTTGAAAATATAGGAACAATT
1681 TAGCAGCTGCAAATATGCCCAAGCTATTTTTAATAGATATACTAAACTTATTGTTGACAAATTTCAGCCTCCTTAATTTT
1761 TTTTTTTTTGGTAATTACCTATAGGCTTAAAAGTCATTCGTTGCTGTTCTAGTATAATTAGTAGTTCCGTGATTGAAAGT
1841 TTATTGTAATTCTACTATCTTCAAATTAGATACATTTTCAAAAGGAAAAGATAATTTTTTAGAAACATCTTAATATTCAC
1921 TATTTCCTGAAAAAATCCAAGCAGTTAACGCTTTCTGGATGGTAACAAAGTACCTTCTAAAAGATAAGTGCTATGACACC
2001 ATGTATGAATGTAATTCTCTTAGTAATTTACCTCTGACTATTTGGTGTCTTAACGCTTTGGTTTATATAATCTCAGGGGT
2081 TGTCTGCAAACCAAAACTGACATATTCTGTGGTTAGCTTTTATTACTTTTTTTTTTAACAGAATGCTTTGCTTTGGTTAT
2161 ATTTCTTCTTTCTTCTTTTGTCTTATATGGATTAATAACTAGTCTCCATGAACTTCACTTGAAAGAGCCTGTAAAAGTTA
2241 GATGAGTCTAAAAGTGCTCTTTGAAGTAGCAGCAAATTGGGAGTATATGCTCTGTTATATAGAAATAAATTGTCCTTGCT
2321 ATTTTCTTACATTTAGCTTTGCTAGATTGTATATACATTGAGCTAAGACCTTAGGAAATTCACTTTCTGCATGATAAAAT
2401 GACCCAATAAATATTCCACTTTGCTTAATAATGTACATACAGTGCATTATTTTTTCTATTTGTAGATGAATTTAATGACA
2481 GATAATTGTCTGTTCCCCGCTGAAACTGAAGAAATCTAGTTTTTTTGTGAACATTTTTGTGGTCTTATGGATAAGGTACA
2561 TGAAGATTTTTGCAGCAGTATTAGTGGTTCAGTGGCTGCACTTTATTAATCAGTGTGTTAATTTTTGACAGTGATTGGAC
2641 TAGACCTTTTCAAATAGAGTCTGAGGGTATCAGACAGTGAAAATGTGCTGTAACTAAGTAGCATGTAAATCAGTTGATTG
2721 TAAAACGTTTCGCTGGGAACTTATTTTAGCTATATTTTACTTCAGACAGATTATGATACAATAATCTACCTGTGCATCAG
2801 TTAGTAGGTGCTGCAGGGTTTCTTACTATTTACAGAAACATTTTGTGCAGTCTTTGTTATAAATTTTCAGAAGACTATAC
2881 TCTTTACTTTGAAGGTCTATTTTTTAATTATACCTCATTTAGCTAACTAGTATTCTAATACCTGGTAGAAAAACAGTGAG
2961 CCAGCCTTTAAGCATCTAACAAAATTTAGACTCTTTGTTTTGTTTTGAACTGAAGACATCATTGGGAAAGGTAGGAAATA
3041 TTAGTTTAGGATAGAGCATACATGTCATATCCAGTAGCATAAAAAAAGTATTATCTCCCTGTCTCCATTAATAAATTTAG
3121 CTGTGCAATATAGGTGCGTTTTTGCAGAAGTTTCTAGTAAGAGATTATAACTCCATTTTACAGGTTCTGAATGCTCAGAG
3201 TCTATATTAAGGCTTATAAAGTTTTTCCTGTGATCAGTAAGTGACACATTTAAGCAGACATTCTTTTCAAGTTCATGACT
3281 TAGATTCCTTTACAAATTTAGTTCTCAATCTTTAAAAACCACATTTCATTATGTTGGTTAATTATTATAAATTTTAAGCA
3361 CTCATTTCTGCAATCAGGTTTCTCAGAATTTTTTTTTTTTAAACAGAAGAGACATTCCTTTTTCCTTGTTACATCCAAGG
3441 GGGGCACAGGGGTGGGTGGAAAGGAATGTCTAAAAATGAAATCCCTTGATATAGAGGGACCTAGACGGACAGGATATGCT
3521 AAAATAATTTCAAATTCTAGCACAATTTTAGAGTAGAATAAGTCATTTTTTTAGACTAATAAAATTAATGGCTGTCATGT
3601 TCACTCTGAAAAAAATCTAAATGACTGAAATGTACAGAAATAAAAATTAGCAAACAATTATTCTAGGGATATTTTCAGAT
3681 TTTACTTCATTTCTTGAAATGCGTGTGCCATATGCAATTGCATTTCTTGTGCCAAGAAACTAATAGAACTTATTTCACTT
3761 TACCTTTTTTTAAAATGTGAATTTAGTTATTATAGTTCAATTTTATGGCCTTACAGATGGCTTTTATTTTGTTTGCAGCT
3841 GACACTGCAGTTCCTTTCATGCAAAATACCATAAACTGTTTGATGAAAATCATGCCCCTAATGGAAACTCTCTAGTTTTT
3921 CCATATAACTATCCTACTGTACATGTTTAAACATATTTTATTTTTGCTCCAATGGCTTAATGTGAAAAGCTCCTGCAGAT
4001 AAGTGGACCTGTCATGTGGTTAATCTTGTTTAAGCCAATTCATTAACTGTGTACTGATACTGATGCTATGTTTTTTTTAA
4081 ATGGATTTTATTCCAGGTGAACTTTTTTTTTATAATAATGTTCGTCTAAAATAAAAACTACATAATGAAAATGAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' aaGUCAAUAGUGUCAUGACAu 5'
            |||| |  |: ||:|||| 
Target 5' gaCAGTGAAAAT-GTGCTGTa 3'
2673 - 2692 138.00 -14.30
2
miRNA  3' aaGUCAAUAGUG-UCAUGACau 5'
            ||   | ||| :||||||  
Target 5' ctCAACAAACACTGGTACTGgt 3'
1324 - 1345 131.00 -11.10
3
miRNA  3' aaGUCAAUAGUGUCAUGACau 5'
            |||||| :| :||:|||  
Target 5' atCAGTTAGTA-GGTGCTGca 3'
2796 - 2815 130.00 -15.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30162116 3 COSMIC
COSN30485398 12 COSMIC
COSN20055708 14 COSMIC
COSN6277814 26 COSMIC
COSN13632073 31 COSMIC
COSN30107712 34 COSMIC
COSN8175623 42 COSMIC
COSN6277815 50 COSMIC
COSN28185189 71 COSMIC
COSN30125376 93 COSMIC
COSN30162299 94 COSMIC
COSN30158355 206 COSMIC
COSN29296979 323 COSMIC
COSN28859205 324 COSMIC
COSN31562745 417 COSMIC
COSN25615175 615 COSMIC
COSN31994567 1238 COSMIC
COSN31552010 1240 COSMIC
COSN7050686 1369 COSMIC
COSN31517494 1382 COSMIC
COSN22475344 1406 COSMIC
COSN31588448 1417 COSMIC
COSN31595658 1455 COSMIC
COSN6277816 1478 COSMIC
COSN31519191 1486 COSMIC
COSN21913505 1551 COSMIC
COSN31611124 1560 COSMIC
COSN22696259 1600 COSMIC
COSN21916254 1637 COSMIC
COSN27474315 1770 COSMIC
COSN27576859 1770 COSMIC
COSN25644189 1771 COSMIC
COSN6277817 1850 COSMIC
COSN31515754 1919 COSMIC
COSN8749118 1959 COSMIC
COSN31483940 2008 COSMIC
COSN31569373 2088 COSMIC
COSN31595001 2144 COSMIC
COSN31571894 2621 COSMIC
COSN25150839 2644 COSMIC
COSN5800019 2896 COSMIC
COSN31516941 2931 COSMIC
COSN31528876 2962 COSMIC
COSN22233804 3083 COSMIC
COSN31531883 3254 COSMIC
COSN26563595 3272 COSMIC
COSN31606210 3279 COSMIC
COSN26572947 3294 COSMIC
COSN26306558 3344 COSMIC
COSN31547697 3354 COSMIC
COSN29085394 3401 COSMIC
COSN30544369 3487 COSMIC
COSN31542554 3683 COSMIC
COSN31548906 3727 COSMIC
COSN31548456 3747 COSMIC
COSN25128699 4040 COSMIC
COSN29215249 4042 COSMIC
COSN8749119 4102 COSMIC
COSN31646583 4126 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs535913243 5 dbSNP
rs1374467067 14 dbSNP
rs1239252665 21 dbSNP
rs192841904 22 dbSNP
rs1315661924 26 dbSNP
rs1487421359 27 dbSNP
rs766307679 29 dbSNP
rs572387833 34 dbSNP
rs201696255 39 dbSNP
rs1364164004 42 dbSNP
rs564435832 48 dbSNP
rs892401429 49 dbSNP
rs1212046472 56 dbSNP
rs1314264985 61 dbSNP
rs1277149749 62 dbSNP
rs1219136924 66 dbSNP
rs1339535894 73 dbSNP
rs1022233544 80 dbSNP
rs1397814062 83 dbSNP
rs1442115676 83 dbSNP
rs185290536 84 dbSNP
rs1352391944 93 dbSNP
rs143919218 94 dbSNP
rs752517393 95 dbSNP
rs1333473001 103 dbSNP
rs562262711 108 dbSNP
rs529001179 109 dbSNP
rs1225592524 115 dbSNP
rs1172920958 125 dbSNP
rs1476842275 135 dbSNP
rs377151242 138 dbSNP
rs1188865329 139 dbSNP
rs959695583 141 dbSNP
rs1033765031 145 dbSNP
rs547434941 147 dbSNP
rs952821795 157 dbSNP
rs992952062 164 dbSNP
rs1014666412 166 dbSNP
rs1203717417 170 dbSNP
rs1216260965 170 dbSNP
rs962128026 175 dbSNP
rs908761984 178 dbSNP
rs940274437 182 dbSNP
rs973250310 190 dbSNP
rs559121268 196 dbSNP
rs922939864 197 dbSNP
rs1483731476 198 dbSNP
rs932990590 202 dbSNP
rs1402373453 206 dbSNP
rs1329170287 208 dbSNP
rs558205431 209 dbSNP
rs1050102403 214 dbSNP
rs920443112 220 dbSNP
rs1399617080 234 dbSNP
rs931877569 236 dbSNP
rs1267576181 237 dbSNP
rs1451880592 248 dbSNP
rs1470679289 258 dbSNP
rs762786369 264 dbSNP
rs936478786 265 dbSNP
rs1053607099 270 dbSNP
rs1174037949 271 dbSNP
rs1426302153 272 dbSNP
rs1273263973 282 dbSNP
rs532937474 287 dbSNP
rs1344614160 290 dbSNP
rs986014328 292 dbSNP
rs1311480051 296 dbSNP
rs911188275 300 dbSNP
rs1378771248 308 dbSNP
rs370595767 317 dbSNP
rs1168916655 325 dbSNP
rs1046783682 336 dbSNP
rs1041481911 339 dbSNP
rs1459456134 349 dbSNP
rs1033732576 350 dbSNP
rs763661289 350 dbSNP
rs1343718413 352 dbSNP
rs751167558 359 dbSNP
rs756776296 360 dbSNP
rs1275723280 368 dbSNP
rs1439607491 372 dbSNP
rs1254111320 376 dbSNP
rs952789322 378 dbSNP
rs1006081063 384 dbSNP
rs904709547 386 dbSNP
rs780750165 389 dbSNP
rs551749135 390 dbSNP
rs1355640277 392 dbSNP
rs1056064434 396 dbSNP
rs368282447 396 dbSNP
rs571248925 396 dbSNP
rs1272237112 401 dbSNP
rs1344157041 404 dbSNP
rs1348527194 406 dbSNP
rs1303232768 410 dbSNP
rs1388626959 415 dbSNP
rs1205790599 417 dbSNP
rs1293211551 421 dbSNP
rs1290394297 429 dbSNP
rs1400831359 429 dbSNP
rs1362909088 440 dbSNP
rs961886185 441 dbSNP
rs576531067 449 dbSNP
rs374860228 455 dbSNP
rs1053939 457 dbSNP
rs1013905513 458 dbSNP
rs1200526453 459 dbSNP
rs189400496 465 dbSNP
rs1266020802 466 dbSNP
rs1015034702 469 dbSNP
rs1185089955 503 dbSNP
rs1489061450 505 dbSNP
rs754388078 510 dbSNP
rs1392427241 511 dbSNP
rs1430880578 513 dbSNP
rs1163583451 517 dbSNP
rs755459021 523 dbSNP
rs537305084 527 dbSNP
rs1215633895 529 dbSNP
rs954350529 529 dbSNP
rs961794564 530 dbSNP
rs1257713835 535 dbSNP
rs985779087 536 dbSNP
rs910241886 537 dbSNP
rs1300663446 552 dbSNP
rs1219266439 557 dbSNP
rs1342616549 559 dbSNP
rs1296534665 568 dbSNP
rs752400437 573 dbSNP
rs1403326438 578 dbSNP
rs1305150590 596 dbSNP
rs936420725 604 dbSNP
rs1376636185 607 dbSNP
rs1344788491 611 dbSNP
rs1170788425 613 dbSNP
rs995015541 614 dbSNP
rs1053979584 616 dbSNP
rs1192423914 617 dbSNP
rs1428906025 626 dbSNP
rs879903296 629 dbSNP
rs1295044380 637 dbSNP
rs549205303 640 dbSNP
rs1482891992 642 dbSNP
rs16946717 645 dbSNP
rs1199384961 646 dbSNP
rs1229038051 649 dbSNP
rs146468305 650 dbSNP
rs985961850 660 dbSNP
rs1046310813 663 dbSNP
rs772352704 666 dbSNP
rs1341516433 672 dbSNP
rs906460868 676 dbSNP
rs1353609906 677 dbSNP
rs911807531 679 dbSNP
rs966380225 690 dbSNP
rs1402123909 701 dbSNP
rs1332589495 703 dbSNP
rs758211943 712 dbSNP
rs976765813 715 dbSNP
rs777867347 724 dbSNP
rs1397477469 725 dbSNP
rs547661137 737 dbSNP
rs1213215816 738 dbSNP
rs1043163833 745 dbSNP
rs888481425 747 dbSNP
rs1185143382 749 dbSNP
rs1250281331 769 dbSNP
rs1422981326 771 dbSNP
rs1005634239 781 dbSNP
rs1238736767 783 dbSNP
rs1016098638 786 dbSNP
rs1256230317 789 dbSNP
rs1198318250 793 dbSNP
rs961535745 796 dbSNP
rs926075056 806 dbSNP
rs747236522 810 dbSNP
rs1029847128 812 dbSNP
rs1310697209 814 dbSNP
rs1449617571 815 dbSNP
rs1163854767 819 dbSNP
rs554215213 821 dbSNP
rs867525018 835 dbSNP
rs572394618 836 dbSNP
rs539437895 840 dbSNP
rs557689948 842 dbSNP
rs1457260125 848 dbSNP
rs1322874320 850 dbSNP
rs1180503460 851 dbSNP
rs1014936320 855 dbSNP
rs957981582 861 dbSNP
rs1390540569 862 dbSNP
rs1269769996 866 dbSNP
rs1036006121 868 dbSNP
rs897487314 873 dbSNP
rs989205678 877 dbSNP
rs1335881707 878 dbSNP
rs913646879 879 dbSNP
rs763254646 881 dbSNP
rs1309115750 883 dbSNP
rs1436595444 886 dbSNP
rs1332296923 895 dbSNP
rs1321221620 904 dbSNP
rs576331220 918 dbSNP
rs1160251621 925 dbSNP
rs367601208 929 dbSNP
rs1379648559 936 dbSNP
rs981957249 954 dbSNP
rs1478427304 958 dbSNP
rs1027352448 976 dbSNP
rs1197114079 985 dbSNP
rs139063498 989 dbSNP
rs142965057 990 dbSNP
rs1264085812 993 dbSNP
rs770983357 994 dbSNP
rs562159279 995 dbSNP
rs1055088394 999 dbSNP
rs1284237751 1001 dbSNP
rs1220285027 1005 dbSNP
rs1346590682 1007 dbSNP
rs1018762234 1012 dbSNP
rs1272556543 1012 dbSNP
rs941367715 1013 dbSNP
rs1299609840 1017 dbSNP
rs1397939047 1019 dbSNP
rs370325955 1029 dbSNP
rs1334799371 1033 dbSNP
rs1416100625 1035 dbSNP
rs965959156 1046 dbSNP
rs1170896319 1047 dbSNP
rs1037090799 1050 dbSNP
rs1424628806 1053 dbSNP
rs776740070 1055 dbSNP
rs1196082502 1061 dbSNP
rs1477069533 1066 dbSNP
rs1241886246 1077 dbSNP
rs540797078 1080 dbSNP
rs1363291337 1083 dbSNP
rs1468714419 1093 dbSNP
rs1161611436 1096 dbSNP
rs1202520597 1101 dbSNP
rs913190861 1106 dbSNP
rs1412927094 1110 dbSNP
rs1469506154 1113 dbSNP
rs377361799 1119 dbSNP
rs1361099295 1122 dbSNP
rs1029773501 1137 dbSNP
rs1449888564 1140 dbSNP
rs978789426 1157 dbSNP
rs1397705671 1166 dbSNP
rs926022622 1168 dbSNP
rs1007093798 1171 dbSNP
rs937440160 1182 dbSNP
rs1334814423 1189 dbSNP
rs1334636991 1193 dbSNP
rs1173178145 1197 dbSNP
rs1464249882 1200 dbSNP
rs1033681014 1202 dbSNP
rs957692845 1206 dbSNP
rs1055946761 1210 dbSNP
rs1182811916 1227 dbSNP
rs2053632 1231 dbSNP
rs1457858190 1233 dbSNP
rs950293470 1235 dbSNP
rs1196440025 1237 dbSNP
rs1306579006 1241 dbSNP
rs1290094150 1251 dbSNP
rs1020677232 1264 dbSNP
rs1376665827 1265 dbSNP
rs1037030866 1270 dbSNP
rs1447420017 1273 dbSNP
rs1329359568 1276 dbSNP
rs1377816101 1277 dbSNP
rs1333459192 1284 dbSNP
rs1460469215 1290 dbSNP
rs147545673 1293 dbSNP
rs769871843 1294 dbSNP
rs1048740143 1310 dbSNP
rs937832908 1315 dbSNP
rs1407486965 1317 dbSNP
rs775503809 1329 dbSNP
rs888851557 1347 dbSNP
rs541785317 1358 dbSNP
rs1240509700 1362 dbSNP
rs1176248045 1375 dbSNP
rs1479996093 1379 dbSNP
rs1007276953 1380 dbSNP
rs1246973275 1382 dbSNP
rs1223267404 1383 dbSNP
rs1319772172 1395 dbSNP
rs1018755949 1397 dbSNP
rs1240528852 1408 dbSNP
rs1355771235 1412 dbSNP
