pre-miRNA Information
pre-miRNA hsa-mir-93   
Genomic Coordinates chr7: 100093768 - 100093847
Synonyms MIRN9, MIRN93, hsa-mir-93, miR-93, MIR93
Description Homo sapiens miR-93 stem-loop
Comment Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-93-7.1 and mir-93-7.2 . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-93-5p
Sequence 11| CAAAGUGCUGUUCGUGCAGGUAG |33
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN1084532 13 COSMIC
COSN30193114 13 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1328828703 6 dbSNP
rs751048634 9 dbSNP
rs1286608125 10 dbSNP
rs779705683 13 dbSNP
rs761414978 14 dbSNP
rs1284084666 17 dbSNP
rs750790187 18 dbSNP
rs765578346 20 dbSNP
rs753843516 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BRE8T5 miR-93 Predictive Biomarker (PRD) Clinical/Experimental Data Expression Decrease Tumor tissue Quantitative real-time PCR
BH2WX1 miR-93-5p Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Real-time polymerase chain reaction
Gene Information
Gene Symbol PDZD11   
Synonyms AIPP1, PDZK11, PISP
Description PDZ domain containing 11
Transcript NM_016484   
Expression
Putative miRNA Targets on PDZD11
3'UTR of PDZD11
(miRNA target sites are highlighted)
>PDZD11|NM_016484|3'UTR
   1 AAAGTTGCAGCCCACAGCCCTTCATGTGGACTCTGTCATGACATGCTAACTAGACTTCAGGGGAGCCACTTCTGTTTTCA
  81 GCCCCTCCCTGGAATAGTGAGTTGGGAGGATGGGGAGACAGCTAACCAACTGCATTACCCAAACCATATTGCACTTTTAG
 161 TTCCCTAGTTTTCTAGGTGAGCTTCATTCCCTGAAAGGAGGATGATGATATCTAGGCATAACCTAGCCTGTGAGGAACCT
 241 AGTTAGGAAAGACAACTGACATTTATTGAATATCATGCACTAGTCCCTTACATATGTCATATTTTAATTATAGAAATCAG
 321 TAGCAAAAAGAATCTTGGGGATTTTCCATCTGACTTCCCTGGCCATCTTATCCCATCCTTGCACTACCAGAAGATTCATA
 401 CACTTTTGAGACTCCAGTGAGACGCTGTTTTCACCCCTTCCTCCTCCTAGCCTCTCTCCCAAAAAGTAAAACACAATGCT
 481 GAAGAAATATTGGTGTGACTTTTGAATGTTACCGATTGGATGTAAAATGCTATCGAGGGAAGAAAAAGCTCTTCCAAAGA
 561 GAGGAGCCACTGGAAGGAACAGAGCAATACTATACCTTCCTCGCAACTACCTGTGATGTCTGACCAGAACATTAGCAAGG
 641 CCAAGGAACTTTAACCACAGTATAACTAAGAAATGGCATAGAGTGAGGGGCACTGAAAGAAACTGCCCGTTCCCCTAGGA
 721 G
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gaUGGACGUGCU-UGUCGUGAAAc 5'
            |||   || | |: ||||||| 
Target 5' ttACCCAAACCATATTGCACTTTt 3'
135 - 158 153.00 -10.10
2
miRNA  3' gaUGGACGUGCUUGU--CGUGAAAc 5'
            |:: ||| |: ||  | ||||| 
Target 5' acATTAGCAAGGCCAAGGAACTTTa 3'
629 - 653 127.00 -5.40
3
miRNA  3' gauGGACGUG-----CUU----GU-CGUGAAAc 5'
             |:|||||     |||    ||  |||||| 
Target 5' atcCTTGCACTACCAGAAGATTCATACACTTTt 3'
375 - 407 126.00 -12.50
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1478031619 2 dbSNP
rs775232515 15 dbSNP
rs777590617 18 dbSNP
rs1465558243 20 dbSNP
rs1427116589 29 dbSNP
rs1027705138 33 dbSNP
rs181549275 49 dbSNP
rs1421013212 54 dbSNP
rs771161411 58 dbSNP
rs1164835197 68 dbSNP
rs755430615 79 dbSNP
rs752034199 80 dbSNP
rs1301860805 81 dbSNP
rs1365269315 82 dbSNP
rs919018544 83 dbSNP
rs551620729 103 dbSNP
rs1430861179 106 dbSNP
rs973199116 112 dbSNP
rs1360108299 117 dbSNP
rs1214249507 127 dbSNP
rs761033690 131 dbSNP
rs1369894176 138 dbSNP
rs910091786 154 dbSNP
rs190119535 163 dbSNP
rs1220091500 167 dbSNP
rs1290948750 168 dbSNP
rs11546429 169 dbSNP
rs773760012 172 dbSNP
rs959625420 192 dbSNP
rs1045225874 195 dbSNP
rs368584317 208 dbSNP
rs1240187357 210 dbSNP
rs1434625126 211 dbSNP
rs1376514008 219 dbSNP
rs1182115379 232 dbSNP
rs1415272277 233 dbSNP
rs1035206768 242 dbSNP
rs1162450750 243 dbSNP
rs893520952 254 dbSNP
rs765524277 265 dbSNP
rs1447940895 268 dbSNP
rs868418346 283 dbSNP
rs14492 288 dbSNP
rs1300407837 292 dbSNP
rs1187265072 311 dbSNP
rs1343837650 338 dbSNP
rs1430222890 372 dbSNP
rs772553985 378 dbSNP
rs1303663096 387 dbSNP
rs1381339347 388 dbSNP
rs1476441047 395 dbSNP
rs1243861496 413 dbSNP
rs1314525985 417 dbSNP
rs1235793281 419 dbSNP
rs140803562 423 dbSNP
rs1053538185 424 dbSNP
rs966759591 434 dbSNP
rs1210311274 445 dbSNP
rs1238841679 450 dbSNP
rs1459747007 456 dbSNP
rs1182422400 459 dbSNP
rs1238299577 476 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Jiyoye
Tools used in this research TargetScan
Original Description (Extracted from the article) ... HITS-CLIP data was present in Supplenentary. RNA binding protein: AGO2. ...

- Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al., 2012, The EMBO journal.

Article - Riley KJ; Rabinowitz GS; Yario TA; Luna JM; et al.
- The EMBO journal, 2012
Epstein-Barr virus (EBV) controls gene expression to transform human B cells and maintain viral latency. High-throughput sequencing and crosslinking immunoprecipitation (HITS-CLIP) identified mRNA targets of 44 EBV and 310 human microRNAs (miRNAs) in Jijoye (Latency III) EBV-transformed B cells. While 25% of total cellular miRNAs are viral, only three viral mRNAs, all latent transcripts, are targeted. Thus, miRNAs do not control the latent/lytic switch by targeting EBV lytic genes. Unexpectedly, 90% of the 1664 human 3'-untranslated regions targeted by the 12 most abundant EBV miRNAs are also targeted by human miRNAs via distinct binding sites. Half of these are targets of the oncogenic miR-17 approximately 92 miRNA cluster and associated families, including mRNAs that regulate transcription, apoptosis, Wnt signalling, and the cell cycle. Reporter assays confirmed the functionality of several EBV and miR-17 family miRNA-binding sites in EBV latent membrane protein 1 (LMP1), EBV BHRF1, and host CAPRIN2 mRNAs. Our extensive list of EBV and human miRNA targets implicates miRNAs in the control of EBV latency and illuminates viral miRNA function in general.
LinkOut: [PMID: 22473208]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE17306 Multiple myeloma 0.356 6.0e-3 0.324 1.2e-2 49 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.486 6.9e-3 0.362 3.8e-2 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.477 8.0e-3 -0.602 7.3e-4 25 Click to see details
GSE38226 Liver fibrosis 0.456 1.9e-2 0.417 3.0e-2 21 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.425 3.1e-2 -0.611 2.1e-3 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.377 3.5e-2 0.433 1.7e-2 24 Click to see details
GSE32688 Pancreatic cancer 0.313 4.1e-2 0.310 4.2e-2 32 Click to see details
GSE14794 Lymphoblastoid cells -0.159 6.7e-2 -0.061 2.8e-1 90 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.457 1.1e-1 -0.450 1.1e-1 9 Click to see details
GSE19783 ER+ ER+ breast cancer 0.288 1.1e-1 0.358 6.1e-2 20 Click to see details
GSE19536 Breast cancer 0.12 1.2e-1 0.129 1.0e-1 100 Click to see details
GSE27834 Pluripotent stem cells 0.288 1.4e-1 0.297 1.3e-1 16 Click to see details
GSE21849 B cell lymphoma 0.17 1.9e-1 0.280 7.1e-2 29 Click to see details
GSE28544 Breast cancer -0.129 2.7e-1 -0.262 1.1e-1 24 Click to see details
GSE28260 Renal cortex and medulla 0.171 2.9e-1 0.121 3.5e-1 13 Click to see details
GSE19783 ER- ER- breast cancer 0.045 3.5e-1 0.064 2.9e-1 79 Click to see details
GSE21032 Prostate cancer 0.036 3.7e-1 0.038 3.7e-1 83 Click to see details
GSE21687 Ependynoma primary tumors 0.035 3.9e-1 -0.024 4.3e-1 64 Click to see details
GSE19350 CNS germ cell tumors -0.049 4.4e-1 0.301 1.7e-1 12 Click to see details
GSE42095 Differentiated embryonic stem cells 0.014 4.7e-1 -0.060 3.9e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.316 0.04 0.375 0.02 32 Click to see details
COAD -0.603 0.06 -0.833 0.01 8 Click to see details
UCEC -0.336 0.08 -0.449 0.03 19 Click to see details
CESC 0.96 0.09 0.500 0.33 3 Click to see details
KICH 0.26 0.1 0.206 0.16 25 Click to see details
KIRC 0.142 0.12 0.071 0.28 68 Click to see details
HNSC 0.181 0.13 0.142 0.18 42 Click to see details
LUAD 0.352 0.13 0.217 0.25 12 Click to see details
PAAD 0.539 0.23 0.400 0.3 4 Click to see details
KIRP 0.13 0.24 0.040 0.41 32 Click to see details
BLCA -0.149 0.28 0.011 0.48 18 Click to see details
PCPG -0.604 0.29 -0.500 0.33 3 Click to see details
ESCA -0.156 0.32 -0.209 0.27 11 Click to see details
LIHC 0.057 0.35 0.027 0.43 49 Click to see details
BRCA -0.031 0.39 -0.048 0.33 84 Click to see details
THCA 0.033 0.4 0.027 0.42 59 Click to see details
LUSC -0.024 0.44 0.110 0.26 38 Click to see details
CHOL -0.023 0.48 0.150 0.35 9 Click to see details
PRAD 0.008 0.48 0.034 0.41 50 Click to see details
PRAD 0.008 0.48 0.034 0.41 50 Click to see details
PRAD 0.008 0.48 0.034 0.41 50 Click to see details
1196 hsa-miR-93-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000021 TP53INP1 tumor protein p53 inducible nuclear protein 1 5 3
MIRT000577 CDKN1A cyclin dependent kinase inhibitor 1A 6 5
MIRT002471 TCEAL1 transcription elongation factor A like 1 1 1
MIRT002472 E2F1 E2F transcription factor 1 5 5
MIRT003240 MAPK9 mitogen-activated protein kinase 9 2 1
MIRT004055 VEGFA vascular endothelial growth factor A 2 1
MIRT004104 ITGB8 integrin subunit beta 8 4 1
MIRT004332 KAT2B lysine acetyltransferase 2B 3 1
MIRT004410 TUSC2 tumor suppressor candidate 2 4 3
MIRT004572 BCL2L11 BCL2 like 11 2 9
MIRT006216 PTEN phosphatase and tensin homolog 4 3
MIRT007003 PURA purine rich element binding protein A 1 1
MIRT007185 LATS2 large tumor suppressor kinase 2 3 1
MIRT027939 TAF6L TATA-box binding protein associated factor 6 like 1 1
MIRT027940 LDLR low density lipoprotein receptor 2 9
MIRT027941 PDZD11 PDZ domain containing 11 1 2
MIRT027942 ZNF813 zinc finger protein 813 1 1
MIRT027943 ARSJ arylsulfatase family member J 2 3
MIRT027944 TMEM100 transmembrane protein 100 2 3
MIRT027945 ADARB1 adenosine deaminase, RNA specific B1 1 1
MIRT027946 LIMA1 LIM domain and actin binding 1 2 5
MIRT027947 LUZP1 leucine zipper protein 1 1 1
MIRT027948 AP1G1 adaptor related protein complex 1 gamma 1 subunit 1 2