rs901674621 1413 dbSNP
rs762856905 1414 dbSNP
rs1389770327 1417 dbSNP
rs545034911 1418 dbSNP
rs563229992 1428 dbSNP
rs1037423920 1437 dbSNP
rs576370547 1443 dbSNP
rs778816645 1444 dbSNP
rs934069187 1446 dbSNP
rs200491248 1448 dbSNP
rs1382721538 1449 dbSNP
rs889912186 1451 dbSNP
rs1425248359 1453 dbSNP
rs968028811 1454 dbSNP
rs1487308843 1462 dbSNP
rs1252647961 1464 dbSNP
rs1267649346 1478 dbSNP
rs1480192075 1484 dbSNP
rs530839824 1486 dbSNP
rs1489121399 1488 dbSNP
rs139407892 1494 dbSNP
rs1316482769 1495 dbSNP
rs1302058838 1498 dbSNP
rs1375705323 1501 dbSNP
rs1033026416 1504 dbSNP
rs1302742084 1508 dbSNP
rs1173057268 1514 dbSNP
rs1401041038 1516 dbSNP
rs567376292 1519 dbSNP
rs893395339 1522 dbSNP
rs1453654014 1538 dbSNP
rs1360192126 1539 dbSNP
rs1010509860 1541 dbSNP
rs530584269 1559 dbSNP
rs763936944 1562 dbSNP
rs1427765584 1564 dbSNP
rs1309255313 1567 dbSNP
rs1350647601 1571 dbSNP
rs1478703899 1575 dbSNP
rs1260761811 1577 dbSNP
rs1204549820 1578 dbSNP
rs1403938814 1584 dbSNP
rs1483547041 1588 dbSNP
rs1257624660 1598 dbSNP
rs547467410 1599 dbSNP
rs547614779 1601 dbSNP
rs959167042 1604 dbSNP
rs1219468886 1611 dbSNP
rs773942282 1619 dbSNP
rs1342835587 1624 dbSNP
rs991574865 1625 dbSNP
rs1293895549 1654 dbSNP
rs114169448 1661 dbSNP
rs1251131994 1671 dbSNP
rs1340594244 1672 dbSNP
rs1380565225 1673 dbSNP
rs1305058738 1688 dbSNP
rs1207930639 1689 dbSNP
rs1467819470 1690 dbSNP
rs950258227 1699 dbSNP
rs962935278 1714 dbSNP
rs868674410 1718 dbSNP
rs972297078 1720 dbSNP
rs919485521 1721 dbSNP
rs918579943 1722 dbSNP
rs1370930534 1725 dbSNP
rs930924307 1729 dbSNP
rs1192210363 1732 dbSNP
rs1490222608 1734 dbSNP
rs1258213385 1740 dbSNP
rs1181642014 1743 dbSNP
rs1048681061 1747 dbSNP
rs149624714 1749 dbSNP
rs1199285589 1752 dbSNP
rs911319485 1755 dbSNP
rs1387632600 1757 dbSNP
rs942846403 1757 dbSNP
rs1434012780 1771 dbSNP
rs191346218 1772 dbSNP
rs1389333764 1774 dbSNP
rs1447579733 1775 dbSNP
rs1451094876 1783 dbSNP
rs1170474808 1789 dbSNP
rs372346517 1791 dbSNP
rs530024661 1796 dbSNP
rs1393925714 1800 dbSNP
rs1166912454 1801 dbSNP
rs1458254402 1805 dbSNP
rs1369970288 1815 dbSNP
rs901626566 1830 dbSNP
rs1443943447 1839 dbSNP
rs1291320178 1854 dbSNP
rs1010895454 1855 dbSNP
rs1387010389 1856 dbSNP
rs1295226685 1858 dbSNP
rs1439585708 1860 dbSNP
rs761500266 1889 dbSNP
rs1009809933 1891 dbSNP
rs1195413313 1894 dbSNP
rs1357577923 1895 dbSNP
rs1020807937 1917 dbSNP
rs903745586 1919 dbSNP
rs549724309 1921 dbSNP
rs1244167304 1928 dbSNP
rs1359360054 1945 dbSNP
rs1310582499 1950 dbSNP
rs902148008 1951 dbSNP
rs1333458853 1967 dbSNP
rs1032974284 1971 dbSNP
rs1299054918 1974 dbSNP
rs1386972647 1976 dbSNP
rs1325783725 1998 dbSNP
rs925194125 2001 dbSNP
rs144341015 2002 dbSNP
rs1034746642 2033 dbSNP
rs1423717360 2035 dbSNP
rs1219411261 2039 dbSNP
rs959092857 2040 dbSNP
rs570138345 2041 dbSNP
rs1471222380 2044 dbSNP
rs991522405 2049 dbSNP
rs1181434771 2055 dbSNP
rs1012027200 2056 dbSNP
rs1017173098 2057 dbSNP
rs1204777502 2067 dbSNP
rs537382970 2068 dbSNP
rs1447486124 2072 dbSNP
rs776678747 2075 dbSNP
rs1287429591 2076 dbSNP
rs755584906 2080 dbSNP
rs1190400161 2093 dbSNP
rs1347991000 2097 dbSNP
rs1278455039 2100 dbSNP
rs1024809897 2101 dbSNP
rs556005330 2102 dbSNP
rs1332491474 2115 dbSNP
rs538728467 2127 dbSNP
rs973021957 2127 dbSNP
rs1409630645 2138 dbSNP
rs574200085 2142 dbSNP
rs955346234 2144 dbSNP
rs1423199038 2157 dbSNP
rs1162026938 2162 dbSNP
rs971529706 2164 dbSNP
rs911243702 2166 dbSNP
rs972628815 2171 dbSNP
rs919445671 2187 dbSNP
rs1431753308 2188 dbSNP
rs930873408 2215 dbSNP
rs985010542 2238 dbSNP
rs541605532 2244 dbSNP
rs1054577994 2249 dbSNP
rs765735018 2263 dbSNP
rs1386877855 2268 dbSNP
rs1218310997 2284 dbSNP
rs1437771624 2288 dbSNP
rs181365123 2301 dbSNP
rs1321680052 2306 dbSNP
rs1382626392 2316 dbSNP
rs943028963 2319 dbSNP
rs1040078329 2322 dbSNP
rs946245380 2332 dbSNP
rs922993339 2335 dbSNP
rs1222517226 2338 dbSNP
rs1340960368 2338 dbSNP
rs148757242 2348 dbSNP
rs1428304220 2358 dbSNP
rs753142491 2361 dbSNP
rs375651362 2362 dbSNP
rs1003150660 2366 dbSNP
rs545099881 2380 dbSNP
rs1415164726 2394 dbSNP
rs903693430 2405 dbSNP
rs1000752523 2406 dbSNP
rs758743943 2418 dbSNP
rs1210311957 2438 dbSNP
rs563304845 2450 dbSNP
rs1188688255 2457 dbSNP
rs1013315077 2463 dbSNP
rs1180117258 2466 dbSNP
rs1242095061 2469 dbSNP
rs1257640801 2480 dbSNP
rs34896765 2482 dbSNP
rs1157914297 2489 dbSNP
rs994028984 2493 dbSNP
rs542599880 2496 dbSNP
rs1025492273 2499 dbSNP
rs1409259247 2500 dbSNP
rs771062955 2503 dbSNP
rs1458508481 2507 dbSNP
rs571340200 2517 dbSNP
rs1338482765 2520 dbSNP
rs971858735 2520 dbSNP
rs561225286 2524 dbSNP
rs747234832 2527 dbSNP
rs1454511932 2529 dbSNP
rs1380411974 2533 dbSNP
rs1334788865 2543 dbSNP
rs1160288636 2551 dbSNP
rs1401327596 2552 dbSNP
rs1172771668 2553 dbSNP
rs993615134 2554 dbSNP
rs1446456966 2555 dbSNP
rs1305162508 2557 dbSNP
rs879767226 2561 dbSNP
rs1164399321 2562 dbSNP
rs1409243031 2562 dbSNP
rs528332261 2574 dbSNP
rs986706376 2578 dbSNP
rs1241767585 2580 dbSNP
rs1182481105 2581 dbSNP
rs1018221435 2584 dbSNP
rs1234306641 2585 dbSNP
rs1286558061 2587 dbSNP
rs564531405 2588 dbSNP
rs964114214 2596 dbSNP
rs990607182 2602 dbSNP
rs984956223 2604 dbSNP
rs914676359 2613 dbSNP
rs946185890 2614 dbSNP
rs977601013 2621 dbSNP
rs1229253079 2623 dbSNP
rs910800386 2626 dbSNP
rs964952818 2630 dbSNP
rs938907406 2631 dbSNP
rs371617374 2632 dbSNP
rs184281602 2638 dbSNP
rs1300183272 2639 dbSNP
rs1440274510 2652 dbSNP
rs922982944 2654 dbSNP
rs1180763932 2656 dbSNP
rs1352914051 2661 dbSNP
rs947753537 2667 dbSNP
rs1038499544 2674 dbSNP
rs945082980 2678 dbSNP
rs1042148128 2679 dbSNP
rs1248999412 2680 dbSNP
rs1409529688 2685 dbSNP
rs994344449 2691 dbSNP
rs571080310 2692 dbSNP
rs1025416860 2695 dbSNP
rs1246883269 2712 dbSNP
rs925060555 2719 dbSNP
rs1489787294 2720 dbSNP
rs936487376 2723 dbSNP
rs533266375 2727 dbSNP
rs964362429 2728 dbSNP
rs144053276 2732 dbSNP
rs1332984175 2733 dbSNP
rs1022069891 2744 dbSNP
rs146443748 2755 dbSNP
rs1429692267 2756 dbSNP
rs188236419 2763 dbSNP
rs1407199208 2767 dbSNP
rs1364073768 2768 dbSNP
rs1306190659 2773 dbSNP
rs1454754511 2783 dbSNP
rs1347389654 2787 dbSNP
rs1156350470 2799 dbSNP
rs555829361 2805 dbSNP
rs977536770 2818 dbSNP
rs1352481922 2819 dbSNP
rs554105389 2822 dbSNP
rs1479371214 2827 dbSNP
rs938835313 2832 dbSNP
rs1366602129 2834 dbSNP
rs1486809833 2837 dbSNP
rs1258850844 2839 dbSNP
rs1213764710 2844 dbSNP
rs991704999 2853 dbSNP
rs1264036115 2855 dbSNP
rs1217220656 2857 dbSNP
rs567960565 2860 dbSNP
rs534963108 2862 dbSNP
rs1383084819 2863 dbSNP
rs1364720591 2880 dbSNP
rs993955773 2881 dbSNP
rs528637988 2900 dbSNP
rs1038021554 2902 dbSNP
rs1026347706 2906 dbSNP
rs1406166411 2913 dbSNP
rs1178215574 2919 dbSNP
rs553627717 2930 dbSNP
rs1428082650 2935 dbSNP
rs1170921445 2936 dbSNP
rs112995030 2937 dbSNP
rs1006325141 2963 dbSNP
rs1430033175 2964 dbSNP
rs180937607 2966 dbSNP
rs1185830103 2975 dbSNP
rs1485623898 2977 dbSNP
rs1243812748 2991 dbSNP
rs1046834782 2992 dbSNP
rs545150930 2994 dbSNP
rs1483783697 2998 dbSNP
rs976366328 3007 dbSNP
rs1205390078 3022 dbSNP
rs1228671051 3023 dbSNP
rs1309598138 3027 dbSNP
rs922896790 3033 dbSNP
rs966396853 3041 dbSNP
rs769938899 3055 dbSNP
rs977793661 3062 dbSNP
rs547014389 3071 dbSNP
rs936434957 3077 dbSNP
rs1338149089 3080 dbSNP
rs1449769922 3085 dbSNP
rs1404939520 3095 dbSNP
rs1352080641 3101 dbSNP
rs139830475 3102 dbSNP
rs1011939191 3108 dbSNP
rs1169731463 3109 dbSNP
rs1021618810 3122 dbSNP
rs1386947663 3125 dbSNP
rs575349829 3126 dbSNP
rs916435229 3128 dbSNP
rs949287296 3135 dbSNP
rs1046318789 3138 dbSNP
rs542615629 3139 dbSNP
rs1249981891 3146 dbSNP
rs1227078273 3147 dbSNP
rs1323003342 3162 dbSNP
rs929318457 3168 dbSNP
rs28406541 3181 dbSNP
rs1243190477 3188 dbSNP
rs1270475604 3193 dbSNP
rs1381372299 3197 dbSNP
rs75626859 3205 dbSNP
rs1297403763 3206 dbSNP
rs540122632 3219 dbSNP
rs186349079 3229 dbSNP
rs1371541889 3234 dbSNP
rs1017690514 3236 dbSNP
rs1442921548 3238 dbSNP
rs1367962609 3242 dbSNP
rs532154385 3246 dbSNP
rs1182534218 3247 dbSNP
rs1421123073 3255 dbSNP
rs1227556178 3261 dbSNP
rs151234474 3264 dbSNP
rs1344269074 3267 dbSNP
rs1214595348 3273 dbSNP
rs900678324 3278 dbSNP
rs1204932408 3284 dbSNP
rs1288541607 3288 dbSNP
rs1046771863 3290 dbSNP
rs140389109 3292 dbSNP
rs1030582325 3300 dbSNP
rs1358187203 3305 dbSNP
rs1247639038 3319 dbSNP
rs943816211 3325 dbSNP
rs375788342 3332 dbSNP
rs749233009 3333 dbSNP
rs899698415 3337 dbSNP
rs1405387020 3338 dbSNP
rs1347149422 3347 dbSNP
rs1187197085 3348 dbSNP
rs1392529710 3357 dbSNP
rs1450666318 3362 dbSNP
rs1162682705 3373 dbSNP
rs368815376 3379 dbSNP
rs1362321164 3383 dbSNP
rs201174879 3389 dbSNP
rs536266154 3389 dbSNP
rs903152016 3389 dbSNP
rs530870298 3393 dbSNP
rs1407291685 3401 dbSNP
rs1197628186 3402 dbSNP
rs1032025375 3409 dbSNP
rs1451547037 3412 dbSNP
rs1324524980 3414 dbSNP
rs957752009 3418 dbSNP
rs1394916867 3425 dbSNP
rs1434037555 3433 dbSNP
rs1267170115 3439 dbSNP
rs768377319 3440 dbSNP
rs549364172 3441 dbSNP
rs960092112 3442 dbSNP
rs1228068835 3443 dbSNP
rs1320170851 3446 dbSNP
rs916364804 3459 dbSNP
rs1382861661 3473 dbSNP
rs1158790493 3474 dbSNP
rs949239316 3482 dbSNP
rs982393023 3489 dbSNP
rs761470310 3490 dbSNP
rs767233591 3493 dbSNP
rs1174751983 3501 dbSNP
rs555843095 3507 dbSNP
rs150365746 3508 dbSNP
rs1444850185 3514 dbSNP
rs772787105 3516 dbSNP
rs887795228 3518 dbSNP
rs372673793 3526 dbSNP
rs2197381 3538 dbSNP
rs1260822875 3546 dbSNP
rs1039088649 3552 dbSNP
rs1271917093 3559 dbSNP
rs919508666 3559 dbSNP
rs1328091018 3562 dbSNP
rs1325714581 3565 dbSNP
rs1207165574 3566 dbSNP
rs1453400690 3566 dbSNP
rs900626229 3566 dbSNP
rs760187810 3567 dbSNP
rs145003666 3581 dbSNP
rs111994639 3589 dbSNP
rs775093773 3595 dbSNP
rs1420667973 3597 dbSNP
rs902736517 3598 dbSNP
rs576111087 3607 dbSNP
rs1235794406 3609 dbSNP
rs1390049612 3612 dbSNP
rs912260018 3616 dbSNP
rs753266987 3617 dbSNP
rs758907417 3631 dbSNP
rs943784680 3634 dbSNP
rs539223760 3638 dbSNP
rs1208971790 3639 dbSNP
rs1039898872 3640 dbSNP
rs921066988 3651 dbSNP
rs1411447644 3652 dbSNP
rs947217442 3655 dbSNP
rs957698451 3658 dbSNP
rs990519791 3660 dbSNP
rs1246849969 3680 dbSNP
rs557548308 3687 dbSNP
rs970904435 3691 dbSNP
rs1156600567 3694 dbSNP
rs981951151 3703 dbSNP
rs1282714175 3704 dbSNP
rs375393248 3711 dbSNP
rs1382695306 3718 dbSNP
rs918428216 3721 dbSNP
rs903118667 3730 dbSNP
rs1333480846 3733 dbSNP
rs951275820 3735 dbSNP
rs1057141599 3754 dbSNP
rs752107990 3760 dbSNP
rs984013354 3761 dbSNP
rs1382847378 3762 dbSNP
rs1293402665 3765 dbSNP
rs909838453 3765 dbSNP
rs1349436048 3769 dbSNP
rs1226197421 3780 dbSNP
rs1470315630 3782 dbSNP
rs1234203864 3789 dbSNP
rs13681 3792 dbSNP
rs1039470876 3793 dbSNP
rs1351924662 3797 dbSNP
rs1013000771 3804 dbSNP
rs1200365650 3805 dbSNP
rs1277170834 3811 dbSNP
rs922027798 3817 dbSNP
rs1188674702 3818 dbSNP
rs1227764085 3825 dbSNP
rs933414733 3848 dbSNP
rs1251175774 3854 dbSNP
rs1281459947 3857 dbSNP
rs1471729902 3861 dbSNP
rs1350239727 3864 dbSNP
rs117288058 3872 dbSNP
rs995434078 3877 dbSNP
rs1413871127 3894 dbSNP
rs1364187258 3896 dbSNP
rs1163483924 3900 dbSNP
rs1026509043 3909 dbSNP
rs1409757104 3913 dbSNP
rs902683691 3924 dbSNP
rs1171810410 3927 dbSNP
rs757521616 3932 dbSNP
rs192308863 3947 dbSNP
rs1312885947 3951 dbSNP
rs1201246193 3954 dbSNP
rs1349414428 3960 dbSNP
rs373584826 3965 dbSNP
rs1289887531 3969 dbSNP
rs1336696151 3970 dbSNP
rs965017823 3973 dbSNP
rs1286683677 3974 dbSNP