MIRT027949 TMEM127 transmembrane protein 127 2 9
MIRT027950 ZIC5 Zic family member 5 1 1
MIRT027951 ZNF202 zinc finger protein 202 2 6
MIRT027952 TSN translin 1 1
MIRT027953 TMX3 thioredoxin related transmembrane protein 3 1 2
MIRT027954 SUCO SUN domain containing ossification factor 2 6
MIRT027955 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT027956 RND3 Rho family GTPase 3 1 1
MIRT027957 RYBP RING1 and YY1 binding protein 1 1
MIRT027958 RAB11FIP1 RAB11 family interacting protein 1 2 6
MIRT027959 EPHA4 EPH receptor A4 2 4
MIRT027960 TMEM168 transmembrane protein 168 1 1
MIRT027961 DCTN6 dynactin subunit 6 2 3
MIRT027962 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT027963 NUPL1 nucleoporin 58 1 1
MIRT027964 HAUS8 HAUS augmin like complex subunit 8 2 3
MIRT027965 GRB2 growth factor receptor bound protein 2 1 1
MIRT027966 CCNG2 cyclin G2 1 1
MIRT027967 KATNAL1 katanin catalytic subunit A1 like 1 2 4
MIRT027968 CAPRIN2 caprin family member 2 2 6
MIRT027969 FAM129A family with sequence similarity 129 member A 2 7
MIRT027970 GNB4 G protein subunit beta 4 1 1
MIRT027971 C5orf22 chromosome 5 open reading frame 22 1 1
MIRT027972 DMKN dermokine 1 1
MIRT027973 SPOPL speckle type BTB/POZ protein like 1 2
MIRT027974 TGFBR2 transforming growth factor beta receptor 2 6 8
MIRT027975 RPA2 replication protein A2 1 2
MIRT027976 ATP5SL distal membrane arm assembly complex 2 1 1
MIRT027977 RAB5B RAB5B, member RAS oncogene family 2 9
MIRT027978 AKAP11 A-kinase anchoring protein 11 2 12
MIRT027979 COQ2 coenzyme Q2, polyprenyltransferase 1 1
MIRT027980 GPR137C G protein-coupled receptor 137C 1 1
MIRT027981 NIN ninein 2 5
MIRT027982 BMPR2 bone morphogenetic protein receptor type 2 1 2
MIRT027983 LIX1L limb and CNS expressed 1 like 1 1
MIRT027984 ARHGAP12 Rho GTPase activating protein 12 2 5
MIRT027985 ZFP91 ZFP91 zinc finger protein 1 1
MIRT027986 PRKACB protein kinase cAMP-activated catalytic subunit beta 2 3
MIRT027987 NACC2 NACC family member 2 2 4
MIRT027988 ATP6V1G2-DDX39B ATP6V1G2-DDX39B readthrough (NMD candidate) 1 1
MIRT027989 YTHDC1 YTH domain containing 1 2 3
MIRT027990 NDEL1 nudE neurodevelopment protein 1 like 1 1 1
MIRT027991 NR2C2AP nuclear receptor 2C2 associated protein 1 1
MIRT027992 HCCS holocytochrome c synthase 1 1
MIRT027993 ZNF417 zinc finger protein 417 2 6
MIRT027994 IRF1 interferon regulatory factor 1 1 1
MIRT027995 SERTAD2 SERTA domain containing 2 1 1
MIRT027996 BNIP2 BCL2 interacting protein 2 2 7
MIRT027997 FMNL2 formin like 2 2 3
MIRT027998 PHC3 polyhomeotic homolog 3 1 1
MIRT027999 SYBU syntabulin 1 1
MIRT028000 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 10
MIRT028001 WDR33 WD repeat domain 33 1 1
MIRT028002 CCND1 cyclin D1 2 12
MIRT028003 PBXIP1 PBX homeobox interacting protein 1 1 1
MIRT028004 SMAD4 SMAD family member 4 2 6
MIRT028005 ZNF805 zinc finger protein 805 2 3
MIRT028006 CRY2 cryptochrome circadian clock 2 1 2
MIRT028007 PBX3 PBX homeobox 3 1 1
MIRT028008 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 1 1
MIRT028009 ZNF264 zinc finger protein 264 2 6
MIRT028010 LRRC58 leucine rich repeat containing 58 1 1
MIRT028011 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 6
MIRT028012 RUNX3 runt related transcription factor 3 2 2
MIRT028013 NUP107 nucleoporin 107 1 1
MIRT028014 SNAPIN SNAP associated protein 1 1
MIRT028015 ACTR2 ARP2 actin related protein 2 homolog 2 6
MIRT028016 SRPK1 SRSF protein kinase 1 1 1
MIRT028017 PBRM1 polybromo 1 1 1
MIRT028018 CD46 CD46 molecule 1 1
MIRT028019 SFXN5 sideroflexin 5 1 1
MIRT028020 USP21 ubiquitin specific peptidase 21 1 1
MIRT028021 ATXN1 ataxin 1 2 4
MIRT028022 ZMIZ1 zinc finger MIZ-type containing 1 1 1
MIRT028023 RNF34 ring finger protein 34 2 3
MIRT028024 ZC3H12C zinc finger CCCH-type containing 12C 2 8
MIRT028025 GRAMD1A GRAM domain containing 1A 1 2
MIRT028026 EGLN3 egl-9 family hypoxia inducible factor 3 2 3
MIRT028027 ZNF180 zinc finger protein 180 2 7
MIRT028028 DDX46 DEAD-box helicase 46 1 1
MIRT028029 KDM3B lysine demethylase 3B 1 1
MIRT028030 ARIH2 ariadne RBR E3 ubiquitin protein ligase 2 1 1
MIRT028031 RMDN3 regulator of microtubule dynamics 3 1 1
MIRT028032 HOOK1 hook microtubule tethering protein 1 1 1
MIRT028033 RB1 RB transcriptional corepressor 1 2 3
MIRT028034 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 1 1
MIRT028035 FIGNL1 fidgetin like 1 1 1
MIRT028036 LYST lysosomal trafficking regulator 1 1
MIRT028037 TNFRSF21 TNF receptor superfamily member 21 2 4
MIRT028038 PDRG1 p53 and DNA damage regulated 1 2 10
MIRT028039 OTUD4 OTU deubiquitinase 4 2 2
MIRT028040 DUSP8 dual specificity phosphatase 8 1 1
MIRT028041 STC2 stanniocalcin 2 1 1
MIRT028042 UBXN2A UBX domain protein 2A 2 4
MIRT028043 ANKFY1 ankyrin repeat and FYVE domain containing 1 1 2
MIRT028044 TOLLIP toll interacting protein 1 1
MIRT028045 PPP6R2 protein phosphatase 6 regulatory subunit 2 1 1
MIRT028046 MAP7 microtubule associated protein 7 2 8
MIRT028047 ZBTB21 zinc finger and BTB domain containing 21 1 1
MIRT028048 TNKS1BP1 tankyrase 1 binding protein 1 1 1
MIRT028049 CSNK1G1 casein kinase 1 gamma 1 1 1
MIRT028050 ARID4B AT-rich interaction domain 4B 2 6
MIRT028051 FOXJ3 forkhead box J3 2 4
MIRT028052 VMA21 VMA21, vacuolar ATPase assembly factor 1 1
MIRT028053 BTG3 BTG anti-proliferation factor 3 2 8
MIRT028054 HARS histidyl-tRNA synthetase 1 1
MIRT028055 TAX1BP1 Tax1 binding protein 1 2 5
MIRT028056 NFIB nuclear factor I B 2 5
MIRT028057 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 1 1
MIRT028058 GPN3 GPN-loop GTPase 3 1 1
MIRT028059 MZT1 mitotic spindle organizing protein 1 1 1
MIRT028060 DDX39B DExD-box helicase 39B 1 1
MIRT028061 RBBP7 RB binding protein 7, chromatin remodeling factor 1 2
MIRT028062 ARCN1 archain 1 1 2
MIRT028063 C16orf70 chromosome 16 open reading frame 70 2 4
MIRT028064 ZBTB33 zinc finger and BTB domain containing 33 2 6
MIRT028065 LAPTM4B lysosomal protein transmembrane 4 beta 1 1
MIRT028066 MYO1E myosin IE 1 1
MIRT028067 TYW5 tRNA-yW synthesizing protein 5 1 1
MIRT028068 LHFPL2 LHFPL tetraspan subfamily member 2 1 1
MIRT028069 ICMT isoprenylcysteine carboxyl methyltransferase 2 5
MIRT028070 C3orf38 chromosome 3 open reading frame 38 2 8
MIRT028071 MYLIP myosin regulatory light chain interacting protein 2 12
MIRT028072 FAM210A family with sequence similarity 210 member A 2 3
MIRT028073 YY1 YY1 transcription factor 1 2
MIRT028074 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 4
MIRT028075 POGK pogo transposable element derived with KRAB domain 1 1
MIRT028076 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT028077 MIDN midnolin 2 11
MIRT028078 DDX5 DEAD-box helicase 5 1 2
MIRT028079 EGR2 early growth response 2 1 1
MIRT028080 SUV420H1 lysine methyltransferase 5B 2 3
MIRT028081 MAPRE3 microtubule associated protein RP/EB family member 3 2 8
MIRT028082 CREBRF CREB3 regulatory factor 1 1
MIRT028083 FCHO2 FCH domain only 2 2 4
MIRT028084 PRRG1 proline rich and Gla domain 1 1 1
MIRT028085 SAMD12 sterile alpha motif domain containing 12 2 3
MIRT028086 PKD2 polycystin 2, transient receptor potential cation channel 1 1
MIRT028087 ARHGAP1 Rho GTPase activating protein 1 2 7
MIRT028088 B2M beta-2-microglobulin 2 10
MIRT028089 TBC1D20 TBC1 domain family member 20 1 1
MIRT028090 KLHL28 kelch like family member 28 2 9
MIRT028091 FBXL3 F-box and leucine rich repeat protein 3 1 1
MIRT028092 RHEBL1 RHEB like 1 1 1
MIRT028093 KMT2D lysine methyltransferase 2D 1 2
MIRT028094 ASB1 ankyrin repeat and SOCS box containing 1 1 2
MIRT028095 WDR1 WD repeat domain 1 1 2
MIRT028096 UBE3B ubiquitin protein ligase E3B 1 1
MIRT028097 FBXL5 F-box and leucine rich repeat protein 5 2 13
MIRT028098 GNA12 G protein subunit alpha 12 1 1
MIRT028099 ASF1A anti-silencing function 1A histone chaperone 1 1
MIRT028100 OSR1 odd-skipped related transciption factor 1 1 1
MIRT028101 SH3PXD2A SH3 and PX domains 2A 1 1
MIRT028102 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT028103 FYCO1 FYVE and coiled-coil domain containing 1 1 2
MIRT028104 DCAF8 DDB1 and CUL4 associated factor 8 2 2
MIRT028105 YOD1 YOD1 deubiquitinase 2 4
MIRT028106 RRN3 RRN3 homolog, RNA polymerase I transcription factor 2 3
MIRT028107 UBR5 ubiquitin protein ligase E3 component n-recognin 5 1 2
MIRT028108 ANKRD52 ankyrin repeat domain 52 2 4
MIRT028109 SAMD8 sterile alpha motif domain containing 8 2 3
MIRT028110 MYO19 myosin XIX 1 1
MIRT028111 ADAR adenosine deaminase, RNA specific 2 5
MIRT028112 BTBD10 BTB domain containing 10 1 1
MIRT028113 SOWAHC sosondowah ankyrin repeat domain family member C 1 1
MIRT028114 REEP3 receptor accessory protein 3 2 4
MIRT028115 SEC23A Sec23 homolog A, coat complex II component 1 2
MIRT028116 PTPN4 protein tyrosine phosphatase, non-receptor type 4 2 9
MIRT028117 MTPAP mitochondrial poly(A) polymerase 2 5
MIRT028118 SPRED1 sprouty related EVH1 domain containing 1 2 3
MIRT028119 KLF9 Kruppel like factor 9 1 1
MIRT028120 DPP8 dipeptidyl peptidase 8 1 1
MIRT028121 FRS2 fibroblast growth factor receptor substrate 2 2 3
MIRT028122 STK11 serine/threonine kinase 11 1 1
MIRT028123 GPATCH2 G-patch domain containing 2 1 1
MIRT028124 NHLRC3 NHL repeat containing 3 1 2
MIRT028125 ANKRD29 ankyrin repeat domain 29 1 1
MIRT028126 STYX serine/threonine/tyrosine interacting protein 1 1
MIRT028127 PAPOLA poly(A) polymerase alpha 1 1
MIRT028128 ACPL2 2-phosphoxylose phosphatase 1 1 1
MIRT028129 MLLT6 MLLT6, PHD finger containing 1 1
MIRT028130 CD164 CD164 molecule 1 1
MIRT028131 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT028132 KLF11 Kruppel like factor 11 1 1
MIRT028133 TAF6 TATA-box binding protein associated factor 6 1 1
MIRT028134 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 3
MIRT028135 UBE2J1 ubiquitin conjugating enzyme E2 J1 1 1
MIRT028136 CAV2 caveolin 2 1 1
MIRT028137 VLDLR very low density lipoprotein receptor 1 1
MIRT028138 WIZ widely interspaced zinc finger motifs 1 1
MIRT028139 C1orf63 arginine and serine rich protein 1 1 2
MIRT028140 PHF10 PHD finger protein 10 1 1
MIRT028141 RRAS2 RAS related 2 2 2
MIRT028142 ZBTB41 zinc finger and BTB domain containing 41 1 1
MIRT028143 SRSF2 serine and arginine rich splicing factor 2 2 5
MIRT028144 WDR26 WD repeat domain 26 1 1
MIRT028145 CPPED1 calcineurin like phosphoesterase domain containing 1 1 1
MIRT028146 F3 coagulation factor III, tissue factor 2 8
MIRT028147 MED12L mediator complex subunit 12 like 1 1
MIRT028148 PDE3B phosphodiesterase 3B 1 1
MIRT028149 NUAK1 NUAK family kinase 1 1 1
MIRT028150 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 4
MIRT028151 TSG101 tumor susceptibility 101 2 6
MIRT028152 EZH1 enhancer of zeste 1 polycomb repressive complex 2 subunit 1 2
MIRT028153 ZNF143 zinc finger protein 143 1 1
MIRT028154 ZNF217 zinc finger protein 217 1 1
MIRT028155 ARL1 ADP ribosylation factor like GTPase 1 1 2
MIRT028156 FKBP7 FK506 binding protein 7 1 1
MIRT028157 RNF145 ring finger protein 145 1 1
MIRT028158 CERS2 ceramide synthase 2 1 1
MIRT028159 SLC5A3 solute carrier family 5 member 3 2 4
MIRT028160 TRIP10 thyroid hormone receptor interactor 10 4 4
MIRT028161 AGO1 argonaute 1, RISC catalytic component 1 3
MIRT028162 PCID2 PCI domain containing 2 1 1
MIRT028163 DCTN4 dynactin subunit 4 1 1
MIRT028164 MAN1C1 mannosidase alpha class 1C member 1 1 1
MIRT028165 UBR1 ubiquitin protein ligase E3 component n-recognin 1 1 1
MIRT028166 MED13L mediator complex subunit 13 like 1 1
MIRT028167 PRUNE2 prune homolog 2 1 1
MIRT028168 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT028169 SGMS1 sphingomyelin synthase 1 2 3
MIRT028170 DSTYK dual serine/threonine and tyrosine protein kinase 1 1
MIRT028171 C18orf32 chromosome 18 open reading frame 32 2 2
MIRT028172 EPHA7 EPH receptor A7 1 1
MIRT028173 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 2
MIRT028174 IKZF4 IKAROS family zinc finger 4 1 1
MIRT028175 HEG1 heart development protein with EGF like domains 1 1 1
MIRT028176 FEM1C fem-1 homolog C 2 9
MIRT028177 CDC37L1 cell division cycle 37 like 1 1 1
MIRT028178 STAT3 signal transducer and activator of transcription 3 1 2
MIRT028179 ZNF148 zinc finger protein 148 1 1
MIRT028180 PGM2L1 phosphoglucomutase 2 like 1 1 2
MIRT028181 EFCAB14 EF-hand calcium binding domain 14 2 3
MIRT048739 ZIC2 Zic family member 2 1 1
MIRT048740 POLR2A RNA polymerase II subunit A 1 1
MIRT048741 SET SET nuclear proto-oncogene 1 1
MIRT048742 MTSS1L MTSS1L, I-BAR domain containing 1 1
MIRT048743 MICALL1 MICAL like 1 1 1
MIRT048744 GRSF1 G-rich RNA sequence binding factor 1 1 1
MIRT048745 RAB8B RAB8B, member RAS oncogene family 1 1
MIRT048746 UBE2M ubiquitin conjugating enzyme E2 M 1 1
MIRT048747 ZC3H7A zinc finger CCCH-type containing 7A 1 1
MIRT048748 PGAM1 phosphoglycerate mutase 1 1 1
MIRT048749 BAZ2A bromodomain adjacent to zinc finger domain 2A 1 1
MIRT048750 DZIP3 DAZ interacting zinc finger protein 3 1 1
MIRT048751 KPNA2 karyopherin subunit alpha 2 2 12
MIRT048752 ITPA inosine triphosphatase 1 1
MIRT048753 FAM3C family with sequence similarity 3 member C 1 1
MIRT048754 ELAVL1 ELAV like RNA binding protein 1 1 1
MIRT048755 TAF8 TATA-box binding protein associated factor 8 1 1
MIRT048756 AP2A2 adaptor related protein complex 2 alpha 2 subunit 1 1
MIRT048757 RPL7A ribosomal protein L7a 1 1
MIRT048758 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT048759 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT048760 ZBTB7A zinc finger and BTB domain containing 7A 2 4
MIRT048761 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT048762 SEC23IP SEC23 interacting protein 1 1
MIRT048763 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT048764 RPL9 ribosomal protein L9 1 1
MIRT048765 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT048766 MOB1A MOB kinase activator 1A 1 1
MIRT048767 STX16 syntaxin 16 1 1
MIRT048768 CDHR1 cadherin related family member 1 1 1
MIRT048769 C6orf62 chromosome 6 open reading frame 62 1 1
MIRT048770 TRAM1 translocation associated membrane protein 1 1 1
MIRT048771 MFN2 mitofusin 2 1 1
MIRT048772 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT048773 RPL30 ribosomal protein L30 1 1
MIRT048774 CTC1 CST telomere replication complex component 1 1 1
MIRT048775 CAP1 cyclase associated actin cytoskeleton regulatory protein 1 1 1
MIRT048776 NONO non-POU domain containing octamer binding 1 1
MIRT048777 DNMT3B DNA methyltransferase 3 beta 1 1
MIRT048778 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 1 1
MIRT048779 RBM23 RNA binding motif protein 23 1 1
MIRT048780 UBAP2L ubiquitin associated protein 2 like 1 1
MIRT048781 RPL27 ribosomal protein L27 1 1
MIRT048782 HIST3H2A histone cluster 3 H2A 1 1
MIRT048783 HDDC2 HD domain containing 2 1 1
MIRT048784 GRID2IP Grid2 interacting protein 1 1
MIRT048785 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 1 1
MIRT048786 PRKCI protein kinase C iota 1 1
MIRT048787 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT048788 CBX3 chromobox 3 1 1
MIRT048789 FAH fumarylacetoacetate hydrolase 1 1
MIRT048790 RIF1 replication timing regulatory factor 1 1 1
MIRT048791 ZSWIM1 zinc finger SWIM-type containing 1 1 1
MIRT048792 POLE DNA polymerase epsilon, catalytic subunit 1 1
MIRT048793 LRP3 LDL receptor related protein 3 1 1
MIRT048794 CCT8 chaperonin containing TCP1 subunit 8 1 1
MIRT048795 KIAA1191 KIAA1191 2 6
MIRT048796 GPS1 G protein pathway suppressor 1 1 1
MIRT048797 BAG2 BCL2 associated athanogene 2 1 1
MIRT048798 ARHGAP32 Rho GTPase activating protein 32 1 1
MIRT048799 SLC19A1 solute carrier family 19 member 1 1 1
MIRT048800 NUBP1 nucleotide binding protein 1 1 1
MIRT048801 ARL9 ADP ribosylation factor like GTPase 9 1 1
MIRT048802 PSMD11 proteasome 26S subunit, non-ATPase 11 1 1
MIRT048803 UBE2O ubiquitin conjugating enzyme E2 O 1 1
MIRT048804 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT048805 APBB2 amyloid beta precursor protein binding family B member 2 1 1
MIRT048806 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT048807 H1F0 H1 histone family member 0 1 1
MIRT048808 PRPF8 pre-mRNA processing factor 8 1 1
MIRT048809 DVL3 dishevelled segment polarity protein 3 1 1
MIRT048810 MAP3K13 mitogen-activated protein kinase kinase kinase 13 1 1
MIRT048811 RPS6KA5 ribosomal protein S6 kinase A5 2 5
MIRT048812 TAF4 TATA-box binding protein associated factor 4 1 1
MIRT048813 HIST1H3B histone cluster 1 H3 family member b 1 1
MIRT048814 TBCC tubulin folding cofactor C 1 1
MIRT048815 FASN fatty acid synthase 1 1
MIRT048816 RFC3 replication factor C subunit 3 1 1
MIRT048817 CCDC88C coiled-coil domain containing 88C 1 1
MIRT048818 ZNF384 zinc finger protein 384 1 1
MIRT048819 APLP2 amyloid beta precursor like protein 2 1 1
MIRT048820 NOB1 NIN1/PSMD8 binding protein 1 homolog 1 1
MIRT048821 JUN Jun proto-oncogene, AP-1 transcription factor subunit 1 1
MIRT048822 PGP phosphoglycolate phosphatase 1 1
MIRT048823 XBP1 X-box binding protein 1 1 1
MIRT048824 NBPF15 NBPF member 15 1 1
MIRT048825 VAT1 vesicle amine transport 1 1 1
MIRT048826 PPTC7 PTC7 protein phosphatase homolog 1 1
MIRT048827 IPO5 importin 5 1 1
MIRT048828 HIST2H4B histone cluster 2 H4 family member b 1 1
MIRT048829 IP6K1 inositol hexakisphosphate kinase 1 1 1
MIRT048830 ARPC2 actin related protein 2/3 complex subunit 2 1 1
MIRT048831 KIAA1279 KIF1 binding protein 1 1
MIRT048832 PIK3R2 phosphoinositide-3-kinase regulatory subunit 2 1 1
MIRT048833 SMG7 SMG7, nonsense mediated mRNA decay factor 1 1
MIRT048834 ELAC2 elaC ribonuclease Z 2 1 1
MIRT048835 NUP153 nucleoporin 153 1 1
MIRT048836 NUP205 nucleoporin 205 1 1
MIRT048837 MYO9B myosin IXB 1 1
MIRT048838 MAD2L1 mitotic arrest deficient 2 like 1 1 1
MIRT048839 SND1 staphylococcal nuclease and tudor domain containing 1 1 1
MIRT048840 MCM5 minichromosome maintenance complex component 5 1 1
MIRT048841 RNF44 ring finger protein 44 1 1
MIRT048842 IGF2 insulin like growth factor 2 1 1
MIRT048843 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT048844 PI4KA phosphatidylinositol 4-kinase alpha 1 1
MIRT048845 HIST2H3A histone cluster 2 H3 family member a 1 1
MIRT048846 MAP3K4 mitogen-activated protein kinase kinase kinase 4 1 1
MIRT048847 N4BP1 NEDD4 binding protein 1 1 2
MIRT048848 GARS glycyl-tRNA synthetase 1 1
MIRT048849 CLN8 CLN8, transmembrane ER and ERGIC protein 1 1
MIRT048850 PSMD4 proteasome 26S subunit, non-ATPase 4 1 1
MIRT048851 NUP188 nucleoporin 188 1 1
MIRT048852 TRAK1 trafficking kinesin protein 1 1 1
MIRT048853 NR4A1 nuclear receptor subfamily 4 group A member 1 1 1
MIRT048854 DCTN1 dynactin subunit 1 1 1
MIRT048855 PAPD7 poly(A) RNA polymerase D7, non-canonical 1 1
MIRT048856 TRIM65 tripartite motif containing 65 1 1
MIRT048857 UPF1 UPF1, RNA helicase and ATPase 1 1
MIRT048858 SPATA2 spermatogenesis associated 2 1 1
MIRT048859 AP1AR adaptor related protein complex 1 associated regulatory protein 1 1
MIRT048860 NTHL1 nth like DNA glycosylase 1 1 1
MIRT048861 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT048862 MARK2 microtubule affinity regulating kinase 2 1 1
MIRT048863 SLC29A2 solute carrier family 29 member 2 1 1
MIRT048864 ZBTB3 zinc finger and BTB domain containing 3 1 1
MIRT048865 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 3