rs1011900506 3979 dbSNP
rs554564832 3981 dbSNP
rs1328671363 3982 dbSNP
rs1368034610 3983 dbSNP
rs1273456562 3984 dbSNP
rs1023749008 3990 dbSNP
rs1366150983 4012 dbSNP
rs1293423347 4023 dbSNP
rs746077253 4039 dbSNP
rs1346437666 4042 dbSNP
rs7181218 4043 dbSNP
rs1456392171 4051 dbSNP
rs540549202 4054 dbSNP
rs780252343 4065 dbSNP
rs1178364033 4067 dbSNP
rs5813203 4071 dbSNP
rs978983207 4071 dbSNP
rs1187024962 4072 dbSNP
rs1486272726 4073 dbSNP
rs1025434411 4077 dbSNP
rs1206835954 4079 dbSNP
rs1464631311 4084 dbSNP
rs1263943025 4095 dbSNP
rs1482141247 4096 dbSNP
rs951212482 4099 dbSNP
rs1251458157 4102 dbSNP
rs1310780614 4103 dbSNP
rs924467369 4103 dbSNP
rs983959742 4103 dbSNP
rs1364633308 4111 dbSNP
rs28597779 4111 dbSNP
rs1317985987 4112 dbSNP
rs1057109050 4121 dbSNP
rs1406415101 4124 dbSNP
rs576669126 4125 dbSNP
rs1197833416 4127 dbSNP
rs561252453 4128 dbSNP
rs1170797304 4129 dbSNP
rs1430251086 4133 dbSNP
rs1388191872 4134 dbSNP
rs1186788522 4136 dbSNP
rs1464473073 4142 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.642 1.1e-3 0.756 5.8e-5 20 Click to see details
GSE28544 Breast cancer 0.505 5.9e-3 0.454 1.3e-2 24 Click to see details
GSE14794 Lymphoblastoid cells 0.237 1.2e-2 0.147 8.3e-2 90 Click to see details
GSE26953 Aortic valvular endothelial cells -0.451 1.3e-2 -0.328 5.9e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.352 4.2e-2 0.428 1.6e-2 25 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.345 4.6e-2 -0.203 1.7e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.242 9.1e-2 0.324 3.5e-2 32 Click to see details
GSE19536 Breast cancer -0.132 9.5e-2 -0.092 1.8e-1 100 Click to see details
GSE21032 Prostate cancer 0.142 1.0e-1 0.103 1.8e-1 83 Click to see details
GSE19783 ER- ER- breast cancer -0.125 1.4e-1 -0.143 1.0e-1 79 Click to see details
GSE28260 Renal cortex and medulla -0.314 1.5e-1 -0.319 1.4e-1 13 Click to see details
GSE19350 CNS germ cell tumors 0.31 1.6e-1 0.229 2.4e-1 12 Click to see details
GSE17498 Multiple myeloma 0.158 1.7e-1 0.251 5.9e-2 40 Click to see details
GSE21849 B cell lymphoma 0.186 1.7e-1 -0.013 4.7e-1 29 Click to see details
GSE19783 ER+ ER+ breast cancer 0.192 2.1e-1 0.072 3.8e-1 20 Click to see details
GSE21687 Ependynoma primary tumors -0.094 2.3e-1 -0.109 2.0e-1 64 Click to see details
GSE17306 Multiple myeloma 0.081 2.9e-1 0.168 1.2e-1 49 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.206 3.0e-1 -0.167 3.3e-1 9 Click to see details
GSE27834 Pluripotent stem cells 0.124 3.2e-1 0.094 3.6e-1 16 Click to see details
GSE38226 Liver fibrosis 0.098 3.4e-1 0.091 3.5e-1 21 Click to see details
GSE42095 Differentiated embryonic stem cells 0.087 3.5e-1 0.071 3.7e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA 0.66 0 0.699 0 18 Click to see details
LUAD 0.578 0.02 0.413 0.09 12 Click to see details
BRCA -0.197 0.04 -0.134 0.11 84 Click to see details
STAD 0.315 0.04 0.235 0.1 32 Click to see details
COAD -0.57 0.07 -0.643 0.04 8 Click to see details
KIRP 0.19 0.15 0.264 0.07 32 Click to see details
KIRC 0.124 0.16 0.139 0.13 68 Click to see details
UCEC 0.216 0.19 -0.007 0.49 19 Click to see details
CESC -0.793 0.21 -0.500 0.33 3 Click to see details
PAAD 0.567 0.22 0.400 0.3 4 Click to see details
HNSC -0.112 0.24 -0.136 0.2 42 Click to see details
THCA 0.058 0.33 0.077 0.28 59 Click to see details
LIHC 0.049 0.37 0.044 0.38 49 Click to see details
CHOL -0.106 0.39 -0.317 0.2 9 Click to see details
ESCA 0.083 0.4 0.000 0.5 11 Click to see details
PCPG -0.23 0.43 -0.500 0.33 3 Click to see details
KICH -0.035 0.43 0.065 0.38 25 Click to see details
LUSC -0.02 0.45 -0.097 0.28 38 Click to see details
PRAD -0.012 0.47 0.055 0.35 50 Click to see details
PRAD -0.012 0.47 0.055 0.35 50 Click to see details
PRAD -0.012 0.47 0.055 0.35 50 Click to see details
360 hsa-miR-101-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000378 MYCN MYCN proto-oncogene, bHLH transcription factor 5 6
MIRT000379 ATXN1 ataxin 1 5 2
MIRT000381 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 8 17
MIRT000430 APP amyloid beta precursor protein 6 4
MIRT001219 FOS Fos proto-oncogene, AP-1 transcription factor subunit 4 6
MIRT002436 ICOS inducible T-cell costimulator 1 1
MIRT003921 MCL1 MCL1, BCL2 family apoptosis regulator 6 7
MIRT003965 COX2 cytochrome c oxidase subunit II 4 2
MIRT004012 FBN2 fibrillin 2 2 1
MIRT004027 ARID1A AT-rich interaction domain 1A 4 3
MIRT004084 SUZ12 SUZ12 polycomb repressive complex 2 subunit 2 1
MIRT004086 EED embryonic ectoderm development 2 1
MIRT004297 PTGS2 prostaglandin-endoperoxide synthase 2 4 4
MIRT005560 ATM ATM serine/threonine kinase 3 1
MIRT005602 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 4 1
MIRT005876 DUSP1 dual specificity phosphatase 1 3 1
MIRT006149 STMN1 stathmin 1 4 2
MIRT006150 RAB5A RAB5A, member RAS oncogene family 5 3
MIRT006151 ATG4D autophagy related 4D cysteine peptidase 4 1
MIRT007091 SOX9 SRY-box 9 3 1
MIRT007188 DNMT3A DNA methyltransferase 3 alpha 3 1
MIRT007375 FMR1 fragile X mental retardation 1 1 1
MIRT027240 PPP4R1 protein phosphatase 4 regulatory subunit 1 1 1
MIRT027241 CERK ceramide kinase 1 1
MIRT027242 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 1
MIRT027243 GMEB2 glucocorticoid modulatory element binding protein 2 1 1
MIRT027244 TGFBR3 transforming growth factor beta receptor 3 2 3
MIRT027245 MRPL44 mitochondrial ribosomal protein L44 1 1
MIRT027246 MKNK2 MAP kinase interacting serine/threonine kinase 2 1 1
MIRT027247 UBE2B ubiquitin conjugating enzyme E2 B 1 1
MIRT027248 VEGFA vascular endothelial growth factor A 3 2
MIRT027249 CDC123 cell division cycle 123 1 1
MIRT027250 TOR1AIP1 torsin 1A interacting protein 1 1 1
MIRT027251 MSH2 mutS homolog 2 1 1
MIRT027252 ZNF567 zinc finger protein 567 1 1
MIRT027253 TMEM192 transmembrane protein 192 2 4
MIRT027254 PRPF38B pre-mRNA processing factor 38B 1 1
MIRT027255 CDC7 cell division cycle 7 1 1
MIRT027256 LYSMD3 LysM domain containing 3 1 1
MIRT027257 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT027258 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT027259 KLHL23 kelch like family member 23 1 1
MIRT027260 SLC7A2 solute carrier family 7 member 2 2 4
MIRT027261 SLC38A2 solute carrier family 38 member 2 2 5
MIRT027262 REEP5 receptor accessory protein 5 1 1
MIRT027263 ZNF792 zinc finger protein 792 1 1
MIRT027264 LIN7C lin-7 homolog C, crumbs cell polarity complex component 1 1
MIRT027265 MAP2K1 mitogen-activated protein kinase kinase 1 1 1
MIRT027266 TMEM168 transmembrane protein 168 1 1
MIRT027267 DIMT1 DIM1 dimethyladenosine transferase 1 homolog 1 1
MIRT027268 INA internexin neuronal intermediate filament protein alpha 1 1
MIRT027269 XIAP X-linked inhibitor of apoptosis 1 1
MIRT027270 NR2F2 nuclear receptor subfamily 2 group F member 2 2 5
MIRT027271 KCNG3 potassium voltage-gated channel modifier subfamily G member 3 1 1
MIRT027272 CCDC125 coiled-coil domain containing 125 1 1
MIRT027273 RAB11FIP1 RAB11 family interacting protein 1 1 1
MIRT027274 GFPT2 glutamine-fructose-6-phosphate transaminase 2 1 1
MIRT027275 CHAMP1 chromosome alignment maintaining phosphoprotein 1 1 1
MIRT027276 MNX1 motor neuron and pancreas homeobox 1 2 4
MIRT027277 FRMD6 FERM domain containing 6 1 1
MIRT027278 PLAG1 PLAG1 zinc finger 1 1
MIRT027279 AP3M1 adaptor related protein complex 3 mu 1 subunit 1 1
MIRT027280 MPPE1 metallophosphoesterase 1 1 1
MIRT027281 MRPL42 mitochondrial ribosomal protein L42 1 1
MIRT027282 RAC1 Rac family small GTPase 1 2 10
MIRT027283 SREK1IP1 SREK1 interacting protein 1 1 1
MIRT027284 OTUD4 OTU deubiquitinase 4 1 1
MIRT027285 C10orf88 chromosome 10 open reading frame 88 1 1
MIRT027286 KIAA1462 junctional cadherin 5 associated 2 3
MIRT027287 MORC3 MORC family CW-type zinc finger 3 2 3
MIRT027288 TGIF2 TGFB induced factor homeobox 2 1 1
MIRT027289 AKAP11 A-kinase anchoring protein 11 1 1
MIRT027290 AP1S3 adaptor related protein complex 1 sigma 3 subunit 1 1
MIRT027291 STAMBP STAM binding protein 2 3
MIRT027292 UBE2D3 ubiquitin conjugating enzyme E2 D3 1 1
MIRT027293 AP1G1 adaptor related protein complex 1 gamma 1 subunit 2 3
MIRT027294 KDM3B lysine demethylase 3B 1 1
MIRT027295 NUPL2 nucleoporin like 2 1 1
MIRT027296 KDM6B lysine demethylase 6B 1 1
MIRT027297 MBNL2 muscleblind like splicing regulator 2 1 1
MIRT027298 RANBP9 RAN binding protein 9 1 1
MIRT027299 ICK intestinal cell kinase 1 1
MIRT027300 MTSS1L MTSS1L, I-BAR domain containing 1 1
MIRT027301 ZBTB21 zinc finger and BTB domain containing 21 1 1
MIRT027302 ARID5B AT-rich interaction domain 5B 1 1
MIRT027303 ABHD17C abhydrolase domain containing 17C 1 1
MIRT027304 MRGBP MRG domain binding protein 1 1
MIRT027305 MOB4 MOB family member 4, phocein 2 2
MIRT027306 INO80D INO80 complex subunit D 2 4
MIRT027307 MEIS1 Meis homeobox 1 1 1
MIRT027308 DCTD dCMP deaminase 1 1
MIRT027309 KCTD14 potassium channel tetramerization domain containing 14 1 1
MIRT027310 BIRC5 baculoviral IAP repeat containing 5 2 1
MIRT027311 ZCCHC2 zinc finger CCHC-type containing 2 2 5
MIRT027312 RPS6KA5 ribosomal protein S6 kinase A5 1 1
MIRT027313 ACVR2B activin A receptor type 2B 1 1
MIRT027314 MKLN1 muskelin 1 1 1
MIRT027315 MBTD1 mbt domain containing 1 1 1
MIRT027316 AMMECR1L AMMECR1 like 1 1
MIRT027317 KIF2C kinesin family member 2C 1 1
MIRT027318 JUN Jun proto-oncogene, AP-1 transcription factor subunit 1 1
MIRT027319 USP25 ubiquitin specific peptidase 25 1 1
MIRT027320 RARS2 arginyl-tRNA synthetase 2, mitochondrial 1 1
MIRT027321 CD46 CD46 molecule 1 1
MIRT027322 NOP2 NOP2 nucleolar protein 1 1
MIRT027323 LTN1 listerin E3 ubiquitin protein ligase 1 1 1
MIRT027324 FZD6 frizzled class receptor 6 2 8
MIRT027325 VAPA VAMP associated protein A 1 1
MIRT027326 XPO7 exportin 7 1 1
MIRT027327 BTG2 BTG anti-proliferation factor 2 1 1
MIRT027328 MMS22L MMS22 like, DNA repair protein 1 1
MIRT027329 FOXP4 forkhead box P4 1 1
MIRT027330 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT027331 SPATA2 spermatogenesis associated 2 2 6
MIRT027332 FBXO11 F-box protein 11 1 1
MIRT027333 RNF44 ring finger protein 44 1 1
MIRT027334 E2F3 E2F transcription factor 3 1 1
MIRT027335 LMNB1 lamin B1 1 1
MIRT027336 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 6
MIRT027337 HOXA9 homeobox A9 1 1
MIRT027338 FAR1 fatty acyl-CoA reductase 1 1 1
MIRT027339 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 2 3
MIRT027340 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT027341 RTN4 reticulon 4 1 1
MIRT027342 ELAVL2 ELAV like RNA binding protein 2 1 1
MIRT027343 CTR9 CTR9 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT027344 CERS2 ceramide synthase 2 1 1
MIRT027345 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT027346 VEZT vezatin, adherens junctions transmembrane protein 1 1
MIRT027347 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT027348 RIOK2 RIO kinase 2 1 1
MIRT027349 CBX4 chromobox 4 1 1
MIRT027350 SEPT11 septin 11 1 1
MIRT027351 QSER1 glutamine and serine rich 1 1 1
MIRT027352 MYO9A myosin IXA 1 1
MIRT027353 CAPN2 calpain 2 1 1
MIRT027354 TFAP4 transcription factor AP-4 2 4
MIRT027355 SSFA2 sperm specific antigen 2 1 1
MIRT027356 TBC1D12 TBC1 domain family member 12 1 1
MIRT027357 SPAG1 sperm associated antigen 1 2 2
MIRT027358 ZNF800 zinc finger protein 800 1 1
MIRT027359 C7orf60 base methyltransferase of 25S rRNA 2 homolog 1 1
MIRT027360 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 1 1
MIRT027361 SPIRE1 spire type actin nucleation factor 1 1 1
MIRT027362 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT027363 TMEM170B transmembrane protein 170B 1 1
MIRT027364 AFF4 AF4/FMR2 family member 4 1 1
MIRT027365 GNB1 G protein subunit beta 1 2 3
MIRT027366 LBR lamin B receptor 1 1
MIRT027367 ZFX zinc finger protein, X-linked 2 5
MIRT027368 KLF12 Kruppel like factor 12 1 1
MIRT027369 PHF3 PHD finger protein 3 2 2
MIRT027370 C1orf52 chromosome 1 open reading frame 52 1 1
MIRT027371 TSPAN12 tetraspanin 12 1 1
MIRT027372 FAM217B family with sequence similarity 217 member B 1 1
MIRT027373 SUB1 SUB1 homolog, transcriptional regulator 2 3
MIRT027374 BCL9 B-cell CLL/lymphoma 9 1 1
MIRT027375 SACM1L SAC1 like phosphatidylinositide phosphatase 1 1
MIRT027376 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 3
MIRT027377 TRERF1 transcriptional regulating factor 1 1 1
MIRT027378 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 1
MIRT027379 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma 1 1
MIRT027380 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT027381 DDIT4 DNA damage inducible transcript 4 1 1
MIRT027382 TGFBR1 transforming growth factor beta receptor 1 5 2
MIRT027383 LRCH2 leucine rich repeats and calponin homology domain containing 2 1 1
MIRT027384 LIFR LIF receptor alpha 1 1
MIRT027385 FBXW7 F-box and WD repeat domain containing 7 4 1
MIRT027386 POU2F1 POU class 2 homeobox 1 2 2
MIRT027387 CBFA2T2 CBFA2/RUNX1 translocation partner 2 1 1
MIRT027388 LCOR ligand dependent nuclear receptor corepressor 2 8
MIRT027389 AEBP2 AE binding protein 2 1 1
MIRT027390 NEK7 NIMA related kinase 7 1 1
MIRT027391 MFSD6 major facilitator superfamily domain containing 6 2 6
MIRT053051 CDH5 cadherin 5 2 1
MIRT053160 ZEB1 zinc finger E-box binding homeobox 1 2 1
MIRT053339 PTGER4 prostaglandin E receptor 4 3 1
MIRT053584 CPEB1 cytoplasmic polyadenylation element binding protein 1 4 1
MIRT054040 MTOR mechanistic target of rapamycin kinase 4 2
MIRT054057 CFTR cystic fibrosis transmembrane conductance regulator 2 1
MIRT054869 KLF6 Kruppel like factor 6 3 2
MIRT054930 ZEB2 zinc finger E-box binding homeobox 2 2 1
MIRT068842 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT082058 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT086535 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT097055 TNPO1 transportin 1 2 2
MIRT102616 UBN2 ubinuclein 2 2 2
MIRT112563 MLEC malectin 2 2
MIRT145022 TNFAIP1 TNF alpha induced protein 1 2 2
MIRT147277 KPNA2 karyopherin subunit alpha 2 2 10
MIRT188232 RAP1B RAP1B, member of RAS oncogene family 3 1
MIRT194216 FAM103A1 family with sequence similarity 103 member A1 2 2
MIRT196792 ZNF207 zinc finger protein 207 2 2
MIRT200053 ZNF431 zinc finger protein 431 2 2
MIRT208757 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT210927 TET2 tet methylcytosine dioxygenase 2 1 1
MIRT211237 FGF2 fibroblast growth factor 2 2 2
MIRT211639 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT218854 CDKN1A cyclin dependent kinase inhibitor 1A 2 4
MIRT218892 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT303303 SNRNP27 small nuclear ribonucleoprotein U4/U6.U5 subunit 27 2 2
MIRT308546 ZNF654 zinc finger protein 654 2 2
MIRT338018 DAZAP2 DAZ associated protein 2 2 2
MIRT379479 JAK2 Janus kinase 2 3 1
MIRT399110 RNF213 ring finger protein 213 2 2
MIRT437858 MET MET proto-oncogene, receptor tyrosine kinase 2 1
MIRT438193 NLK nemo like kinase 1 1
MIRT438717 MITF melanogenesis associated transcription factor 3 1
MIRT444392 ZNF480 zinc finger protein 480 2 2
MIRT449015 ANKRD17 ankyrin repeat domain 17 2 2
MIRT451770 USP36 ubiquitin specific peptidase 36 2 2
MIRT452413 QDPR quinoid dihydropteridine reductase 2 2
MIRT458487 RMI1 RecQ mediated genome instability 1 2 10
MIRT459618 SLC25A33 solute carrier family 25 member 33 2 2
MIRT460768 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 2
MIRT461158 SLC11A2 solute carrier family 11 member 2 2 4
MIRT461268 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 2
MIRT463488 ZC3H11A zinc finger CCCH-type containing 11A 2 12
MIRT465090 TSN translin 2 2
MIRT466390 TGOLN2 trans-golgi network protein 2 2 2
MIRT466406 TGFBR2 transforming growth factor beta receptor 2 2 4
MIRT466804 STYX serine/threonine/tyrosine interacting protein 2 2
MIRT466883 STX16 syntaxin 16 2 2
MIRT467147 SREBF2 sterol regulatory element binding transcription factor 2 2 2
MIRT468154 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT468832 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT469425 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT470123 PSPC1 paraspeckle component 1 2 4
MIRT470274 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 2
MIRT470359 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT470432 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 6
MIRT470518 PPP1CC protein phosphatase 1 catalytic subunit gamma 2 4
MIRT471100 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT471629 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 2
MIRT472408 NCKAP1 NCK associated protein 1 2 2
MIRT472556 NACC1 nucleus accumbens associated 1 2 4
MIRT475275 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT475569 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 4
MIRT476590 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT478914 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT479637 CD81 CD81 molecule 2 2
MIRT479712 CCNF cyclin F 2 2
MIRT480226 C9orf41 carnosine N-methyltransferase 1 2 2
MIRT480283 C8orf4 chromosome 8 open reading frame 4 2 2
MIRT480577 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT480914 BCL2L11 BCL2 like 11 2 2
MIRT481937 ANKRD11 ankyrin repeat domain 11 2 12
MIRT485643 DICER1 dicer 1, ribonuclease III 2 4
MIRT492248 SLC35F5 solute carrier family 35 member F5 2 2
MIRT493269 MAP3K4 mitogen-activated protein kinase kinase kinase 4 2 2
MIRT496253 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT497710 ZNF645 zinc finger protein 645 2 2
MIRT502490 FAM84B family with sequence similarity 84 member B 2 2
MIRT503888 PGBD4 piggyBac transposable element derived 4 2 2
MIRT504261 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT507720 CLIC4 chloride intracellular channel 4 2 4
MIRT512042 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 6
MIRT512876 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 4
MIRT513078 IL20RB interleukin 20 receptor subunit beta 2 6
MIRT513562 FKBP14 FK506 binding protein 14 2 2
MIRT513632 UBE2A ubiquitin conjugating enzyme E2 A 2 4
MIRT513691 RNF111 ring finger protein 111 2 2
MIRT513760 PEX5L peroxisomal biogenesis factor 5 like 2 4
MIRT516746 ZNF100 zinc finger protein 100 2 2
MIRT520784 TBX18 T-box 18 2 4
MIRT521024 SLC30A5 solute carrier family 30 member 5 2 2
MIRT521902 PIAS1 protein inhibitor of activated STAT 1 2 6
MIRT522364 NAP1L1 nucleosome assembly protein 1 like 1 2 6
MIRT523400 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 4
MIRT525712 DCAF12L2 DDB1 and CUL4 associated factor 12 like 2 2 2
MIRT526325 UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus 2 2
MIRT526565 UGT2A2 UDP glucuronosyltransferase family 2 member A2 2 2
MIRT526793 ZNF223 zinc finger protein 223 2 2
MIRT527746 NANOGNB NANOG neighbor homeobox 2 2
MIRT528459 NXT2 nuclear transport factor 2 like export factor 2 2 2
MIRT532825 ZNF827 zinc finger protein 827 2 2
MIRT534604 RORA RAR related orphan receptor A 2 2
MIRT534670 RNF152 ring finger protein 152 2 2
MIRT535722 N4BP1 NEDD4 binding protein 1 2 2
MIRT536332 LEFTY1 left-right determination factor 1 2 2
MIRT536625 IPO7 importin 7 2 2
MIRT537095 GPR135 G protein-coupled receptor 135 2 2
MIRT537901 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 4
MIRT541193 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT545416 SLC39A6 solute carrier family 39 member 6 2 2
MIRT546237 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 2 4
MIRT547360 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT547538 MAML3 mastermind like transcriptional coactivator 3 2 2
MIRT548060 GOLGA7 golgin A7 2 2
MIRT549247 ATXN1L ataxin 1 like 2 4
MIRT551438 ZNF490 zinc finger protein 490 2 4
MIRT552563 ZFP36L2 ZFP36 ring finger protein like 2 2 4
MIRT553238 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT554919 RAP2C RAP2C, member of RAS oncogene family 2 2
MIRT555004 RAB39B RAB39B, member RAS oncogene family 2 2
MIRT555005 RAB33B RAB33B, member RAS oncogene family 2 2
MIRT555110 PURB purine rich element binding protein B 2 2
MIRT555439 NT5C3A 5'-nucleotidase, cytosolic IIIA 2 2
MIRT555536 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555561 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT557624 GLRX5 glutaredoxin 5 2 2
MIRT558189 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 2 4
MIRT558369 DIDO1 death inducer-obliterator 1 2 4
MIRT559235 BICD2 BICD cargo adaptor 2 2 4
MIRT559244 BEND4 BEN domain containing 4 2 2
MIRT561655 RNF219 ring finger protein 219 2 2
MIRT561719 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT562682 AGO4 argonaute 4, RISC catalytic component 2 2
MIRT562889 NACA2 nascent polypeptide associated complex alpha subunit 2 2 2
MIRT563555 KIAA1586 KIAA1586 2 2
MIRT564994 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT565180 TTC37 tetratricopeptide repeat domain 37 2 2
MIRT565943 RREB1 ras responsive element binding protein 1 2 2
MIRT566486 PCCB propionyl-CoA carboxylase beta subunit 2 2
MIRT566865 LRRC1 leucine rich repeat containing 1 2 2
MIRT567244 HSPA13 heat shock protein family A (Hsp70) member 13 2 2
MIRT567291 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 2 2
MIRT570699 FAM69A family with sequence similarity 69 member A 2 2
MIRT570927 ZNF284 zinc finger protein 284 2 2
MIRT571063 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT571646 SIX4 SIX homeobox 4 2 2
MIRT573692 RBM12B RNA binding motif protein 12B 2 2
MIRT574265 ZNF350 zinc finger protein 350 2 2
MIRT574300 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT574584 NACA nascent polypeptide-associated complex alpha subunit 2 2
MIRT574844 CADM1 cell adhesion molecule 1 2 2
MIRT608127 TSC22D2 TSC22 domain family member 2 2 2
MIRT609020 WNT7A Wnt family member 7A 2 4
MIRT618890 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 2
MIRT644803 NKX3-2 NK3 homeobox 2 2 2
MIRT662979 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT668624 EEA1 early endosome antigen 1 2 2
MIRT679150 ZDHHC15 zinc finger DHHC-type containing 15 2 2
MIRT697516 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT701145 PANK1 pantothenate kinase 1 2 2
MIRT704285 DENND5B DENN domain containing 5B 2 2
MIRT704542 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT705741 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT707679 GPR50 G protein-coupled receptor 50 2 2
MIRT710016 KCNQ5 potassium voltage-gated channel subfamily Q member 5 2 2
MIRT731782 PRDM1 PR/SET domain 1 3 1
MIRT732064 VEGFC vascular endothelial growth factor C 3 2
MIRT732470 SKP1 S-phase kinase associated protein 1 1 0
MIRT733128 FN1 fibronectin 1 1 0
MIRT733278 LINC00943 long intergenic non-protein coding RNA 943 2 0
MIRT733919 TRIB1 tribbles pseudokinase 1 3 0
MIRT734457 BCL6 B-cell CLL/lymphoma 6 4 0
MIRT734877 HIF1A hypoxia inducible factor 1 alpha subunit 3 0
MIRT734878 FOXP3 forkhead box P3 3 0