MIRT048866 SEC16A SEC16 homolog A, endoplasmic reticulum export factor 1 2
MIRT048867 XYLT2 xylosyltransferase 2 1 1
MIRT048868 ZCCHC14 zinc finger CCHC-type containing 14 1 1
MIRT048869 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 1 1
MIRT048870 UBN1 ubinuclein 1 1 1
MIRT048871 UNC45A unc-45 myosin chaperone A 1 1
MIRT048872 VAMP7 vesicle associated membrane protein 7 1 1
MIRT048873 KIAA1715 lunapark, ER junction formation factor 1 1
MIRT048874 ANAPC5 anaphase promoting complex subunit 5 1 1
MIRT048875 NPM1 nucleophosmin 1 1 1
MIRT048876 SLC9A6 solute carrier family 9 member A6 1 1
MIRT048877 ZNF706 zinc finger protein 706 1 1
MIRT048878 PYGL glycogen phosphorylase L 1 1
MIRT048879 ZNFX1 zinc finger NFX1-type containing 1 2 6
MIRT048880 TLE3 transducin like enhancer of split 3 1 1
MIRT048881 LOXL1 lysyl oxidase like 1 1 1
MIRT048882 MPG N-methylpurine DNA glycosylase 1 1
MIRT048883 IBA57 IBA57 homolog, iron-sulfur cluster assembly 1 1
MIRT048884 KLHDC2 kelch domain containing 2 1 1
MIRT048885 HDGF heparin binding growth factor 1 1
MIRT048886 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT048887 SH3BP4 SH3 domain binding protein 4 1 1
MIRT048888 DAPK3 death associated protein kinase 3 1 1
MIRT048889 CRELD2 cysteine rich with EGF like domains 2 1 1
MIRT048890 CCDC47 coiled-coil domain containing 47 1 1
MIRT048891 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 2
MIRT048892 RMND5B required for meiotic nuclear division 5 homolog B 1 1
MIRT048893 TELO2 telomere maintenance 2 1 1
MIRT048894 HK1 hexokinase 1 1 1
MIRT048895 TYSND1 trypsin domain containing 1 1 1
MIRT048896 ERLIN2 ER lipid raft associated 2 1 1
MIRT048897 TRPC4AP transient receptor potential cation channel subfamily C member 4 associated protein 1 1
MIRT048898 FAM57A family with sequence similarity 57 member A 1 2
MIRT048899 ICAM4 intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) 1 1
MIRT048900 ATP6 ATP synthase F0 subunit 6 1 1
MIRT048901 RNF220 ring finger protein 220 1 1
MIRT048902 SMG6 SMG6, nonsense mediated mRNA decay factor 1 1
MIRT048903 KLB klotho beta 1 1
MIRT048904 HPS1 HPS1, biogenesis of lysosomal organelles complex 3 subunit 1 1 1
MIRT048905 MED21 mediator complex subunit 21 1 1
MIRT048906 NBEAL2 neurobeachin like 2 1 1
MIRT048907 ZNF76 zinc finger protein 76 1 1
MIRT048908 UQCRC1 ubiquinol-cytochrome c reductase core protein I 1 1
MIRT048909 GLI3 GLI family zinc finger 3 1 1
MIRT048910 CDC16 cell division cycle 16 1 1
MIRT048911 EAPP E2F associated phosphoprotein 1 1
MIRT048912 PPAN peter pan homolog (Drosophila) 1 1
MIRT048913 WAC WW domain containing adaptor with coiled-coil 2 7
MIRT048914 TRIM8 tripartite motif containing 8 1 2
MIRT052990 Sp7 Sp7 transcription factor 7 2 1
MIRT053085 SLC2A4 solute carrier family 2 member 4 3 1
MIRT053624 ATG16L1 autophagy related 16 like 1 3 2
MIRT053634 DAB2 DAB2, clathrin adaptor protein 4 1
MIRT053874 SMAD7 SMAD family member 7 3 1
MIRT054116 UNKL unkempt family like zinc finger 1 1
MIRT054255 ZBTB4 zinc finger and BTB domain containing 4 5 8
MIRT055021 TPRG1L tumor protein p63 regulated 1 like 2 3
MIRT055384 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT055650 WDR37 WD repeat domain 37 1 1
MIRT056477 PFKP phosphofructokinase, platelet 2 9
MIRT057385 TNKS2 tankyrase 2 2 3
MIRT057823 SLC30A7 solute carrier family 30 member 7 2 2
MIRT058913 FAM46C family with sequence similarity 46 member C 1 1
MIRT060076 TMEM138 transmembrane protein 138 1 1
MIRT060498 PPP6R3 protein phosphatase 6 regulatory subunit 3 2 2
MIRT060679 KLHL20 kelch like family member 20 1 1
MIRT061182 MED17 mediator complex subunit 17 2 3
MIRT061354 WEE1 WEE1 G2 checkpoint kinase 2 3
MIRT063055 ULK1 unc-51 like autophagy activating kinase 1 2 2
MIRT063436 SKI SKI proto-oncogene 1 1
MIRT064436 GPR137B G protein-coupled receptor 137B 2 4
MIRT064798 ZBTB18 zinc finger and BTB domain containing 18 2 3
MIRT065365 TMBIM6 transmembrane BAX inhibitor motif containing 6 1 1
MIRT065671 ACVR1B activin A receptor type 1B 2 6
MIRT065859 GDF11 growth differentiation factor 11 2 2
MIRT067230 FOXJ2 forkhead box J2 2 2
MIRT070742 HIF1A hypoxia inducible factor 1 alpha subunit 6 3
MIRT070840 EIF2S1 eukaryotic translation initiation factor 2 subunit alpha 2 4
MIRT070996 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT071325 CMPK1 cytidine/uridine monophosphate kinase 1 1 1
MIRT071904 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT072568 USP3 ubiquitin specific peptidase 3 1 1
MIRT073118 UBE2Q2 ubiquitin conjugating enzyme E2 Q2 1 1
MIRT073377 ABHD2 abhydrolase domain containing 2 1 1
MIRT073408 SEMA4B semaphorin 4B 1 1
MIRT074790 CYLD CYLD lysine 63 deubiquitinase 1 1
MIRT074892 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT075776 KIAA0513 KIAA0513 2 6
MIRT076178 GID4 GID complex subunit 4 homolog 2 5
MIRT077065 KRT10 keratin 10 2 8
MIRT077832 MINK1 misshapen like kinase 1 2 3
MIRT078812 UNK unkempt family zinc finger 2 2
MIRT079345 CCDC137 coiled-coil domain containing 137 2 3
MIRT079412 FOXK2 forkhead box K2 2 5
MIRT079773 CABLES1 Cdk5 and Abl enzyme substrate 1 2 2
MIRT080849 RAB12 RAB12, member RAS oncogene family 1 1
MIRT082292 FNBP1L formin binding protein 1 like 2 6
MIRT083740 PARD6B par-6 family cell polarity regulator beta 1 1
MIRT083961 RAB22A RAB22A, member RAS oncogene family 2 5
MIRT084345 RRM2 ribonucleotide reductase regulatory subunit M2 2 3
MIRT085868 TANC1 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 1 1
MIRT086426 NABP1 nucleic acid binding protein 1 2 7
MIRT088128 SEPT2 septin 2 2 5
MIRT090634 U2SURP U2 snRNP associated SURP domain containing 2 7
MIRT093801 KLF3 Kruppel like factor 3 2 2
MIRT093942 SLAIN2 SLAIN motif family member 2 1 1
MIRT095201 SMAD5 SMAD family member 5 1 1
MIRT095720 ANKH ANKH inorganic pyrophosphate transport regulator 2 8
MIRT095998 ATP6V0E1 ATPase H+ transporting V0 subunit e1 1 1
MIRT096309 SQSTM1 sequestosome 1 1 1
MIRT097604 POLR3G RNA polymerase III subunit G 1 1
MIRT097650 LYSMD3 LysM domain containing 3 1 1
MIRT098786 SASH1 SAM and SH3 domain containing 1 2 1
MIRT098905 SNX9 sorting nexin 9 2 1
MIRT099309 QKI QKI, KH domain containing RNA binding 2 4
MIRT099356 C6ORF120 chromosome 6 open reading frame 120 1 1
MIRT099825 SOX4 SRY-box 4 2 10
MIRT100278 MICB MHC class I polypeptide-related sequence B 1 1
MIRT100455 ZBTB9 zinc finger and BTB domain containing 9 1 1
MIRT100946 CENPQ centromere protein Q 2 4
MIRT102222 HBP1 HMG-box transcription factor 1 2 3
MIRT102295 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 10
MIRT103191 SP4 Sp4 transcription factor 2 6
MIRT104162 PHTF2 putative homeodomain transcription factor 2 2 6
MIRT104397 ANKIB1 ankyrin repeat and IBR domain containing 1 1 1
MIRT108720 XIAP X-linked inhibitor of apoptosis 2 2
MIRT110268 GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 1 1
MIRT112090 TIMM17A translocase of inner mitochondrial membrane 17A 2 6
MIRT115781 CAPN15 calpain 15 2 2
MIRT121801 GRPEL2 GrpE like 2, mitochondrial 1 1
MIRT122364 RGMB repulsive guidance molecule family member b 2 4
MIRT124126 GINS4 GINS complex subunit 4 2 4
MIRT126309 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT126345 ZRANB1 zinc finger RANBP2-type containing 1 1 1
MIRT126551 MASTL microtubule associated serine/threonine kinase like 2 3
MIRT127162 VPS26A VPS26, retromer complex component A 1 1
MIRT130073 TXNIP thioredoxin interacting protein 2 5
MIRT132395 PPP1R12B protein phosphatase 1 regulatory subunit 12B 1 1
MIRT133314 ORAI1 ORAI calcium release-activated calcium modulator 1 1 1
MIRT134276 DNM1L dynamin 1 like 1 1
MIRT135707 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 1 1
MIRT135794 GNS glucosamine (N-acetyl)-6-sulfatase 2 7
MIRT136563 TXLNA taxilin alpha 1 1
MIRT138112 BRMS1L breast cancer metastasis-suppressor 1 like 1 1
MIRT138351 FRMD6 FERM domain containing 6 1 1
MIRT138794 SUSD6 sushi domain containing 6 1 1
MIRT140631 PLEKHO2 pleckstrin homology domain containing O2 1 1
MIRT140798 SMAD6 SMAD family member 6 1 1
MIRT141127 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT141699 RCCD1 RCC1 domain containing 1 1 1
MIRT142096 CCP110 centriolar coiled-coil protein 110 1 1
MIRT142384 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT144210 SNTB2 syntrophin beta 2 1 1
MIRT144298 NFAT5 nuclear factor of activated T-cells 5 2 9
MIRT144979 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 1 1
MIRT145021 TNFAIP1 TNF alpha induced protein 1 1 1
MIRT145598 LASP1 LIM and SH3 protein 1 2 3
MIRT146072 RUNDC1 RUN domain containing 1 1 1
MIRT147119 MAP3K3 mitogen-activated protein kinase kinase kinase 3 1 1
MIRT147922 CAMTA1 calmodulin binding transcription activator 1 1 1
MIRT148869 ANKRD12 ankyrin repeat domain 12 1 1
MIRT151693 CHAF1A chromatin assembly factor 1 subunit A 1 1
MIRT151801 BLOC1S3 biogenesis of lysosomal organelles complex 1 subunit 3 1 1
MIRT151854 ARHGAP35 Rho GTPase activating protein 35 1 1
MIRT151935 TBC1D17 TBC1 domain family member 17 1 1
MIRT152368 ARHGEF18 Rho/Rac guanine nucleotide exchange factor 18 1 1
MIRT152674 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT153328 MAVS mitochondrial antiviral signaling protein 2 4
MIRT153455 TTPAL alpha tocopherol transfer protein like 1 1
MIRT153614 NCOA3 nuclear receptor coactivator 3 1 1
MIRT153970 PRNP prion protein 2 3
MIRT155234 IFNAR2 interferon alpha and beta receptor subunit 2 1 1
MIRT155334 IFNAR1 interferon alpha and beta receptor subunit 1 1 1
MIRT155889 SIK1 salt inducible kinase 1 2 2
MIRT156406 RAPGEF4 Rap guanine nucleotide exchange factor 4 1 1