MIRT735315 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 2 0
MIRT735316 ROS1 ROS proto-oncogene 1, receptor tyrosine kinase 2 0
MIRT735656 ETV1 ETS variant 1 3 0
MIRT736117 NFE2L2 nuclear factor, erythroid 2 like 2 3 0
MIRT736402 PRKDC protein kinase, DNA-activated, catalytic polypeptide 3 0
MIRT736516 ANXA2 annexin A2 3 0
MIRT736655 SRRM4 serine/arginine repetitive matrix 4 1 0
MIRT737510 TBR1 T-box, brain 1 3 0
MIRT755331 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT755564 E2F2 E2F transcription factor 2 1 1
MIRT755567 USP47 ubiquitin specific peptidase 47 6 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-101 Cyclosporin A(CsA) approved 5284373 Quantitative real-time PCR human trophoblast (HT) cells 24453045 2014 down-regulated
miR-101 Sodium butyrate NULL 5222465 Quantitative real-time PCR Burkitt lymphoma cells 24577510 2014 up-regulated
miR-101 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-101 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-101 Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-101 Metformin approved 4091 Quantitative real-time PCR pancreatic cancer cells 22086681 2012 up-regulated
miR-101 CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer cells 22108826 2012 up-regulated
miR-101 Progesterone approved 5994 Microarray Breast cancer 22330642 2012 down-regulated
miR-101 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miR-101 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) NULL 47289 Microarray rat lung 18780894 2008 down-regulated
miR-101 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) NULL 47289 Northern blot rat lung 18780894 2008 down-regulated
miR-101 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) NULL 47289 Quantitative real-time PCR rat lung 18780894 2008 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-101-3p -d-xylose 24203222 NSC727221 sensitive
hsa-miR-101-3p (-)-dactylolide 11222845 NSC740028 sensitive
hsa-miR-101-3p (1'R,3'S,3'aS,8'bS)-1',3'-diphenylspiro[1,3-dihydroindene-2,2'-3,3a,4,8b-tetrahydro-1H-cyclopenta[a]indene]-1,4'-diol 385850 NSC677249 sensitive
hsa-miR-101-3p (1,1,3-trioxo-1,2-benzothiazol-2-yl)methyl 4-methylpiperazine-1-carbodithioate 16072473 NSC735181 sensitive
hsa-miR-101-3p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-101-3p (10Z)-10-[bromo(iodo)methylidene]phenanthren-9-one 3005079 NSC670789 sensitive
hsa-miR-101-3p (11r,15s,17s)-17-methyl-14,16-dioxatetracyclo[8.7.0.03,8.011,15]heptadeca-1(10),3,5,7-tetraene-2,9-dione 54611663 NSC722392 sensitive
hsa-miR-101-3p (14r,15r)-15-methyl-14-[(2r)-6-methylheptan-2-yl]-2,7-diazatetracyclo[8.7.0.02,7.011,15]heptadeca-4,9-diene-3,6-dione 54613624 NSC750441 sensitive
hsa-miR-101-3p (1r)-(-)-3-nitromethine-6-endo-acetoxycamphor 3004516 NSC657829 sensitive
hsa-miR-101-3p (1r)-3,3-dibromocamphor 376765 NSC657822 sensitive
hsa-miR-101-3p (1R,12S)-20-[2-(dimethylamino)ethyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene-11,19-dione 45027831 NSC726770 sensitive
hsa-miR-101-3p (1R,4S,5R,8S,12R,13R)-9-[[(E)-4-[[(1R,4S,5R,8S,12R,13R)-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadec-9-en-9-yl]methoxy]but-2-enoxy]methyl]-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3 54612586 NSC724781 sensitive
hsa-miR-101-3p (1R,4S,5R,8S,12R,13R)-9-[2-[[(1R,4S,5R,8S,12R,13R)-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadec-9-en-9-yl]methoxy]ethoxymethyl]-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08 54612640 NSC724780 sensitive
hsa-miR-101-3p (1R,5S,8E)-8-benzylidene-5-(3-hydroxyphenyl)-2-methyl-2-azabicyclo[3.3.1]nonan-7-one;perchloric acid 45489959 NSC678345 sensitive
hsa-miR-101-3p (1s,4s,6s,9r,11r,14r,15r)-14-hydroxy-4,9,14-trimethyl-18-methylidene-5,10,16-trioxatetracyclo[13.3.1.04,6.09,11]nonadecan-17-one 24205276 NSC734913 sensitive
hsa-miR-101-3p (2-methoxyphenyl) (e)-3-(4-methoxyphenyl)prop-2-enoate 5928358 NSC700136 sensitive
hsa-miR-101-3p (2-methoxyphenyl)(naphthalen-2-yl)methanone 246624 NSC59937 sensitive
hsa-miR-101-3p (2-nitrophenyl)methyl (1s,5s,8z,12s,20r)-21-oxa-13-azapentacyclo[10.9.0.01,20.05,20.014,19]henicosa-8,14,16,18-tetraen-6,10-diyne-13-carboxylate 5469103 NSC683252 sensitive
hsa-miR-101-3p (2e)-2-(1,3-benzodioxol-5-ylmethylidene)-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516904 NSC639981 sensitive
hsa-miR-101-3p (2E)-2-[(2-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516827 NSC639520 sensitive
hsa-miR-101-3p (2e)-2-[(4-chloroanilino)methylidene]-3-methyl-1-oxopyrido[1,2-a]benzimidazole-4-carbonitrile 5456998 NSC712423 resistant
hsa-miR-101-3p (2E)-2-[(4-chlorophenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988453 NSC639517 sensitive
hsa-miR-101-3p (2E)-2-[(4-hydroxyphenyl)methylidene]-6-(piperidin-1-ylmethyl)cyclohexan-1-one;hydrochloride 5469353 NSC687002 sensitive
hsa-miR-101-3p (2E)-2-[(6aS)-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-8-ylidene]-N-[5-[[(2E)-2-[(6aS)-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-8-ylidene]acetyl]amino]pentyl]acetamide 5471190 NSC709362 sensitive
hsa-miR-101-3p (2E)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(piperidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54605003 NSC639978 sensitive
hsa-miR-101-3p (2e)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(pyrrolidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608909 NSC639977 sensitive
hsa-miR-101-3p (2E)-2-benzylidene-6-[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 5468410 NSC669732 sensitive
hsa-miR-101-3p (2E)-2-pentylidene-5-(piperidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608096 NSC639501 sensitive
hsa-miR-101-3p (2e,4e,6z,8e)-n-(1,3-benzodioxol-5-yl)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenamide 24202490 NSC672131 sensitive
hsa-miR-101-3p (2E,6E)-2,6-bis[(4-bromophenyl)methylidene]cyclohexan-1-one 5716584 NSC632831 sensitive
hsa-miR-101-3p (2r,13r,17s,18s)-7-(4-fluorophenyl)-2,18-dimethyl-6,7,9-triazapentacyclo[11.7.0.02,10.04,8.014,18]icosa-4(8),5-dien-17-ol 376242 NSC656925 sensitive
hsa-miR-101-3p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 sensitive
hsa-miR-101-3p (2s)-1-[(2-phenylmethoxynaphtho[1,2-f][1,3]benzodioxol-5-yl)methyl]piperidine-2-carboxylic acid 24205345 NSC735209 resistant
hsa-miR-101-3p (2S)-2-[(E,2S)-2-hydroxy-4-oxo-6-phenylhex-5-enyl]-2,3-dihydropyran-6-one 5468230 NSC666388 sensitive
hsa-miR-101-3p (2s)-2-[2,2-bis(4-chlorophenyl)ethyl]-2-(4-chlorophenyl)-1,3-thiazolidin-4-one 402438 NSC716408 sensitive
hsa-miR-101-3p (2z)-2-[(4-hydroxyphenyl)methylidene]-5-methoxy-1-benzofuran-3-one 54613041 NSC747169 sensitive
hsa-miR-101-3p (2z)-2-[(4z)-3-chloro-4-hydroxyiminocyclohexa-2,5-dien-1-ylidene]-2-(4-chlorophenyl)acetonitrile 5715133 NSC102225 sensitive
hsa-miR-101-3p (2z)-5-methoxy-2-[(3-phenacyloxyphenyl)methylidene]-1-benzofuran-3-one 45028682 NSC743694 sensitive
hsa-miR-101-3p (2Z,6Z)-2,6-bis[[3-[(dimethylamino)methyl]-4-hydroxyphenyl]methylidene]cyclohexan-1-one 6067712 NSC683834 sensitive
hsa-miR-101-3p (3-hydroxy-4-methoxyphenyl)-(7-methoxy-1,3-benzodioxol-5-yl)methanone 46949031 NSC758027 sensitive
hsa-miR-101-3p (3,7,7-trimethyl-5,14-dioxo-13-propan-2-yl-4-oxatricyclo[9.4.0.03,8]pentadeca-1(15),8,10,12-tetraen-15-yl) acetate 363975 NSC629595 sensitive
hsa-miR-101-3p (3e)-3-[(2-chloro-1-methylindol-3-yl)methylidene]-1h-indol-2-one 24203155 NSC726904 sensitive
hsa-miR-101-3p (3e)-3-[(2-chloro-1-phenylindol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471471 NSC711611 sensitive
hsa-miR-101-3p (3e)-3-[(2-chloro-5-methoxy-1,6-dimethylindol-3-yl)methylidene]-5-hydroxy-6-methyl-1h-indol-2-one 16738491 NSC734207 sensitive
hsa-miR-101-3p (3e)-3-[(2-chloro-5-methoxy-1h-indol-3-yl)methylidene]-1-phenylindol-2-one 5471475 NSC711615 sensitive
hsa-miR-101-3p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1-methylindol-2-one 24205817 NSC736793 sensitive
hsa-miR-101-3p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471419 NSC711074 sensitive
hsa-miR-101-3p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-5-fluoro-1h-indol-2-one NSC737697 sensitive
hsa-miR-101-3p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-101-3p (3e)-3-[(6-methylimidazo[2,1-b]thiazol-5-yl)methylene]-1,3-dihydro-2h-indol-2-one 10755270 NSC726902 sensitive
hsa-miR-101-3p (3E)-3-[[3-[1-(4-fluorophenyl)sulfonylpiperidin-4-yl]imidazo[1,5-a]pyridin-1-yl]methylidene]-1H-indol-2-one 54613720 NSC750970 resistant
hsa-miR-101-3p (3E)-3-[1-(4-chloroanilino)ethylidene]oxolan-2-one 820318 NSC680781 sensitive
hsa-miR-101-3p (3e)-4-chloro-3-(pyridin-3-ylmethylidene)-1h-indol-2-one 5473204 NSC724435 sensitive
hsa-miR-101-3p (3e)-4-chloro-3-[(6-chloroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471415 NSC711070 resistant
hsa-miR-101-3p (3e)-5-methoxy-3-[(6-phenyl-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471411 NSC711066 sensitive
hsa-miR-101-3p (3e)-7-chloro-4-hydroxy-1-oxido-3-(p-tolylimino)quinoxalin-1-ium-2-carbonitrile 135457335 NSC693867 sensitive
hsa-miR-101-3p (3e)-n'-(4-nitrophenyl)-3-[(4-nitrophenyl)hydrazinylidene]butanehydrazide 6180765 NSC158088 sensitive
hsa-miR-101-3p (3E,5E)-1-acetyl-3,5-dibenzylidenepiperidin-4-one 5387998 NSC630599 sensitive
hsa-miR-101-3p (3E,5E)-3,5-bis[[4-(dimethylamino)phenyl]methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 5386914 NSC618757 sensitive
hsa-miR-101-3p (3E,5Z)-3,5-bis[(3,4-dimethoxyphenyl)methylidene]thian-4-one 6477009 NSC144310 sensitive
hsa-miR-101-3p (3s,5s)-4-benzyl-3,5-bis(2-methoxyphenyl)hexahydro-1h-pyrrolizinium chloride 402114 NSC715973 sensitive
hsa-miR-101-3p (3s,8r,9s,10r,13s,14s,16e)-3-hydroxy-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-17-one 5472098 NSC716261 resistant
hsa-miR-101-3p (3z)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-5-hydroxy-1-methylindol-2-one 24205836 NSC736818 sensitive
hsa-miR-101-3p (3Z)-3-[(3-nitrophenyl)methylidene]chromen-4-one 1550197 NSC646498 sensitive
hsa-miR-101-3p (3z)-3-[[3-[2-(4-chlorophenyl)-2-oxoethoxy]phenyl]methylidene]-6-methylthiochromen-4-one 45028771 NSC744076 sensitive
hsa-miR-101-3p (3z)-3-[[3-[2-(4-methoxyphenyl)-2-oxoethoxy]phenyl]methylidene]-6-methylthiochromen-4-one 45028770 NSC744075 sensitive
hsa-miR-101-3p (3z)-5-chloro-3-[(2,6-dimethylimidazo[2,1-b][1,3,4]thiadiazol-5-yl)methylidene]-1h-indol-2-one 24205825 NSC736807 sensitive
hsa-miR-101-3p (3z)-5-hydroxy-3-[(3,4,5-trimethoxyphenyl)methylidene]-1h-indol-2-one 24205822 NSC736802 sensitive
hsa-miR-101-3p (3Z,5E)-3,5-bis[(4-methoxyphenyl)methylidene]piperidin-4-one 6477975 NSC632840 sensitive
hsa-miR-101-3p (3Z,5Z)-1,1-dimethyl-3,5-bis[(E)-3-phenylprop-2-enylidene]piperidin-1-ium-4-one 6334460 NSC636679 sensitive
hsa-miR-101-3p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-101-3p (3Z,8R,9S,10R,13S,14S,17R)-17-ethynyl-10,13-dimethyl-3-(2-pyrrolidin-1-ylethoxyimino)-2,6,7,8,9,11,12,14,15,16-decahydro-1H-cyclopenta[a]phenanthren-17-ol 6520040 NSC701574 sensitive
hsa-miR-101-3p (4-methoxyphenyl)-(3,4,5-trimethoxyphenyl)methanol 368140 NSC638483 sensitive
hsa-miR-101-3p (4-methoxyphenyl)(2,3,4-trimethoxyphenyl)methanone 240478 NSC46683 sensitive
hsa-miR-101-3p (4-methylphenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388005 NSC630606 sensitive
hsa-miR-101-3p (4-nitrophenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388007 NSC630608 sensitive
hsa-miR-101-3p (4,4,11,11-tetramethyl-3,5,7,10,12-pentaoxatricyclo[7.3.0.02,6]dodecan-8-yl)methyl 2,2-diphenylacetate 359628 NSC620687 sensitive
hsa-miR-101-3p (4aR,9aR)-9-(4-methylphenyl)sulfonyl-3,4,4a,9a-tetrahydrocarbazole 372866 NSC648556 sensitive
hsa-miR-101-3p (4bS,9bS)-4b,9b-dimethyl-[1]benzoselenolo[3,2-b][1]benzoselenole 370235 NSC643004 sensitive
hsa-miR-101-3p (4e)-2-hydroxy-4-[hydroxy(phenyl)methylidene]-1,5-bis(4-methoxyphenyl)-2-phenacylpyrrolidin-3-one 5471002 NSC707085 sensitive
hsa-miR-101-3p (4e)-4-[(4-chlorophenyl)imino]-1,5-diphenylpyrrolidin-2-one 403390 NSC718191 sensitive
hsa-miR-101-3p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 resistant
hsa-miR-101-3p (4S,5R)-4-(2-methylpropyl)-3-[(1R)-1-phenylethyl]-5-phenylmethoxyoxathiazinane 2,2-dioxide 390837 NSC688895 sensitive
hsa-miR-101-3p (4s,8s,12s,16s)-4,8,12,16-tetrabenzyl-1,9-bis(prop-2-enyl)-1,5,9,13-tetrazacyclohexadecane-2,6,10,14-tetrone 403842 NSC719376 sensitive
hsa-miR-101-3p (4Z)-4-[[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]methylidene]-5-imino-1-phenylpyrazol-3-amine 135276800 NSC763587 sensitive
hsa-miR-101-3p (4z,5z)-1-[(e)-(2-hydroxyphenyl)methyleneamino]-3-phenyl-4,5-bis(phenylimino)imidazolidine-2-thione 135509182 NSC671409 resistant
hsa-miR-101-3p (4Z,9Z,14Z)-2,2,7,7,12,12,17,17-octamethyl-21-oxabicyclo[16.2.1]henicosa-1(20),4,9,14,18-pentaene-3,6,8,11,13,16-hexone 5387611 NSC625154 sensitive
hsa-miR-101-3p (5,7-dibromo-8-hydroxy-3-methyl-2-quinolinyl)(phenyl)methanone 370210 NSC642954 sensitive
hsa-miR-101-3p (5ar,6r,8ar)-6-(1,5-dimethylhexyl)-5a-methyl-2,3,4,5,6,7,8,8a-octahydro-1h-cyclopenta[b]azepine 403828 NSC719362 sensitive
hsa-miR-101-3p (5E)-2-(morpholin-4-ylmethyl)-5-nonylidenecyclopentan-1-one;hydrochloride 54612513 NSC639505 sensitive
hsa-miR-101-3p (5E)-2-[(4-chloroanilino)methyl]-5-[(4-hydroxyphenyl)methylidene]cyclopentan-1-one 5930524 NSC639541 sensitive
hsa-miR-101-3p (5e)-2-[(4-ethoxyanilino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one 5915890 NSC639539 sensitive
hsa-miR-101-3p (5e)-2-[(4-methylphenoxy)methyl]-5-[(5-nitrofuran-2-yl)methylidene]-1,3a-dihydro-[1,3]thiazolo[3,2-b][1,2,4]triazol-6-one 5471975 NSC715682 sensitive
hsa-miR-101-3p (5E)-2-[(dimethylamino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 5387758 NSC626874 sensitive
hsa-miR-101-3p (5E)-2-[(dimethylamino)methyl]-5-[(4-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 21141935 NSC639511 sensitive
hsa-miR-101-3p (5E)-2-[(dimethylamino)methyl]-5-heptylidenecyclopentan-1-one;hydrochloride 5387764 NSC626879 sensitive
hsa-miR-101-3p (5E)-3-(4-chlorophenyl)-1,1-dioxo-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]-1,3-thiazolidin-4-one 5470264 NSC699092 sensitive
hsa-miR-101-3p (5e)-3-benzyl-5-benzylidene-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470510 NSC702359 sensitive
hsa-miR-101-3p (5e)-5-[(3,4-dimethoxyphenyl)methylidene]-3-phenyl-2-propylimino-1,3-thiazolidin-4-one 5471348 NSC710598 resistant
hsa-miR-101-3p (5e)-5-[[(5e)-5-[[5-[(z)-(4,4-dimethyl-5-oxopyrrolidin-2-ylidene)methyl]-4,4-dimethylpyrrol-2-yl]methylidene]-4,4-dimethyl-1-(trifluoromethylsulfonyl)pyrrol-2-yl]methylidene]-2,4,4-trimethyl-1-(triflu 5471912 NSC715335 sensitive
hsa-miR-101-3p (5E,6Z)-5,6-bis[(6,8-dibromoquinazolin-4-yl)hydrazinylidene]hexane-1,2,3,4-tetrol 54611942 NSC716034 sensitive
hsa-miR-101-3p (5r,6s)-5-phenyl-3,4-diazatricyclo[8.4.0.02,6]tetradeca-1(14),2,10,12-tetraene-4-carbothioamide 5467466 NSC652809 sensitive
hsa-miR-101-3p (5z)-3-(4,7-dimethoxy-1,3-benzothiazol-2-yl)-5-[[4-(dimethylamino)phenyl]methylidene]-2-phenylimidazol-4-one 1273997 NSC711830 sensitive
hsa-miR-101-3p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-101-3p (6-acetamido-7-methyl-5,8-dioxo-2,3-dihydro-1H-pyrrolo[1,2-a]benzimidazol-3-yl) 2-methoxyacetate 374010 NSC651084 sensitive
hsa-miR-101-3p (6,6-dibromo-5-oxo-8,9-dihydro-7H-benzo[7]annulen-4-yl) acetate 361590 NSC624771 sensitive
hsa-miR-101-3p (6aS)-3-[5-[4-(2-diethoxyphosphorylethyl)piperazin-1-yl]pentoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 25113728 NSC744025 sensitive
hsa-miR-101-3p (6E)-2-[(dimethylamino)methyl]-6-[(4-methoxyphenyl)methylidene]cyclohexan-1-one;hydrochloride 5468453 NSC670687 sensitive
hsa-miR-101-3p (6Z)-6-[(2-methoxyphenyl)methylidene]-3-(3-nitrophenyl)-[1,3]thiazolo[2,3-b][1,3]thiazol-4-ium-5-one 5847653 NSC657446 sensitive
hsa-miR-101-3p (6Z,10E)-5-hydroxy-6-methyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-10-carbaldehyde 6477353 NSC645998 sensitive
hsa-miR-101-3p (7ar)-1,6-bis(4-methoxyphenyl)-7a-phenyltetrahydroimidazo[1,5-b][1,2,4]oxadiazol-2(1h)-one 402882 NSC717189 sensitive
hsa-miR-101-3p (7E)-6-(methoxymethoxy)-2-methylcyclododec-7-en-3-yn-1-one 5467712 NSC658114 sensitive
hsa-miR-101-3p (7E)-7-benzylidene-2-chloro-5,6-dihydroquinolin-8-one 5470385 NSC700549 sensitive
hsa-miR-101-3p (7z)-6-(4-methoxyphenyl)-3-methyl-7-[[5-(4-nitrophenyl)furan-2-yl]methylidene]-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine 5471358 NSC710779 sensitive
hsa-miR-101-3p (8r,9s,10r,13s,14s,16e)-10,13-dimethyl-16-[(3,4,5-trimethoxyphenyl)methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 5470702 NSC704614 sensitive
hsa-miR-101-3p (8r,9s,10r,13s,14s,16e)-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 5472100 NSC716263 sensitive
hsa-miR-101-3p (8R,9S,10R,13S,14S,16E)-10,13-dimethyl-16-[[3-(2-morpholin-4-ylethoxy)phenyl]methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 24205793 NSC736753 sensitive
hsa-miR-101-3p (8R,9S,13S,14S,16E)-3-hydroxy-13-methyl-16-(pyridin-4-ylmethylidene)-6,7,8,9,11,12,14,15-octahydrocyclopenta[a]phenanthren-17-one 5470644 NSC703823 sensitive
hsa-miR-101-3p (8R,9S,13S,14S,17S)-13-methyl-2-(2,2,2-trifluoroethoxy)-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthrene-3,17-diol 386444 NSC678473 sensitive
hsa-miR-101-3p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 sensitive
hsa-miR-101-3p (8S,9S,10R,13S,14S,17S)-10,13-dimethyl-17-(2-methyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 259211 NSC88916 sensitive
hsa-miR-101-3p (9,10-dioxoanthracen-2-yl)methyl 3-benzamido-2-hydroxy-3-phenylpropanoate 361915 NSC625350 resistant
hsa-miR-101-3p (e)-1-(1,2-dihydroacenaphthylen-5-yl)-3-(4-nitrophenyl)prop-2-en-1-one 6167610 NSC746353 sensitive
hsa-miR-101-3p (e)-1-(1h-benzimidazol-2-yl)-3-(4-methylsulfanylphenyl)prop-2-en-1-one 5472117 NSC716334 sensitive
hsa-miR-101-3p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-101-3p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-(3,4-dimethoxyphenyl)prop-2-en-1-one 5471156 NSC709100 sensitive
hsa-miR-101-3p (E)-1-(7-fluoro-3-methylquinoxalin-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45029310 NSC746087 sensitive
hsa-miR-101-3p (E)-1-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54612660 NSC741738 resistant
hsa-miR-101-3p (e)-1-[(4r,5r)-1,3-dibenzyl-2-oxo-4,5-diphenyl-1,3,2lambda5-diazaphospholidin-2-yl]-3-phenylprop-2-en-1-ol 5470796 NSC705149 sensitive
hsa-miR-101-3p (E)-1-[1-ethyl-4-hydroxy-1-methyl-4-[(E)-2-phenylethenyl]piperidin-1-ium-3-yl]-3-phenylprop-2-en-1-one;bromide 5386939 NSC618770 sensitive
hsa-miR-101-3p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 sensitive
hsa-miR-101-3p (E)-1-[4-[(E)-4,4-dimethyl-3-oxo-5-piperidin-1-ylpent-1-enyl]phenyl]-4,4-dimethyl-5-piperidin-1-ylpent-1-en-3-one;hydrobromide 5386918 NSC618759 sensitive
hsa-miR-101-3p (e)-1-[4-[[4-(4-chloroanilino)-6-(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-[4-(dimethylamino)phenyl]prop-2-en-1-one 45028715 NSC743884 sensitive
hsa-miR-101-3p (e)-1-[4-[[4-anilino-6-(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613477 NSC749379 sensitive
hsa-miR-101-3p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(2-methoxyphenyl)prop-2-en-1-one 24205906 NSC737225 sensitive
hsa-miR-101-3p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 24205912 NSC737231 sensitive
hsa-miR-101-3p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(4-methoxyphenyl)prop-2-en-1-one 24205905 NSC737224 sensitive
hsa-miR-101-3p (e)-2-(benzenesulfonyl)-1-phenyl-3-(2-phenyl-1h-indol-3-yl)prop-2-en-1-one NSC749025 sensitive
hsa-miR-101-3p (e)-2-[4-amino-6-(3,5,5-trimethyl-4h-pyrazol-1-yl)-1,3,5-triazin-2-yl]-3-[4-(diethylamino)phenyl]prop-2-enenitrile 6175750 NSC696923 resistant
hsa-miR-101-3p (e)-3-(1,3-benzodioxol-5-yl)-1-(3,5-ditert-butyl-4-hydroxyphenyl)prop-2-en-1-one 5471158 NSC709102 sensitive
hsa-miR-101-3p (E)-3-(2-nitrophenyl)-1-(3,6,7-trimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)prop-2-en-1-one 5351352 NSC621486 resistant
hsa-miR-101-3p (E)-3-(3,4-dihydroxyphenyl)-N-[(13S)-3-methoxy-13-methyl-8,9,11,12,14,15,16,17-octahydrocyclopenta[a]phenanthren-17-yl]prop-2-enamide 24205536 NSC736118 sensitive
hsa-miR-101-3p (E)-3-(3,4-dimethoxyphenyl)-1-[6-[(E)-3-(3,4-dimethoxyphenyl)prop-2-enoyl]pyridin-2-yl]prop-2-en-1-one 5470456 NSC702045 sensitive
hsa-miR-101-3p (E)-3-(4-chlorophenyl)-1-[4-[(E)-2-(4-chlorophenyl)ethenyl]-1-ethyl-4-hydroxy-1-methylpiperidin-1-ium-3-yl]prop-2-en-1-one;iodide 5469649 NSC691276 sensitive
hsa-miR-101-3p (e)-3-(4-hydroxyphenyl)-1-[5-methyl-1-[8-(trifluoromethyl)quinolin-4-yl]triazol-4-yl]prop-2-en-1-one NSC736153 sensitive
hsa-miR-101-3p (E)-3-(4-methoxyphenyl)-2-(4-oxo-3H-quinazolin-2-yl)prop-2-enenitrile 135454458 NSC684969 resistant
hsa-miR-101-3p (E)-3-[4-(dimethylamino)phenyl]-1-(4-hydroxyphenyl)prop-2-en-1-one 5468166 NSC665694 sensitive
hsa-miR-101-3p (e)-3-[4-[2-oxo-2-(4-phenylpiperazin-1-yl)ethoxy]phenyl]-1-phenyl-prop-2-en-1-one 5466903 NSC645389 sensitive
hsa-miR-101-3p (E)-3-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]-N-(4-chlorophenyl)-2-[[(E)-3-phenylprop-2-enoyl]amino]prop-2-enamide 5920449 NSC645665 sensitive
hsa-miR-101-3p (e)-3-chloro-2-(4-fluorophenyl)-3-(4-methoxyphenyl)prop-2-enal 5387394 NSC623173 sensitive
hsa-miR-101-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 sensitive
hsa-miR-101-3p (E)-5-(diethylamino)-1-[4-[(E)-5-(diethylamino)-4,4-dimethyl-3-oxopent-1-enyl]phenyl]-4,4-dimethylpent-1-en-3-one 5916501 NSC602066 sensitive
hsa-miR-101-3p (e)-5-(diethylamino)-1-phenylpent-1-en-3-one;hydrochloride 6519127 NSC678343 sensitive
hsa-miR-101-3p (e)-but-2-enedioic acid;1-(7,8,9,10-tetrahydrophenanthridin-6-yl)piperidin-4-amine 5471308 NSC710333 sensitive
hsa-miR-101-3p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-methylphenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351426 NSC670225 sensitive
hsa-miR-101-3p (E)-N-[[(17S)-3,17-dihydroxy-13-methyl-7,8,9,11,12,14,15,16-octahydro-6H-cyclopenta[a]phenanthren-17-yl]methyl]-3-(4-hydroxy-3-methoxyphenyl)prop-2-enamide 24205473 NSC735946 sensitive
hsa-miR-101-3p (r,r)-diop 122582 NSC699412 sensitive
hsa-miR-101-3p (z)-(5-bromo-2-oxo-1h-indol-3-ylidene)sulfamic acid 135505239 NSC707054 sensitive
hsa-miR-101-3p (z)-[cyclohexyl-(4-methoxyphenyl)methyl]-methoxycarbonylimino-oxido-ammonium 9556322 NSC692597 sensitive
hsa-miR-101-3p (z)-1-iodo-2-phenyl-1-penten-3-one 5468684 NSC674455 sensitive
hsa-miR-101-3p (Z)-3-(benzenesulfinyl)-N-benzyl-N-tert-butylprop-2-enamide 5470812 NSC705331 sensitive
hsa-miR-101-3p (z)-3-iodo-1,2-diphenyl-2-propen-1-one 5468683 NSC674454 sensitive
hsa-miR-101-3p (z)-n-(1,3-benzodioxol-5-ylmethyl)-n-tert-butyl-3-phenylsulfanylprop-2-enamide 5470808 NSC705327 sensitive