MIRT156643 C2ORF69 chromosome 2 open reading frame 69 1 1
MIRT157146 FAM117B family with sequence similarity 117 member B 1 1
MIRT157586 MTMR3 myotubularin related protein 3 1 1
MIRT158574 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT159108 NRBP1 nuclear receptor binding protein 1 2 3
MIRT159400 FEZ2 fasciculation and elongation protein zeta 2 1 1
MIRT160005 TET3 tet methylcytosine dioxygenase 3 1 1
MIRT160842 PLXNA1 plexin A1 1 1
MIRT164200 GAB1 GRB2 associated binding protein 1 1 1
MIRT164525 MSMO1 methylsterol monooxygenase 1 4 4
MIRT164660 WHSC1 nuclear receptor binding SET domain protein 2 1 1
MIRT164721 ADD1 adducin 1 1 1
MIRT166063 FAF2 Fas associated factor family member 2 1 1
MIRT167841 HECA hdc homolog, cell cycle regulator 1 1
MIRT168217 BTN3A2 butyrophilin subfamily 3 member A2 1 1
MIRT168279 BTN3A1 butyrophilin subfamily 3 member A1 1 1
MIRT169664 AGFG2 ArfGAP with FG repeats 2 1 1
MIRT170566 CASP2 caspase 2 1 1
MIRT172198 OXR1 oxidation resistance 1 1 1
MIRT173113 E2F5 E2F transcription factor 5 1 1
MIRT173690 PRPF4 pre-mRNA processing factor 4 1 1
MIRT175380 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT175596 OCRL OCRL, inositol polyphosphate-5-phosphatase 1 1
MIRT175645 PHF6 PHD finger protein 6 1 1
MIRT176083 CHIC1 cysteine rich hydrophobic domain 1 1 1
MIRT182518 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT187473 PCBP2 poly(rC) binding protein 2 2 4
MIRT194850 UBFD1 ubiquitin family domain containing 1 1 1
MIRT199107 ZNF532 zinc finger protein 532 2 2
MIRT205047 CREB1 cAMP responsive element binding protein 1 2 2
MIRT205282 STK11IP serine/threonine kinase 11 interacting protein 2 2
MIRT206193 RAB10 RAB10, member RAS oncogene family 2 4
MIRT208976 SKIL SKI like proto-oncogene 2 10
MIRT213204 REST RE1 silencing transcription factor 2 2
MIRT213322 KIAA0232 KIAA0232 2 2
MIRT216424 SERF1A small EDRK-rich factor 1A 2 2
MIRT216449 SERF1B small EDRK-rich factor 1B 2 2
MIRT216662 F2R coagulation factor II thrombin receptor 2 2
MIRT220120 CAV1 caveolin 1 2 2
MIRT222674 EIF4H eukaryotic translation initiation factor 4H 2 6
MIRT222909 CROT carnitine O-octanoyltransferase 1 1
MIRT224748 DPYSL2 dihydropyrimidinase like 2 2 2
MIRT224886 MAK16 MAK16 homolog 1 1
MIRT227327 TRIM32 tripartite motif containing 32 1 1
MIRT230966 PRRG4 proline rich and Gla domain 4 2 2
MIRT238173 ANKRD33B ankyrin repeat domain 33B 2 10
MIRT242197 TTC9 tetratricopeptide repeat domain 9 2 4
MIRT242658 SALL3 spalt like transcription factor 3 2 4
MIRT243779 AFF1 AF4/FMR2 family member 1 1 1
MIRT244163 E2F3 E2F transcription factor 3 1 1
MIRT244589 HOOK3 hook microtubule tethering protein 3 2 2
MIRT246961 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT247080 CEP57 centrosomal protein 57 1 1
MIRT248851 SESN2 sestrin 2 1 1
MIRT250445 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 1 1
MIRT254250 TRAPPC10 trafficking protein particle complex 10 1 1
MIRT257280 FOXC1 forkhead box C1 2 2
MIRT266050 FJX1 four jointed box 1 2 4
MIRT266854 SLC25A44 solute carrier family 25 member 44 2 2
MIRT280208 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT283173 C16ORF52 chromosome 16 open reading frame 52 2 2
MIRT286947 SOCS7 suppressor of cytokine signaling 7 2 2
MIRT289573 KDM6B lysine demethylase 6B 6 3
MIRT291932 TPM4 tropomyosin 4 2 2
MIRT293646 PVR poliovirus receptor 2 4
MIRT296869 REV1 REV1, DNA directed polymerase 1 1
MIRT296914 NPAS2 neuronal PAS domain protein 2 2 1
MIRT299338 CYBRD1 cytochrome b reductase 1 1 1
MIRT302435 CLIP4 CAP-Gly domain containing linker protein family member 4 2 2
MIRT303490 NAGK N-acetylglucosamine kinase 2 6
MIRT322521 HMBOX1 homeobox containing 1 2 2
MIRT325511 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT363923 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT368883 BCL2L2 BCL2 like 2 2 2
MIRT397685 ATXN7L3B ataxin 7 like 3B 2 2
MIRT400047 ADRBK2 G protein-coupled receptor kinase 3 2 2
MIRT437749 MXD1 MAX dimerization protein 1 2 1
MIRT437750 SLC16A9 solute carrier family 16 member 9 3 2
MIRT437751 MGLL monoglyceride lipase 2 1
MIRT437752 SNX16 sorting nexin 16 2 1
MIRT437753 EREG epiregulin 2 1
MIRT438035 ICAM1 intercellular adhesion molecule 1 1 1
MIRT438036 WNT2B Wnt family member 2B 1 1
MIRT438037 MYC MYC proto-oncogene, bHLH transcription factor 1 2
MIRT438038 HLA-F major histocompatibility complex, class I, F 1 1
MIRT438039 TGFB1 transforming growth factor beta 1 1 1
MIRT438087 IL8 C-X-C motif chemokine ligand 8 2 1
MIRT441876 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 2 2
MIRT442198 CCDC132 VPS50, EARP/GARPII complex subunit 2 2
MIRT442547 SLCO5A1 solute carrier organic anion transporter family member 5A1 2 2
MIRT442765 NRIP3 nuclear receptor interacting protein 3 2 2
MIRT442807 CEP170 centrosomal protein 170 2 4
MIRT443254 A1CF APOBEC1 complementation factor 2 2
MIRT443708 LLPH LLP homolog, long-term synaptic facilitation 2 2
MIRT444307 SREK1IP1 SREK1 interacting protein 1 2 2
MIRT444433 EMC1 ER membrane protein complex subunit 1 2 2
MIRT448320 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT448368 TSR1 TSR1, ribosome maturation factor 2 6
MIRT448641 NPNT nephronectin 2 2
MIRT448724 ITGA2 integrin subunit alpha 2 2 2
MIRT449169 SORCS2 sortilin related VPS10 domain containing receptor 2 2 2
MIRT450185 TMEM9B TMEM9 domain family member B 2 2
MIRT450918 CADM2 cell adhesion molecule 2 2 2
MIRT450953 ATAD2 ATPase family, AAA domain containing 2 2 2
MIRT458289 FUT10 fucosyltransferase 10 2 2
MIRT462123 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT463550 ZBTB5 zinc finger and BTB domain containing 5 2 4
MIRT464850 RPS27A ribosomal protein S27a 2 12
MIRT465535 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465840 TMEM64 transmembrane protein 64 2 3
MIRT466451 TFAM transcription factor A, mitochondrial 2 8
MIRT467491 SMIM13 small integral membrane protein 13 2 6
MIRT467897 SLC22A23 solute carrier family 22 member 23 2 2
MIRT468157 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT469856 PXK PX domain containing serine/threonine kinase like 2 8
MIRT470057 PTGFRN prostaglandin F2 receptor inhibitor 2 2
MIRT471007 PITPNA phosphatidylinositol transfer protein alpha 2 2
MIRT472057 NPAT nuclear protein, coactivator of histone transcription 2 3
MIRT472343 NETO2 neuropilin and tolloid like 2 2 4
MIRT473166 MLLT1 MLLT1, super elongation complex subunit 2 2
MIRT473810 MAP3K2 mitogen-activated protein kinase kinase kinase 2 5 3
MIRT473911 M6PR mannose-6-phosphate receptor, cation dependent 2 9
MIRT474595 KLF6 Kruppel like factor 6 2 2
MIRT475475 HSPA8 heat shock protein family A (Hsp70) member 8 2 6
MIRT476129 GPR157 G protein-coupled receptor 157 2 6
MIRT477114 FAM160B1 family with sequence similarity 160 member B1 2 6
MIRT477282 ERGIC2 ERGIC and golgi 2 2 2
MIRT478726 CSNK1A1 casein kinase 1 alpha 1 2 4
MIRT479036 COIL coilin 2 10
MIRT479063 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 8
MIRT479264 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT480569 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT480672 BSCL2 BSCL2, seipin lipid droplet biogenesis associated 2 2
MIRT480783 BMP2 bone morphogenetic protein 2 2 2
MIRT480952 BBX BBX, HMG-box containing 2 8
MIRT481345 ATL3 atlastin GTPase 3 2 3
MIRT481884 ANKRD50 ankyrin repeat domain 50 2 2
MIRT484869 ZNF70 zinc finger protein 70 2 4
MIRT484882 ZNF652 zinc finger protein 652 2 2
MIRT484918 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485099 SLC30A1 solute carrier family 30 member 1 2 4
MIRT485189 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 4
MIRT485334 MYO1D myosin ID 2 2
MIRT485584 FOXQ1 forkhead box Q1 2 2
MIRT486025 LPAR2 lysophosphatidic acid receptor 2 2 2
MIRT489603 ZDHHC20 zinc finger DHHC-type containing 20 2 10
MIRT491803 ZFYVE21 zinc finger FYVE-type containing 21 2 8
MIRT492007 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT492379 SEMA7A semaphorin 7A (John Milton Hagen blood group) 2 2
MIRT492785 PDGFB platelet derived growth factor subunit B 2 2
MIRT493126 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 7
MIRT493344 LAPTM4A lysosomal protein transmembrane 4 alpha 2 13
MIRT493614 HMGB3 high mobility group box 3 2 6
MIRT494075 DUSP2 dual specificity phosphatase 2 2 4
MIRT494434 BTG2 BTG anti-proliferation factor 2 5 5
MIRT496060 MORC1 MORC family CW-type zinc finger 1 2 2
MIRT500720 TRIM37 tripartite motif containing 37 2 2
MIRT502053 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 2 6
MIRT502375 GIGYF1 GRB10 interacting GYF protein 1 2 9
MIRT502401 GATA6 GATA binding protein 6 2 8
MIRT503077 C11orf30 EMSY, BRCA2 interacting transcriptional repressor 2 9
MIRT503219 ACER2 alkaline ceramidase 2 2 2
MIRT503558 MDM2 MDM2 proto-oncogene 2 4
MIRT503606 ZNF780A zinc finger protein 780A 2 2
MIRT503803 ZNF12 zinc finger protein 12 2 7
MIRT503825 TMEM242 transmembrane protein 242 2 4
MIRT504096 C9orf40 chromosome 9 open reading frame 40 2 7
MIRT504637 MFSD8 major facilitator superfamily domain containing 8 2 6
MIRT505863 POLR1B RNA polymerase I subunit B 2 4
MIRT506278 PDPK1 3-phosphoinositide dependent protein kinase 1 2 2
MIRT506548 MORF4L1 mortality factor 4 like 1 2 8
MIRT506618 MARCH6 membrane associated ring-CH-type finger 6 2 8
MIRT506662 MAPK1 mitogen-activated protein kinase 1 2 5
MIRT506682 LZIC leucine zipper and CTNNBIP1 domain containing 2 4
MIRT506852 KIF23 kinesin family member 23 2 5
MIRT506871 KIAA1147 KIAA1147 2 2
MIRT506883 KIAA0101 PCNA clamp associated factor 2 4
MIRT506987 HNRNPR heterogeneous nuclear ribonucleoprotein R 2 2
MIRT507202 FZD9 frizzled class receptor 9 2 6