hsa-miR-101-3p (z) 2',3,4,5-tetramethoxystilbene 5388740 NSC638390 sensitive
hsa-miR-101-3p .beta.-phenylethyl 2,4,5-trihydroxycinnamate 5933247 NSC666592 sensitive
hsa-miR-101-3p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 sensitive
hsa-miR-101-3p [(1e,3e)-4-(benzenesulfonyl)buta-1,3-dienyl]sulfinylbenzene 5468034 NSC662784 sensitive
hsa-miR-101-3p [(1h-benzimidazole-2-yl)dithio]-9h-purine 54613148 NSC750485 sensitive
hsa-miR-101-3p [(1r,2r,3r,4r,6r,8s,9e,12s,13s,14r,15s)-3,4,6,12,13-pentaacetyloxy-4,8,11,11-tetramethyl-14-(2-methylpropoxy)-7,18-dioxo-19-oxatricyclo[13.4.0.02,6]nonadec-9-en-15-yl] benzoate 5469441 NSC688228 sensitive
hsa-miR-101-3p [(1R,2S,10S,13S,14R)-7-(4-fluorophenyl)-10,14-dimethyl-6,7,9-triazapentacyclo[11.8.0.02,10.04,8.014,19]henicosa-4(8),5,19-trien-17-yl] acetate 392371 NSC692655 sensitive
hsa-miR-101-3p [(1R,2S,6R,9Z)-9-(acetyloxymethyl)-4-(hydroxymethyl)-14-methylidene-13-oxo-5,12-dioxatricyclo[9.3.0.04,6]tetradec-9-en-2-yl] 2-methylprop-2-enoate 5468206 NSC666113 sensitive
hsa-miR-101-3p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-1,9-dihydroxy-15-[(2r,3s)-2-hydroxy-3-(3-methylbutanoylamino)-3-phenylpropanoyl]oxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]h 6712271 NSC664404 sensitive
hsa-miR-101-3p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-(cyclohexanecarbonylamino)-3-cyclohexyl-2-hydroxypropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10 383477 NSC671869 sensitive
hsa-miR-101-3p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-benzamido-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en- 384061 NSC673186 sensitive
hsa-miR-101-3p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-benzamido-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en- 384061 NSC673186 sensitive
hsa-miR-101-3p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(2r,3s)-3-benzamido-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en- 384061 NSC673186 sensitive
hsa-miR-101-3p [(1s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-15-[(3s)-3-(3,3-dimethylbutanoylamino)-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]hep 6712270 NSC664403 sensitive
hsa-miR-101-3p [(1s,4r,5r,6r,7s,8r,11r,13s,17s,18s,19r)-4,5,17-trihydroxy-6,14,18-trimethyl-9,16-dioxo-3,10-dioxapentacyclo[9.8.0.01,7.04,19.013,18]nonadec-14-en-8-yl] 3-hydroxy-2,2-dimethylpropanoate 390662 NSC688274 sensitive
hsa-miR-101-3p [(1S,4S,5R,9R,10S,12R)-1,5,9-trimethyl-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadecan-10-yl] 4-[2-[[2-[7-(dimethylamino)-2-oxochromen-4-yl]acetyl]amino]ethylamino]-4-oxobutanoate 155812944 NSC754329 sensitive
hsa-miR-101-3p [(1s,4s,7r,10s,12r)-4-acetyloxy-15-[(3s)-3-(hexanoylamino)-2-hydroxy-3-phenylpropanoyl]oxy-1,12-dihydroxy-10,14,17,17-tetramethyl-11-oxo-9-(3,4,5-trihydroxyoxan-2-yl)oxy-6-oxatetracyclo[11.3.1.03,10.0 6712194 NSC658831 sensitive
hsa-miR-101-3p [(1s,4s,7r,9s,10s,12r)-4,12-diacetyloxy-15-[3-[(3-chlorobenzoyl)amino]-2-hydroxy-3-phenylpropanoyl]oxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-2-y 6712240 NSC662158 sensitive
hsa-miR-101-3p [(3aR,4S,6Z,11aS)-11-acetyloxy-6-(hydroxymethyl)-3,10-dimethylidene-2-oxo-4,5,8,9,11,11a-hexahydro-3aH-cyclodeca[b]furan-4-yl] 2-methylprop-2-enoate 5468207 NSC666114 sensitive
hsa-miR-101-3p [(3aR,6S)-6-(acetyloxymethyl)-9-methyl-3-methylidene-2-oxo-3a,4,5,6,6a,7,9a,9b-octahydroazuleno[4,5-b]furan-4-yl] 2-methylprop-2-enoate 380497 NSC666112 sensitive
hsa-miR-101-3p [(3S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-4,5-dioxo-3-(1-phenylprop-2-enyl)oxolan-3-yl] acetate 386050 NSC677617 sensitive
hsa-miR-101-3p [(3s,8r,9s,10r,13s,14s,16e)-16-(1-acetyloxy-2,2,2-trifluoroethylidene)-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 5351782 NSC45238 sensitive
hsa-miR-101-3p [(3s,8r,9s,10r,13s,14s,16e,17e)-16-[(3,4-dimethoxyphenyl)methylidene]-17-hydroxyimino-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 9572442 NSC716258 sensitive
hsa-miR-101-3p [(3S,8R,9S,10R,13S,14S,16E,17S)-17-acetyloxy-10,13-dimethyl-16-[[3-(2-morpholin-4-ylethoxy)phenyl]methylidene]-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthren-3-yl] acetate 24205801 NSC736761 sensitive
hsa-miR-101-3p [(4S,5R,6S)-4-[(3,4-dimethoxyphenyl)methyl]-6-(2,2-diphenylcyclopentyl)oxy-4-ethyl-2-oxido-5,6-dihydrooxazin-2-ium-5-yl] benzoate 395287 NSC699767 sensitive
hsa-miR-101-3p [(6z)-1-thiacyclodec-6-en-3,8-diyn-5-yl] 9,10-dioxoanthracene-2-carboxylate 5468578 NSC671898 resistant
hsa-miR-101-3p [(6Z,10Z)-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (Z)-4-hydroxy-2-(hydroxymethyl)but-2-enoate 6477984 NSC659936 sensitive
hsa-miR-101-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 sensitive
hsa-miR-101-3p [(E)-1-chlorobutylideneamino] N-[4-(trifluoromethoxy)phenyl]carbamate 5466270 NSC682840 sensitive
hsa-miR-101-3p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(4-bromophenyl)carbamate 9556248 NSC682825 sensitive
hsa-miR-101-3p [(z)-[2-[[6-[[2-[(z)-(carbamothioylhydrazinylidene)methyl]phenoxy]methyl]pyridin-2-yl]methoxy]phenyl]methylideneamino]thiourea 54611756 NSC715648 resistant
hsa-miR-101-3p [(z)-[2-[[6-[[2-[(z)-(carbamoylhydrazinylidene)methyl]phenoxy]methyl]pyridin-2-yl]methoxy]phenyl]methylideneamino]urea 54604867 NSC714407 resistant
hsa-miR-101-3p [(Z)-2-(2,2-diphenylcyclopentyl)oxyethenyl] benzoate 3005428 NSC699766 sensitive
hsa-miR-101-3p [1-(benzenesulfonyloxy)-4,13-dimethyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] acetate 386755 NSC679434 sensitive
hsa-miR-101-3p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]methanol 9572565 NSC720255 sensitive
hsa-miR-101-3p [1-[[[2-amino-6-chloro-5-[(E)-hydroxyiminomethyl]pyrimidin-4-yl]amino]methyl]cyclobutyl]methanol 5468789 NSC676372 sensitive
hsa-miR-101-3p [1-benzyl-3,4,5-tris(phenylmethoxy)piperidin-2-yl]methanol 364050 NSC629676 sensitive
hsa-miR-101-3p [1,1,1,3,3,3-hexafluoro-2-(quinolin-2-ylmethyl)propan-2-yl] acetate 379602 NSC664303 sensitive
hsa-miR-101-3p [2-(4-methoxyphenyl)-4-thioxo-quinazolin-3-yl] acetate 389393 NSC685459 sensitive
hsa-miR-101-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper; 2-(2-pyridyl)pyridine 135484845 NSC638302 sensitive
hsa-miR-101-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]copper; pyridine 135484832 NSC638287 sensitive
hsa-miR-101-3p [2,6-bis[(z)-2-(4-methoxyphenyl)-1-phenylethenyl]-3,5-dimethylphenyl]-(3,5-dimethylphenyl)diazene 5471486 NSC711661 sensitive
hsa-miR-101-3p [2,6-dimethoxy-4-(7-methyl-6-morpholin-4-yl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)phenyl] acetate 383125 NSC671166 sensitive
hsa-miR-101-3p [3-(4-fluorophenyl)-8,9-dimethyl-2-oxo-5H-pyrano[3,2-c]chromen-5-yl] acetate 45113107 NSC747825 sensitive
hsa-miR-101-3p [3-(chloromethyl)indolin-1-yl]-(5,6,7-trimethoxy-1h-indol-2-yl)methanone 393954 NSC696990 sensitive
hsa-miR-101-3p [3-(furan-2-carbonyl)-2-thioxo-imidazolidin-1-yl]-(2-furyl)methanone 396757 NSC703467 sensitive
hsa-miR-101-3p [3-[(3E,5E)-3,5-dibenzylidene-4-oxopiperidin-1-yl]-3-oxopropyl]-trimethylazanium;bromide 5388801 NSC638635 sensitive
hsa-miR-101-3p [3-keto-bmt(sup 1)]-[val(sup 2)]-cyclosporin 5467197 NSC648265 sensitive
hsa-miR-101-3p [3,4,5-triacetyloxy-6-(1-cyano-2-sulfanylidene-4-thiophen-2-yl-5,6-dihydrobenzo[f]isoquinolin-3-yl)oxan-2-yl]methyl acetate 386291 NSC678049 sensitive
hsa-miR-101-3p [3,4,5-triacetyloxy-6-(5-cyano-2,4-dimethyl-3-phenyldiazenyl-6-sulfanylidenepyridin-1-yl)oxan-2-yl]methyl acetate 381286 NSC667722 resistant
hsa-miR-101-3p [3,4,5-triacetyloxy-6-[(e)-2-(azidomethyl)-3-oxobut-1-enoxy]oxan-2-yl]methyl acetate 5471355 NSC710716 sensitive
hsa-miR-101-3p [3,4,5-triacetyloxy-6-[4-(4-chlorophenyl)-3-cyano-7,7-dimethyl-5-oxo-2-sulfanylidene-6,8-dihydroquinolin-1-yl]oxan-2-yl]methyl acetate 385412 NSC676591 sensitive
hsa-miR-101-3p [3,4,5-triacetyloxy-6-[5-[(2-methoxyphenyl)methyl]-3-phenyl-6-sulfanylidene-1,2,4-triazin-1-yl]oxan-2-yl]methyl acetate 362262 NSC625873 resistant
hsa-miR-101-3p [3,4,5-triacetyloxy-6-[6-(4-chlorophenyl)-3-cyano-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 386296 NSC678057 resistant
hsa-miR-101-3p [4-(4-aminophenyl)sulfonylphenyl]-[4-(4-aminophenyl)sulfonylphenyl]imino-oxidoazanium 380146 NSC665549 resistant
hsa-miR-101-3p [4-(4-nitrophenyl)piperazin-1-yl]-(3,6,7-trimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)methanone 404496 NSC720732 resistant
hsa-miR-101-3p [4-(6-aminopurin-9-yl)cyclopent-2-en-1-yl]methyl sulfamate 379793 NSC664885 sensitive
hsa-miR-101-3p [4-[(E)-[3-[(dimethylamino)methyl]-2-oxocyclohexylidene]methyl]phenyl] (E)-3-(4-chlorophenyl)prop-2-enoate 6036088 NSC693442 sensitive
hsa-miR-101-3p [4-[(e)-[3-[(dimethylamino)methyl]-2-oxocyclohexylidene]methyl]phenyl] 4-chlorobenzoate;hydrochloride 5470076 NSC697444 sensitive
hsa-miR-101-3p [4-[(E)-[3-[(dimethylamino)methyl]-2-oxocyclopentylidene]methyl]-2-methoxyphenyl] benzoate;hydrochloride 6516825 NSC639518 sensitive
hsa-miR-101-3p [4-[[2-(1h-indol-2-yl)-1,3-dioxolan-2-yl]methyl]-1-piperidyl]-phenyl-methanone 398268 NSC707982 sensitive
hsa-miR-101-3p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(2-thienyl)methanone 399019 NSC709440 resistant
hsa-miR-101-3p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(4-methoxyphenyl)methanone 399621 NSC710530 sensitive
hsa-miR-101-3p [4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-phenylmethanone 405497 NSC722854 sensitive
hsa-miR-101-3p [5-(n-[(z)-n-(dimethylcarbamothioyl)-c-methylsulfanylcarbonimidoyl]anilino)-1,2,4-dithiazol-3-ylidene]-dimethylazanium;iodide 9569862 NSC622588 sensitive
hsa-miR-101-3p [6-methoxy-3,4-bis-(4-methylphenyl)sulfonyloxyoxan-2-yl]methyl 4-methylbenzenesulfonate 359615 NSC620674 resistant
hsa-miR-101-3p [6,7-difluoro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-phenylmethanone 406024 NSC723906 sensitive
hsa-miR-101-3p [7-(phosphonomethyl)-1,4,7,10-tetrazacyclododec-1-yl]methylphosphonic acid;hydrochloride 387350 NSC681104 sensitive
hsa-miR-101-3p [7-benzyl-6-bromo-2,4-bis(methylsulfanyl)pyrrolo[2,3-d]pyrimidin-5-yl]methanol 357482 NSC616511 resistant
hsa-miR-101-3p [7-fluoro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-(furan-2-yl)methanone 23635646 NSC736443 sensitive
hsa-miR-101-3p [7,8-dichloro-1-methyl-2-(phenylcarbamoyloxymethyl)benzo[g]indol-3-yl]methyl n-phenylcarbamate 388469 NSC683405 sensitive
hsa-miR-101-3p [bis(aminomethyl)diethylsilane]dichloroplatinum (ii) NSC645351 sensitive
hsa-miR-101-3p {3-[(4-benzyloxycarbonylamino-butyl)-tert-butoxycarbonyl-amino]-propyl}-carbamic acid benzyl ester NSC685964 sensitive
hsa-miR-101-3p 1',3',9-trihydroxy-6'-methoxy-3-pentylspiro[6,7-dihydro-2h-cyclopenta[g]isoquinoline-8,2'-cyclopenta[b]naphthalene]-1,4',5',8',9'-pentone 135489797 NSC676769 sensitive
hsa-miR-101-3p 1-((4-methylene-5-oxo-2-phenyltetrahydro-2-furanyl)methyl)dihydro-2,4(1h,3h)-pyrimidinedione 381497 NSC668253 sensitive
hsa-miR-101-3p 1-(1-adamantyl)-3-(1-methylbenzimidazol-2-yl)urea 374147 NSC651604 resistant
hsa-miR-101-3p 1-(1-naphthylmethyl)-4-[1-(1-naphthylmethyl)-4-piperidyl]piperidine 364095 NSC629736 sensitive
hsa-miR-101-3p 1-(1-naphthylmethylene)-4-(1-naphthyl)semicarbazide 5859414 NSC680931 sensitive
hsa-miR-101-3p 1-(11,12,13,14-tetrachloro-17,17-dimethoxy-4-pentacyclo[7.6.1.111,14.05,16.010,15]heptadeca-1(16),2,4,6,8,12-hexaenyl)ethanone 363066 NSC627618 sensitive