MIRT507435 ELK4 ELK4, ETS transcription factor 2 4
MIRT507943 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT508572 CEP72 centrosomal protein 72 2 4
MIRT508741 ZNF682 zinc finger protein 682 2 4
MIRT508833 GPR155 G protein-coupled receptor 155 2 2
MIRT509126 BMP8B bone morphogenetic protein 8b 2 6
MIRT509741 EFCAB11 EF-hand calcium binding domain 11 2 4
MIRT510025 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 4
MIRT510875 RAN RAN, member RAS oncogene family 2 9
MIRT511084 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 5
MIRT511260 KLHL36 kelch like family member 36 2 6
MIRT511316 KIAA1551 KIAA1551 2 2
MIRT511552 HMGB1 high mobility group box 1 2 6
MIRT513463 NARS asparaginyl-tRNA synthetase 2 6
MIRT513708 RBM20 RNA binding motif protein 20 2 4
MIRT513755 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT513989 CEP97 centrosomal protein 97 2 3
MIRT514097 EPS15L1 epidermal growth factor receptor pathway substrate 15 like 1 2 6
MIRT514133 SERF2 small EDRK-rich factor 2 2 2
MIRT514316 FXYD5 FXYD domain containing ion transport regulator 5 2 6
MIRT514994 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 2 2
MIRT515201 CRCP CGRP receptor component 2 2
MIRT515571 TMEM134 transmembrane protein 134 2 2
MIRT516056 MED18 mediator complex subunit 18 2 2
MIRT516367 GABPB1 GA binding protein transcription factor beta subunit 1 2 3
MIRT516555 MIXL1 Mix paired-like homeobox 2 2
MIRT516795 PTRF caveolae associated protein 1 2 4
MIRT517017 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT517183 SLC28A1 solute carrier family 28 member 1 2 2
MIRT517256 PRIM1 DNA primase subunit 1 2 4
MIRT518313 ZNF514 zinc finger protein 514 2 4
MIRT518464 KIF6 kinesin family member 6 2 2
MIRT518695 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT518800 MED16 mediator complex subunit 16 2 4
MIRT518859 NEK8 NIMA related kinase 8 2 2
MIRT518968 GRK7 G protein-coupled receptor kinase 7 2 2
MIRT519428 KCNA7 potassium voltage-gated channel subfamily A member 7 2 4
MIRT519544 TMEM38A transmembrane protein 38A 2 2
MIRT520078 YIPF4 Yip1 domain family member 4 2 2
MIRT520152 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT521006 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT521302 RRAGD Ras related GTP binding D 2 4
MIRT521545 QSOX1 quiescin sulfhydryl oxidase 1 2 4
MIRT522168 NR2F6 nuclear receptor subfamily 2 group F member 6 2 4
MIRT522201 NR2C2 nuclear receptor subfamily 2 group C member 2 2 7
MIRT522506 MFN1 mitofusin 1 2 2
MIRT523079 HYPK huntingtin interacting protein K 2 2
MIRT523650 FOXK1 forkhead box K1 2 4
MIRT524079 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT524291 CYCS cytochrome c, somatic 2 2
MIRT524453 CNKSR3 CNKSR family member 3 2 2
MIRT524979 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT525200 ZNF93 zinc finger protein 93 2 2
MIRT525484 TPK1 thiamin pyrophosphokinase 1 2 2
MIRT525762 SOD2 superoxide dismutase 2 2 3
MIRT526635 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT527202 XIRP2 xin actin binding repeat containing 2 2 2
MIRT527255 TMEM196 transmembrane protein 196 2 2
MIRT527470 CLEC12B C-type lectin domain family 12 member B 2 4
MIRT528370 ZMYM1 zinc finger MYM-type containing 1 2 4
MIRT529999 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 4
MIRT530587 ABHD15 abhydrolase domain containing 15 2 2
MIRT530985 EXO5 exonuclease 5 2 4
MIRT531476 TNFRSF10B TNF receptor superfamily member 10b 2 4
MIRT531775 TXK TXK tyrosine kinase 2 4
MIRT532049 FHDC1 FH2 domain containing 1 2 2
MIRT532614 SPTLC2 serine palmitoyltransferase long chain base subunit 2 2 2
MIRT532929 ZNF385A zinc finger protein 385A 2 2
MIRT533877 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT534627 RNASEH1 ribonuclease H1 2 4
MIRT535029 PRKAR1A protein kinase cAMP-dependent type I regulatory subunit alpha 2 2
MIRT536445 KMT2B lysine methyltransferase 2B 2 6
MIRT536498 KIAA0922 transmembrane 131 like 2 2
MIRT536538 KCNJ8 potassium voltage-gated channel subfamily J member 8 2 2
MIRT537446 FBXL7 F-box and leucine rich repeat protein 7 2 2
MIRT537740 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT538045 DNAJB6 DnaJ heat shock protein family (Hsp40) member B6 2 2
MIRT539423 ADAT2 adenosine deaminase, tRNA specific 2 2 2
MIRT540274 FAM89A family with sequence similarity 89 member A 2 2
MIRT541098 RLIM ring finger protein, LIM domain interacting 2 2
MIRT541285 GLO1 glyoxalase I 2 3
MIRT542059 SLC25A46 solute carrier family 25 member 46 2 2
MIRT542141 DIS3L DIS3 like exosome 3'-5' exoribonuclease 2 2
MIRT542267 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT543184 FICD FIC domain containing 2 2
MIRT543507 PLS1 plastin 1 2 2
MIRT543579 RPF2 ribosome production factor 2 homolog 2 4
MIRT544628 CSDE1 cold shock domain containing E1 2 2
MIRT545202 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT546302 TMEM200C transmembrane protein 200C 2 4
MIRT546698 RORA RAR related orphan receptor A 2 4
MIRT546823 RAP2C RAP2C, member of RAS oncogene family 2 2
MIRT547081 PLRG1 pleiotropic regulator 1 2 2
MIRT548393 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT548818 CLIC4 chloride intracellular channel 4 2 4
MIRT548871 CERCAM cerebral endothelial cell adhesion molecule 2 2
MIRT549822 LUZP2 leucine zipper protein 2 2 2
MIRT550093 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT550304 ZNF681 zinc finger protein 681 2 2
MIRT551123 ZNF107 zinc finger protein 107 2 2
MIRT552204 F2RL3 F2R like thrombin or trypsin receptor 3 2 2
MIRT552685 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 4
MIRT552865 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT552895 WASL Wiskott-Aldrich syndrome like 2 4
MIRT553038 USP48 ubiquitin specific peptidase 48 2 2
MIRT553709 TCF7L2 transcription factor 7 like 2 2 2
MIRT554412 SCD stearoyl-CoA desaturase 2 2
MIRT554534 RUFY2 RUN and FYVE domain containing 2 2 2
MIRT554752 RHOC ras homolog family member C 2 2
MIRT555464 POLR3A RNA polymerase III subunit A 2 2
MIRT556165 MECP2 methyl-CpG binding protein 2 2 3
MIRT556184 MCC mutated in colorectal cancers 2 2
MIRT556592 LEPROT leptin receptor overlapping transcript 2 2
MIRT556904 ISOC1 isochorismatase domain containing 1 2 2
MIRT557030 HOXD11 homeobox D11 2 2
MIRT557592 GNPTAB N-acetylglucosamine-1-phosphate transferase alpha and beta subunits 2 2
MIRT557896 FEM1B fem-1 homolog B 2 4
MIRT558269 DYNC1LI2 dynein cytoplasmic 1 light intermediate chain 2 2 3
MIRT558340 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 4
MIRT558783 CFL2 cofilin 2 2 3
MIRT558935 CBX1 chromobox 1 2 2
MIRT561243 ZNF354B zinc finger protein 354B 2 2
MIRT562215 HMGB2 high mobility group box 2 2 2
MIRT562563 CCDC71L coiled-coil domain containing 71 like 2 4
MIRT562965 LRPAP1 LDL receptor related protein associated protein 1 2 2
MIRT563379 DSPP dentin sialophosphoprotein 2 2
MIRT564683 ZNF35 zinc finger protein 35 2 2
MIRT565707 SESN3 sestrin 3 2 2
MIRT565917 SCAMP2 secretory carrier membrane protein 2 2 3
MIRT566149 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT566887 LRP12 LDL receptor related protein 12 2 2
MIRT567057 KCNB1 potassium voltage-gated channel subfamily B member 1 2 2
MIRT567113 ITGB1 integrin subunit beta 1 2 2
MIRT567543 FGFR1OP FGFR1 oncogene partner 2 2
MIRT567685 EIF4A2 eukaryotic translation initiation factor 4A2 2 2
MIRT567924 CRK CRK proto-oncogene, adaptor protein 2 3
MIRT567992 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT568180 CCDC6 coiled-coil domain containing 6 2 2
MIRT568273 BICD2 BICD cargo adaptor 2 2 2
MIRT571015 CKAP2 cytoskeleton associated protein 2 2 2
MIRT571694 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT571724 RPL17-C18orf32 RPL17-C18orf32 readthrough 2 2
MIRT571867 NKIRAS1 NFKB inhibitor interacting Ras like 1 2 2
MIRT572676 AGMAT agmatinase 2 4
MIRT573708 RBM12B RNA binding motif protein 12B 2 3
MIRT573916 SNAP47 synaptosome associated protein 47 2 2
MIRT575214 Piwil2 piwi-like RNA-mediated gene silencing 2 2 5
MIRT575989 Fem1a feminization 1 homolog a (C. elegans) 2 4
MIRT608368 PIWIL2 piwi like RNA-mediated gene silencing 2 2 7
MIRT608748 MYH9 myosin heavy chain 9 2 2
MIRT608974 PRKCB protein kinase C beta 2 2
MIRT610999 BRI3BP BRI3 binding protein 2 4
MIRT611836 FEM1A fem-1 homolog A 2 5
MIRT612611 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT614263 WDR53 WD repeat domain 53 2 4
MIRT615176 SPIB Spi-B transcription factor 2 2
MIRT615447 FAXC failed axon connections homolog 2 2
MIRT616172 TCEB1 elongin C 2 2
MIRT616438 FAM126B family with sequence similarity 126 member B 2 3
MIRT619841 POLM DNA polymerase mu 2 4
MIRT620977 TM4SF5 transmembrane 4 L six family member 5 2 2
MIRT624433 CBX8 chromobox 8 2 2
MIRT625080 C15orf41 chromosome 15 open reading frame 41 2 2
MIRT626038 ATAT1 alpha tubulin acetyltransferase 1 2 4
MIRT626221 PNRC1 proline rich nuclear receptor coactivator 1 2 4
MIRT626930 HIST1H2BG histone cluster 1 H2B family member g 2 2
MIRT628565 MELK maternal embryonic leucine zipper kinase 2 2
MIRT633122 CBX5 chromobox 5 2 2
MIRT634098 APOH apolipoprotein H 2 2
MIRT634455 PAK6 p21 (RAC1) activated kinase 6 2 2
MIRT634646 HIP1 huntingtin interacting protein 1 2 2
MIRT634955 GTF2H2C GTF2H2 family member C 2 4
MIRT640013 OSTM1 osteopetrosis associated transmembrane protein 1 2 2
MIRT641706 SPCS1 signal peptidase complex subunit 1 2 2
MIRT641806 USP32 ubiquitin specific peptidase 32 2 3
MIRT645215 POLR3F RNA polymerase III subunit F 2 2
MIRT662407 ICA1L islet cell autoantigen 1 like 2 4
MIRT664228 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT664394 CYB5A cytochrome b5 type A 2 2
MIRT664794 LIAS lipoic acid synthetase 2 4
MIRT673134 MFSD2A major facilitator superfamily domain containing 2A 2 2
MIRT675839 DHODH dihydroorotate dehydrogenase (quinone) 2 4
MIRT677155 DEGS1 delta 4-desaturase, sphingolipid 1 2 2
MIRT677261 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT678748 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT680374 GATAD1 GATA zinc finger domain containing 1 2 4
MIRT680701 ZNF785 zinc finger protein 785 2 2
MIRT680779 WDR73 WD repeat domain 73 2 2
MIRT681411 RMND1 required for meiotic nuclear division 1 homolog 2 2
MIRT681705 ABI2 abl interactor 2 2 2
MIRT681841 N4BP2L2 NEDD4 binding protein 2 like 2 2 2
MIRT682332 RAB42 RAB42, member RAS oncogene family 2 2
MIRT683330 C19orf40 Fanconi anemia core complex associated protein 24 1 1
MIRT683400 ESR2 estrogen receptor 2 2 2
MIRT683504 ZNF7 zinc finger protein 7 2 2
MIRT683536 C11orf54 chromosome 11 open reading frame 54 2 2
MIRT683887 OCIAD1 OCIA domain containing 1 2 2
MIRT683960 MYLK3 myosin light chain kinase 3 2 2
MIRT683989 QRFPR pyroglutamylated RFamide peptide receptor 2 2
MIRT684092 TLR7 toll like receptor 7 2 2
MIRT684145 CEP104 centrosomal protein 104 2 2
MIRT684370 BCAS4 breast carcinoma amplified sequence 4 2 2
MIRT684586 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT684629 GTF2IRD2B GTF2I repeat domain containing 2B 2 2
MIRT684660 PDE4C phosphodiesterase 4C 2 2
MIRT684725 LRRD1 leucine rich repeats and death domain containing 1 2 2
MIRT684754 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT684799 MYO1F myosin IF 2 2
MIRT684931 CD28 CD28 molecule 2 2
MIRT685207 DCTN5 dynactin subunit 5 2 2
MIRT685260 F2RL1 F2R like trypsin receptor 1 2 2
MIRT685328 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT685363 CCL5 C-C motif chemokine ligand 5 2 2
MIRT685531 MSH3 mutS homolog 3 2 2
MIRT685590 KCNK6 potassium two pore domain channel subfamily K member 6 2 2
MIRT685721 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT685754 C12orf65 chromosome 12 open reading frame 65 2 2
MIRT685795 ZNF426 zinc finger protein 426 2 2
MIRT685895 RTN2 reticulon 2 2 2
MIRT685967 PTGIS prostaglandin I2 synthase 2 2
MIRT686118 TNIP3 TNFAIP3 interacting protein 3 2 2
MIRT686168 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT686295 WWC1 WW and C2 domain containing 1 2 2
MIRT686333 VPS53 VPS53, GARP complex subunit 2 2
MIRT686456 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT686510 TRIOBP TRIO and F-actin binding protein 2 2
MIRT686539 TRAF3IP2 TRAF3 interacting protein 2 2 2
MIRT686594 TMOD3 tropomodulin 3 2 2
MIRT686839 SLC7A11 solute carrier family 7 member 11 2 2
MIRT686892 SLC1A5 solute carrier family 1 member 5 2 2
MIRT686992 SERINC1 serine incorporator 1 2 2
MIRT687056 RNF115 ring finger protein 115 2 2
MIRT687091 RABGAP1L RAB GTPase activating protein 1 like 2 2
MIRT687266 PDHB pyruvate dehydrogenase E1 beta subunit 2 2
MIRT687608 MANEAL mannosidase endo-alpha like 2 2
MIRT687662 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT687870 ISCA2 iron-sulfur cluster assembly 2 2 2
MIRT687995 GTF2IRD2 GTF2I repeat domain containing 2 2 2
MIRT688135 GEMIN8 gem nuclear organelle associated protein 8 2 2
MIRT688229 FKBP14 FK506 binding protein 14 2 2
MIRT688287 FAM213A family with sequence similarity 213 member A 2 2
MIRT688469 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 2 2
MIRT688518 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT688678 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT688712 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT688842 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT689124 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT689186 ZNF665 zinc finger protein 665 2 2
MIRT689811 GTF2H3 general transcription factor IIH subunit 3 2 2
MIRT689856 HIST1H2BJ histone cluster 1 H2B family member j 2 2
MIRT690751 IRAK4 interleukin 1 receptor associated kinase 4 2 2
MIRT690996 ZNF578 zinc finger protein 578 2 2
MIRT691088 NUGGC nuclear GTPase, germinal center associated 2 2
MIRT691345 KIAA1841 KIAA1841 2 2
MIRT691590 CCDC125 coiled-coil domain containing 125 2 2
MIRT691626 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT692086 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT692123 CXorf38 chromosome X open reading frame 38 2 4
MIRT692332 RFK riboflavin kinase 2 2
MIRT692394 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT692455 METTL8 methyltransferase like 8 2 2
MIRT692558 PARD3 par-3 family cell polarity regulator 2 2
MIRT692619 GDF5OS growth differentiation factor 5 opposite strand 2 2
MIRT692800 SYNPO2L synaptopodin 2 like 2 2
MIRT692831 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT692893 RBM41 RNA binding motif protein 41 2 2
MIRT693003 LGSN lengsin, lens protein with glutamine synthetase domain 2 2
MIRT693153 THEM4 thioesterase superfamily member 4 2 2
MIRT694125 ZNF446 zinc finger protein 446 2 2
MIRT694209 ZNF347 zinc finger protein 347 2 2
MIRT694675 C14orf119 chromosome 14 open reading frame 119 2 2
MIRT694829 STX4 syntaxin 4 2 2
MIRT694951 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 2 2
MIRT695195 SLC25A33 solute carrier family 25 member 33 2 2
MIRT695677 MAN2B2 mannosidase alpha class 2B member 2 2 2
MIRT695848 ABCG8 ATP binding cassette subfamily G member 8 2 2
MIRT695940 ZNF174 zinc finger protein 174 2 2
MIRT696198 GNB5 G protein subunit beta 5 2 2
MIRT696459 SUGP1 SURP and G-patch domain containing 1 2 2
MIRT696875 UBOX5 U-box domain containing 5 2 2
MIRT696922 C14orf105 coiled-coil domain containing 198 2 2
MIRT697261 ZYG11A zyg-11 family member A, cell cycle regulator 2 2
MIRT697406 ZMAT3 zinc finger matrin-type 3 2 2
MIRT698000 TSPAN6 tetraspanin 6 2 2
MIRT699286 SLC6A4 solute carrier family 6 member 4 2 2
MIRT699333 SLC35F5 solute carrier family 35 member F5 2 5
MIRT699655 SH3BP5 SH3 domain binding protein 5 2 2
MIRT699711 SF3B3 splicing factor 3b subunit 3 2 2
MIRT700060 RPL14 ribosomal protein L14 2 2
MIRT700118 RNF19B ring finger protein 19B 2 2
MIRT700442 PURB purine rich element binding protein B 2 3
MIRT701126 PAPD5 poly(A) RNA polymerase D5, non-canonical 2 2
MIRT701310 NUDT3 nudix hydrolase 3 2 2
MIRT701592 MYPN myopalladin 2 2
MIRT702392 KLF10 Kruppel like factor 10 2 2
MIRT702541 KCND3 potassium voltage-gated channel subfamily D member 3 2 2
MIRT703107 GPRIN3 GPRIN family member 3 2 2
MIRT704126 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT704168 DNAL1 dynein axonemal light chain 1 2 2
MIRT704213 LDHD lactate dehydrogenase D 2 2
MIRT704779 CDKN2AIPNL CDKN2A interacting protein N-terminal like 2 2
MIRT705100 C4orf29 abhydrolase domain containing 18 2 2
MIRT705365 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT706122 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT706291 SLC35F6 solute carrier family 35 member F6 2 2
MIRT706327 CCDC30 coiled-coil domain containing 30 2 2
MIRT706367 STAC2 SH3 and cysteine rich domain 2 2 2
MIRT706419 HAS2 hyaluronan synthase 2 2 2
MIRT706530 MTMR9 myotubularin related protein 9 2 2
MIRT707604 PCNXL2 pecanex homolog 2 2 2
MIRT707833 TMEM133 transmembrane protein 133 2 2
MIRT708386 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 2 2
MIRT708465 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 2
MIRT709088 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT709553 ZBED1 zinc finger BED-type containing 1 2 2
MIRT711785 RFXAP regulatory factor X associated protein 2 2
MIRT713350 KLRD1 killer cell lectin like receptor D1 2 2
MIRT714322 ZNF454 zinc finger protein 454 2 2
MIRT716556 GOLGA2 golgin A2 2 2
MIRT719087 ACOX1 acyl-CoA oxidase 1 2 2
MIRT725223 PEA15 phosphoprotein enriched in astrocytes 15 2 2
MIRT726009 ZNF800 zinc finger protein 800 1 1
MIRT726014 ZNF770 zinc finger protein 770 1 1
MIRT726030 ZNF597 zinc finger protein 597 1 1
MIRT726033 ZNF280C zinc finger protein 280C 1 1
MIRT726037 ZNF280B zinc finger protein 280B 1 1
MIRT726079 ZBTB6 zinc finger and BTB domain containing 6 1 1
MIRT726100 WDR89 WD repeat domain 89 1 1
MIRT726114 VTI1A vesicle transport through interaction with t-SNAREs 1A 1 1
MIRT726133 VPS13C vacuolar protein sorting 13 homolog C 1 1
MIRT726137 VDAC1 voltage dependent anion channel 1 1 1
MIRT726153 UXS1 UDP-glucuronate decarboxylase 1 1 1
MIRT726169 USP28 ubiquitin specific peptidase 28 1 1
MIRT726172 USP16 ubiquitin specific peptidase 16 1 1
MIRT726201 UBC ubiquitin C 1 1
MIRT726213 TWF1 twinfilin actin binding protein 1 1 1
MIRT726247 TOPORS TOP1 binding arginine/serine rich protein 1 1
MIRT726282 TMEM67 transmembrane protein 67 1 1
MIRT726301 TMEM167A transmembrane protein 167A 1 1
MIRT726309 TMEM123 transmembrane protein 123 1 1
MIRT726328 TGOLN2 trans-golgi network protein 2 1 1
MIRT726343 TCF4 transcription factor 4 1 1
MIRT726402 TADA2B transcriptional adaptor 2B 1 1
MIRT726412 STX6 syntaxin 6 1 1
MIRT726426 STK17B serine/threonine kinase 17b 1 1
MIRT726442 SSX2IP SSX family member 2 interacting protein 1 1
MIRT726449 SSH2 slingshot protein phosphatase 2 1 1
MIRT726496 SLK STE20 like kinase 1 1
MIRT726524 SLC4A7 solute carrier family 4 member 7 1 1
MIRT726573 SIKE1 suppressor of IKBKE 1 1 1
MIRT726605 PEAK1 pseudopodium enriched atypical kinase 1 1 1
MIRT726634 SENP1 SUMO1/sentrin specific peptidase 1 1 1
MIRT726658 SAMD9L sterile alpha motif domain containing 9 like 1 1
MIRT726667 SACS sacsin molecular chaperone 1 1
MIRT726688 RPL17 ribosomal protein L17 1 1
MIRT726727 RNF216 ring finger protein 216 1 1
MIRT726751 RFXANK regulatory factor X associated ankyrin containing protein 1 1
MIRT726775 REEP5 receptor accessory protein 5 1 1