hsa-miR-101-3p 1-(2-chlorophenyl)-3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]thiourea 5465914 NSC668323 sensitive
hsa-miR-101-3p 1-(2-chlorophenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5923821 NSC668333 sensitive
hsa-miR-101-3p 1-(2-methoxyphenyl)-3-[(z)-[phenyl(2-pyridyl)methylene]amino]thiourea 5907304 NSC668331 sensitive
hsa-miR-101-3p 1-(2,3,4,5,6-pentafluorobenzoyl)-1,3-dihydro-2h-benzimidazol-2-one 383503 NSC671888 sensitive
hsa-miR-101-3p 1-(3-bromo-phenyl)-3-(pyridin-2-ylsulfanyl)-propenone 24203485 NSC728220 sensitive
hsa-miR-101-3p 1-(3-bromophenyl)-7-methoxy-3,9-dihydro[1,3]thiazolo[4,3-b]quinazoline 400620 NSC712742 sensitive
hsa-miR-101-3p 1-(3-methoxyphenyl)-4-phenyl-[1,2,4]triazolo[4,3-a]quinoxaline 399100 NSC709516 sensitive
hsa-miR-101-3p 1-(4'-phthalimidopropyl-carbonyl)-5-fluorouracil 388985 NSC684405 sensitive
hsa-miR-101-3p 1-(4-((1h-benzimidazol-2-ylmethyl)amino)phenyl)-3-phenyl-2-propen-1-one 6105764 NSC645069 sensitive
hsa-miR-101-3p 1-(4-(trifluoromethyl)phenyl)-3h-[1,3]thiazolo[3,4-a]benzimidazole 362619 NSC626760 sensitive
hsa-miR-101-3p 1-(4-chloronaphthalen-1-yl)-2-(dimethylamino)ethanol 4-methylbenzenesulfonate(1:1) 230791 NSC26074 sensitive
hsa-miR-101-3p 1-(4-chlorophenyl)-1'-methyl-3,3-diphenylspiro[azetidine-4,3'-indole]-2,2'-dione 16096361 NSC737780 sensitive
hsa-miR-101-3p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 resistant
hsa-miR-101-3p 1-(4-fluorobenzyl)-2-methyl-1h-naphtho[2,3-d]imidazole-4,9-dione 374275 NSC651776 sensitive
hsa-miR-101-3p 1-(4-methoxyphenyl)-3-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]thiourea 5465920 NSC668329 sensitive
hsa-miR-101-3p 1-(4-methylphenyl)-3-[(Z)-[phenyl(pyridin-2-yl)methylidene]amino]thiourea 5465919 NSC668328 sensitive
hsa-miR-101-3p 1-(4,8-dioxothieno[2,3-f][1]benzothiol-2-yl)ethyl acetate 388025 NSC682450 sensitive
hsa-miR-101-3p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-101-3p 1-(hydroxy(oxido)amino)-7-methoxy-9-((3-(methylamino)propyl)amino)acridine 384254 NSC673800 sensitive
hsa-miR-101-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 sensitive
hsa-miR-101-3p 1-[(E)-1-[4-[methyl(phenyl)sulfamoyl]phenyl]ethylideneamino]-3-propylthiourea 5466445 NSC691415 resistant
hsa-miR-101-3p 1-[(z)-(2-oxoindolin-3-ylidene)amino]-3-(2-pyridylmethyl)thiourea 3005083 NSC670961 sensitive
hsa-miR-101-3p 1-[(Z)-2-cyano-1-pyrrolidin-1-ylethenyl]-3-phenylurea 5468918 NSC679095 resistant
hsa-miR-101-3p 1-[[2-(4-chlorophenyl)-4-methylidene-5-oxooxolan-2-yl]methyl]-5-methylpyrimidine-2,4-dione 381501 NSC668257 sensitive
hsa-miR-101-3p 1-[10-[4-(dimethylamino)-2-methylquinolin-1-ium-1-yl]decyl]-N,N,2-trimethylquinolin-1-ium-4-amine;perchlorate 387883 NSC682095 sensitive
hsa-miR-101-3p 1-[11-(4-chlorophenyl)-13-methyl-15-thia-12,17-diazatetracyclo[8.7.0.02,7.012,16]heptadeca-1(10),2,4,6,13,16-hexaen-14-yl]ethanone 388255 NSC682866 sensitive
hsa-miR-101-3p 1-[2-(2-pyridyl)ethyl]-3-[(e)-2-pyridylmethyleneamino]thiourea 9571904 NSC670779 sensitive
hsa-miR-101-3p 1-[2-(3-chloropropyl)phenyl]-3,4-dihydroisoquinoline;hydrochloride 390024 NSC686940 sensitive
hsa-miR-101-3p 1-[2-(4-methoxyphenyl)-6-morpholin-4-yl-1,3-benzothiazol-5-yl]-3-(4-methylsulfanylphenyl)urea 54613383 NSC747180 resistant
hsa-miR-101-3p 1-[3-(4-chlorophenyl)-5-[4-[(7-chloroquinolin-4-yl)amino]phenyl]-3,4-dihydropyrazol-2-yl]ethanone 72374604 NSC759004 sensitive
hsa-miR-101-3p 1-[3-[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]-5-phenyl-3,4-dihydropyrazol-2-yl]ethanone 155815904 NSC763582 resistant
hsa-miR-101-3p 1-[4-[(1,3-dihydroxy-2-methylpropan-2-yl)amino]butyl]-5,10-dihydroxynaphtho[2,3-f]indole-4,11-dione 406504 NSC724631 sensitive
hsa-miR-101-3p 1-[4-[(8-hydroxy-2-phenylquinolin-4-yl)amino]phenyl]ethanone 24205367 NSC735318 sensitive
hsa-miR-101-3p 1-[4-[(e)-n-(diaminomethylideneamino)-c-ethylcarbonimidoyl]phenyl]-3-[4-[(z)-n-(diaminomethylideneamino)-c-ethylcarbonimidoyl]phenyl]urea;hydrochloride 54600368 NSC181500 sensitive
hsa-miR-101-3p 1-[4-[4-[(5-fluoro-2,4-dioxopyrimidin-1-yl)methyl]triazol-1-yl]-5-[[(4-methoxyphenyl)-diphenylmethoxy]methyl]oxolan-2-yl]-5-methylpyrimidine-2,4-dione 392020 NSC691819 sensitive
hsa-miR-101-3p 1-[4-[5,6-bis(4-chlorophenyl)-1,2,4-triazin-3-yl]piperazin-1-yl]-2-[4-(4-methoxyphenyl)piperazin-1-yl]ethanone 54613007 NSC749152 sensitive
hsa-miR-101-3p 1-[4-[5,6-bis(4-methoxyphenyl)-1,2,4-triazin-3-yl]piperazin-1-yl]-2-[4-(4-chlorophenyl)piperazin-1-yl]ethanone 54613115 NSC749146 sensitive
hsa-miR-101-3p 1-[4-[5,6-bis(4-methoxyphenyl)-1,2,4-triazin-3-yl]piperazin-1-yl]-2-[4-(4-methoxyphenyl)piperazin-1-yl]ethanone 54613116 NSC749147 sensitive
hsa-miR-101-3p 1-[4-[tert-butyl(dimethyl)silyl]oxy-5-[[tert-butyl(dimethyl)silyl]oxymethyl]oxolan-2-yl]-5-fluoropyrimidine-2,4-dione 388209 NSC682803 sensitive
hsa-miR-101-3p 1-[5-(4-methylsulfanylphenyl)-3-(3,4,5-trimethoxyphenyl)-3,4-dihydropyrazol-2-yl]ethanone 45028883 NSC744688 sensitive
hsa-miR-101-3p 1-[n'-[4-[(6-methoxyquinolin-8-yl)amino]butyl]carbamimidoyl]-2-propan-2-ylguanidine;hydrochloride 54601442 NSC53861 sensitive
hsa-miR-101-3p 1-[n'-[5-[(6-methoxyquinolin-8-yl)amino]pentyl]carbamimidoyl]-2-propan-2-ylguanidine;hydrochloride 54605283 NSC54849 sensitive
hsa-miR-101-3p 1-[phenyl(2-pyridinyl)methylene]-4-(3-methylphenyl)thiosemicarbazide 5785686 NSC668327 sensitive
hsa-miR-101-3p 1-{3-[(4-bromophenyl)amino]-5-methyl-1,2-oxazolidin-2-yl}ethanone 377011 NSC658229 sensitive
hsa-miR-101-3p 1-adamantyl(3-(4-hydroxyphenyl)-2-oxiranyl)methanone 386287 NSC678044 sensitive
hsa-miR-101-3p 1-adamantylmethyl 4-[(2,5-dihydroxyphenyl)methylamino]benzoate 391131 NSC689857 sensitive
hsa-miR-101-3p 1-benzyl-3-hexadecyl-2-methylimidazolium chloride 44219704 NSC745343 sensitive
hsa-miR-101-3p 1-bromo-3,6-dichloro-3,7-dimethyloctan-2-one 382936 NSC670813 sensitive
hsa-miR-101-3p 1-butoxy-4-(dichloromethylidene)-3,5-dimethyl-1,4-dihydrophosphinine 1-oxide 372646 NSC648100 sensitive
hsa-miR-101-3p 1-chloro-9-[4-(diaminomethylideneamino)sulfonylanilino]-n-[4-[(4,6-dimethylpyrimidin-2-yl)sulfamoyl]phenyl]acridine-4-carboxamide 365421 NSC633041 sensitive
hsa-miR-101-3p 1-cyclohexyl-3-[(e)-(6-methyl-2-pyridyl)methyleneamino]thiourea 9571907 NSC670782 sensitive
hsa-miR-101-3p 1-cyclopentyl-3-[(Z)-1-pyridin-2-ylethylideneamino]thiourea 5468465 NSC670783 sensitive
hsa-miR-101-3p 1-ethyl-2,4,6-triphenyl-4-(trichloromethyl)pyridine 386205 NSC677921 sensitive
hsa-miR-101-3p 10-methyl-2-[(3,4,5-trimethoxyphenyl)methyl]phenothiazine-1-carbonitrile 374832 NSC653255 sensitive
hsa-miR-101-3p 10-phenyl-11,12,14,16-tetrazatetracyclo[7.7.0.02,7.011,15]hexadeca-1(9),2,4,6,12,14-hexaene 373409 NSC649664 sensitive
hsa-miR-101-3p 11-(4-fluoroanilino)-7,8,9,10-tetrahydrobenzimidazolo[1,2-b]isoquinoline-6-carbonitrile 387851 NSC682011 sensitive
hsa-miR-101-3p 11-(benzenesulfonyl)-4-methyl-8-thia-5,13-diazatricyclo[7.4.0.02,6]trideca-1(9),2(6),3,10-tetraen-12-one 54612954 NSC749874 sensitive
hsa-miR-101-3p 11h-benzo[a]carbazole-1,4-dione, 7,11-dimethyl- 371271 NSC645330 sensitive
hsa-miR-101-3p 12-(3-piperidin-1-ylpropyl)-3-oxa-12-azapentacyclo[11.8.0.02,11.05,10.014,19]henicosa-1(13),2(11),5,7,9,14,16,18,20-nonaen-4-one;hydrochloride 368096 NSC638435 sensitive
hsa-miR-101-3p 12-ethyl-3-methyl-8-phenyl-2,4,5,9,10,12-hexazatetracyclo[11.4.0.02,6.07,11]heptadeca-1(17),3,5,7,10,13,15-heptaene 383802 NSC672305 sensitive
hsa-miR-101-3p 12-iminodaunorubicin hcl 72400 NSC254681 sensitive
hsa-miR-101-3p 13-(4-methylphenyl)sulfonyl-1,4,7,10-tetrathia-13-azacyclopentadecane 373829 NSC650792 resistant
hsa-miR-101-3p 13-benzoyl-18,19-dimethoxy-5,7-dioxa-13-azapentacyclo[10.7.1.02,10.04,8.016,20]icosa-1(20),2,4(8),9,16,18-hexaene-12-carbonitrile 363096 NSC627666 resistant
hsa-miR-101-3p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 resistant
hsa-miR-101-3p 15,18-dihydroxy-5,7-dimethyl-11-thia-2,5,7,9-tetrazapentacyclo[10.8.0.02,10.03,8.014,19]icosa-1(12),3(8),9,14,16,18-hexaene-4,6,13,20-tetrone 380627 NSC666302 sensitive
hsa-miR-101-3p 17-methyl-13,14,17-triazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,8,11(16),14-heptaen-12-one 403909 NSC719502 resistant
hsa-miR-101-3p 17-nitro-8,20-diazapentacyclo[11.7.1.02,7.09,21.014,19]henicosa-1(21),2,4,6,8,10,12,14(19),15,17-decaene 438794 NSC670694 sensitive
hsa-miR-101-3p 18,20-dioxa-3,11,24-triazahexacyclo[12.10.0.02,11.04,9.015,23.017,21]tetracosa-1(14),2,4,6,8,15,17(21),22-octaen-10-one 378229 NSC660032 resistant
hsa-miR-101-3p 1h-1,4,7-triazonine-1,4-diacetic acid, octahydro- 393901 NSC696862 sensitive
hsa-miR-101-3p 1h-benzo[a]carbazole-1,4(11h)-dione, 11-methyl- 261066 NSC92937 sensitive
hsa-miR-101-3p 1h-benzo[a]carbazole-1,4(11h)-dione, 11-phenyl- 369537 NSC641394 sensitive
hsa-miR-101-3p 1h-pyrido[4,3,2-mn]thiazolo[4,5-b]acridin-9-one 390989 NSC689297 sensitive
hsa-miR-101-3p 2',3',4'-trimethoxy-5-hydroxyflavone 373139 NSC649082 sensitive
hsa-miR-101-3p 2-(1-(3-(4-chlorophenyl)-2-hydroxy-5-(2-thienyl)-2,5-cyclohexadien-1-yl)ethylidene)malonamide 392312 NSC692588 sensitive
hsa-miR-101-3p 2-(1-(4-(2-(2-hydroxyethoxy)ethyl)piperazino))naphthazarin NSC658143 sensitive
hsa-miR-101-3p 2-(1h-benzimidazol-2-yl)-3,4,5,6-tetrachlorobenzohydrazide 402423 NSC716354 sensitive
hsa-miR-101-3p 2-(2-(benzoylamino)-6-hydroxy-7h-purin-7-yl)ethyl benzoate 135501538 NSC637507 sensitive
hsa-miR-101-3p 2-(2-(dimethylamino)ethylamino)naphthazarin 376950 NSC658145 sensitive
hsa-miR-101-3p 2-(2-acetylbenzimidazol-1-yl)-1-(4-chlorophenyl)ethanone 384455 NSC674257 sensitive
hsa-miR-101-3p 2-(2-acetylbenzimidazol-1-yl)-1-(4-methoxyphenyl)ethanone 384456 NSC674258 sensitive
hsa-miR-101-3p 2-(2-acetylbenzimidazol-1-yl)-1-(4-nitrophenyl)ethanone 384457 NSC674259 sensitive
hsa-miR-101-3p 2-(2-benzoylbenzimidazol-1-yl)-1-(4-fluorophenyl)ethanone 45029093 NSC745451 sensitive
hsa-miR-101-3p 2-(2-chlorophenyl)-3-[5-(1,2,4-triazol-4-ylmethyl)-1,3,4-oxadiazol-2-yl]-1,3-thiazolidin-4-one 45029357 NSC746513 sensitive
hsa-miR-101-3p 2-(2-naphthyl)-5-methyl-1,8-naphthyridin-4(1h)-one 386570 NSC679018 sensitive
hsa-miR-101-3p 2-(2-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468909 NSC679021 sensitive
hsa-miR-101-3p 2-(2,4-dichlorobenzoyl)-7-hydroxy-chromen-4-one 5465338 NSC646381 sensitive
hsa-miR-101-3p 2-(3-(2-methoxy-4-(4-methylene-5-oxotetrahydro-2-furanyl)phenoxy)propyl)-1h-isoindole-1,3(2h)-dione 381521 NSC668277 sensitive
hsa-miR-101-3p 2-(3-benzyl-6-methyl-4-oxoquinazolin-2-yl)sulfanyl-N-(3,4,5-trimethoxyphenyl)acetamide 155809865 NSC762988 resistant
hsa-miR-101-3p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-101-3p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepine-6-thione 4998423 NSC684481 resistant
hsa-miR-101-3p 2-(3-methylbutylsulfanyl)naphthalene-1,4-dione 315743 NSC241494 sensitive
hsa-miR-101-3p 2-(3-phenyl-4,5-bis(phenylimino)-1,3-thiazolidin-2-ylidene)malononitrile 383253 NSC671367 sensitive
hsa-miR-101-3p 2-(3,4-dichloro-5-hydroxytetrahydro-2-furanyl)-1-(2,5-dimethylphenyl)ethanone 366852 NSC635831 sensitive
hsa-miR-101-3p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 sensitive
hsa-miR-101-3p 2-(4-((oxiran-2-yl)methoxy)styryl)-4,5-dihydrooxazole 24206038 NSC737757 sensitive
hsa-miR-101-3p 2-(4-{(e)-[4-(diethylamino)phenyl]diazenyl}phenyl)-4-methyl[1,3]thiazolo[5,4-b]pyridin-4-ium iodide 366877