MIRT726803 RABEP1 rabaptin, RAB GTPase binding effector protein 1 1 1
MIRT726814 RAB30 RAB30, member RAS oncogene family 1 1
MIRT726834 PTGES3 prostaglandin E synthase 3 1 1
MIRT726838 PTGER4 prostaglandin E receptor 4 1 1
MIRT726869 PPP6C protein phosphatase 6 catalytic subunit 1 1
MIRT726876 PPP3R1 protein phosphatase 3 regulatory subunit B, alpha 1 1
MIRT726883 PPP1R3B protein phosphatase 1 regulatory subunit 3B 1 1
MIRT726903 POLQ DNA polymerase theta 1 1
MIRT726912 PNPLA4 patatin like phospholipase domain containing 4 1 1
MIRT726923 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT726927 PKMYT1 protein kinase, membrane associated tyrosine/threonine 1 1 1
MIRT726932 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT726945 PIGO phosphatidylinositol glycan anchor biosynthesis class O 1 1
MIRT726991 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 1 1
MIRT727016 PANK3 pantothenate kinase 3 1 1
MIRT727045 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 1 1
MIRT727048 NUP98 nucleoporin 98 1 1
MIRT727053 NUP35 nucleoporin 35 1 1
MIRT727102 NCAPD2 non-SMC condensin I complex subunit D2 1 1
MIRT727106 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT727127 MXI1 MAX interactor 1, dimerization protein 1 1
MIRT727146 MTF1 metal regulatory transcription factor 1 1 1
MIRT727171 MLXIP MLX interacting protein 1 1
MIRT727184 MKRN1 makorin ring finger protein 1 1 1
MIRT727233 MCL1 MCL1, BCL2 family apoptosis regulator 1 1
MIRT727254 MAP3K14 mitogen-activated protein kinase kinase kinase 14 1 1
MIRT727273 LPGAT1 lysophosphatidylglycerol acyltransferase 1 1 1
MIRT727326 LAMC1 laminin subunit gamma 1 1 1
MIRT727335 KLHL15 kelch like family member 15 1 1
MIRT727362 CCSER2 coiled-coil serine rich protein 2 1 1
MIRT727368 ATG14 autophagy related 14 1 1
MIRT727411 JAK1 Janus kinase 1 1 1
MIRT727414 ITPKB inositol-trisphosphate 3-kinase B 1 1
MIRT727419 ITCH itchy E3 ubiquitin protein ligase 1 1
MIRT727428 IQSEC1 IQ motif and Sec7 domain 1 1 1
MIRT727442 INPP5F inositol polyphosphate-5-phosphatase F 1 1
MIRT727471 IER3 immediate early response 3 1 1
MIRT727497 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 1 1
MIRT727515 HCP5 HLA complex P5 (non-protein coding) 1 1
MIRT727533 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 1 1
MIRT727553 GOLGA1 golgin A1 1 1
MIRT727561 GNAS GNAS complex locus 1 1
MIRT727600 GBP3 guanylate binding protein 3 1 1
MIRT727608 GAK cyclin G associated kinase 1 1
MIRT727613 GABBR1 gamma-aminobutyric acid type B receptor subunit 1 1 1
MIRT727638 FTSJD1 cap methyltransferase 2 1 1
MIRT727652 FMNL3 formin like 3 1 1
MIRT727665 FBXO48 F-box protein 48 1 1
MIRT727669 FBXO31 F-box protein 31 1 1
MIRT727672 FBXO21 F-box protein 21 1 1
MIRT727682 FBXO10 F-box protein 10 1 1
MIRT727693 FAM83D family with sequence similarity 83 member D 1 1
MIRT727730 FAM102A family with sequence similarity 102 member A 1 1
MIRT727741 ETF1 eukaryotic translation termination factor 1 1 1
MIRT727749 ERAP1 endoplasmic reticulum aminopeptidase 1 1 1
MIRT727768 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT727781 EIF5A2 eukaryotic translation initiation factor 5A2 1 1
MIRT727804 EEA1 early endosome antigen 1 1 1
MIRT727821 E2F2 E2F transcription factor 2 1 1
MIRT727841 DUSP18 dual specificity phosphatase 18 1 1
MIRT727873 DNAJC27 DnaJ heat shock protein family (Hsp40) member C27 1 1
MIRT727880 DENND5B DENN domain containing 5B 1 1
MIRT727894 DDHD1 DDHD domain containing 1 1 1
MIRT727919 CTSS cathepsin S 1 1
MIRT727925 CRTC3 CREB regulated transcription coactivator 3 1 1
MIRT727947 CPOX coproporphyrinogen oxidase 1 1
MIRT727967 CNOT7 CCR4-NOT transcription complex subunit 7 1 1
MIRT727974 CLOCK clock circadian regulator 1 1
MIRT727988 CIT citron rho-interacting serine/threonine kinase 1 1
MIRT727992 CHURC1 churchill domain containing 1 1 1
MIRT728024 CD47 CD47 molecule 1 1
MIRT728034 CCL1 C-C motif chemokine ligand 1 1 1
MIRT728052 CAMK2N2 calcium/calmodulin dependent protein kinase II inhibitor 2 1 1
MIRT728056 TMEM245 transmembrane protein 245 1 1
MIRT728072 C7orf60 base methyltransferase of 25S rRNA 2 homolog 1 1
MIRT728080 C7orf43 chromosome 7 open reading frame 43 1 1
MIRT728094 C5orf28 transmembrane protein 267 1 1
MIRT728108 PRR14L proline rich 14 like 1 1
MIRT728141 ELMSAN1 ELM2 and Myb/SANT domain containing 1 1 1
MIRT728144 C14orf28 chromosome 14 open reading frame 28 1 1
MIRT728150 METTL21D valosin containing protein lysine methyltransferase 1 1
MIRT728172 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT728184 BTBD7 BTB domain containing 7 1 1
MIRT728227 BAGE5 BAGE family member 5 1 1
MIRT728257 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 1 1
MIRT728280 ATG2B autophagy related 2B 1 1
MIRT728285 ATG2A autophagy related 2A 1 1
MIRT728315 ARHGEF7 Rho guanine nucleotide exchange factor 7 1 1
MIRT728320 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT728339 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT728362 ALDH9A1 aldehyde dehydrogenase 9 family member A1 1 1
MIRT728366 AKTIP AKT interacting protein 1 1
MIRT728402 ACBD5 acyl-CoA binding domain containing 5 1 1
MIRT728406 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 1 1
MIRT728415 ABCA1 ATP binding cassette subfamily A member 1 1 1
MIRT728420 AAK1 AP2 associated kinase 1 1 1
MIRT734154 CDH1 cadherin 1 1 0
MIRT736748 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 4 0
MIRT737013 MYCN MYCN proto-oncogene, bHLH transcription factor 1 0
MIRT756417 CCND2 cyclin D2 3 1
MIRT756473 DCUN1D3 defective in cullin neddylation 1 domain containing 3 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-93 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 down-regualted
miR-93 Calcium sulfate (CaS) NULL 24497 Microarray MG63E osteoblast-like cells 17618507 2008 down-regulated
miR-93 Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-93 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-93 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-93 Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer PANC-1 cells 19407485 2009 up-regulated
miR-93 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-93 5-Fluorouracil approved 3385 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-93 5-Fluorouracil approved 3385 Quantitative real-time PCR HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-93 5-Fluorouracil approved 3385 Quantitative real-time PCR HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-93 Oxaliplatin (L-OHP) approved 5310940 Microarray HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-93 Oxaliplatin (L-OHP) approved 5310940 Quantitative real-time PCR HCT-8 colon cancer cell line 19956872 2010 down-regulated
miR-93 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miR-93 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells HT-29 cells 20955366 2011 down-regulated
miR-93 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-93 Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
miR-93 Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-93 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR endometrial cancer (EMC) cells 23028803 2012 down-regulated
miR-93 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-93 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 up-regulated
miR-93 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-93 N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 up-regulated
miR-93 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 up-regulated
miR-93 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-93 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miR-93 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-93 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-93 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-mir-93 Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-93 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-93 Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-miR-93-5p -d-xylose 24203222 NSC727221 sensitive
hsa-miR-93-5p (-)-eburnamonine 71203 NSC322920 sensitive
hsa-miR-93-5p (-)7,8-dihydrocalanolide a 383107 NSC682400 sensitive
hsa-miR-93-5p (1'R,3'S,3'aS,8'bS)-1',3'-diphenylspiro[1,3-dihydroindene-2,2'-3,3a,4,8b-tetrahydro-1H-cyclopenta[a]indene]-1,4'-diol 385850 NSC677249 sensitive
hsa-miR-93-5p (1'S,8'R)-9',10'-dibromospiro[1,3-dithiolane-2,11'-tricyclo[6.3.1.02,7]dodeca-2,4,6,9-tetraene] 389921 NSC686573 sensitive
hsa-miR-93-5p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-isopropylcyclobutyl)methanol 385230 NSC676343 sensitive
hsa-miR-93-5p (1,1,3-trioxo-1,2-benzothiazol-2-yl)methyl 4-methylpiperazine-1-carbodithioate 16072473 NSC735181 sensitive
hsa-miR-93-5p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-93-5p (10Z)-10-[bromo(iodo)methylidene]phenanthren-9-one 3005079 NSC670789 sensitive
hsa-miR-93-5p (11E)-11-(6-aminohexylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027835 NSC727049 sensitive
hsa-miR-93-5p (11E)-15,16-dimethoxy-20-methyl-11-[3-(methylamino)propylidene]-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027834 NSC727048 sensitive
hsa-miR-93-5p (1r)-(-)-3-nitromethine-6-endo-acetoxycamphor 3004516 NSC657829 sensitive
hsa-miR-93-5p (1r)-3,3-dibromocamphor 376765 NSC657822 sensitive
hsa-miR-93-5p (1R)-4-methyl-7-oxo-1,6-diphenyl-5,6-diazaspiro[2.4]hept-4-ene-2,2-dicarbonitrile 366094 NSC634353 sensitive
hsa-miR-93-5p (1R,2S,7S,13R,15S)-2,15-bis[[tert-butyl(dimethyl)silyl]oxy]-3,4,11,12-tetrahydroxy-7-methyl-6-oxabicyclo[11.3.0]hexadecan-5-one 24202575 NSC694611 resistant
hsa-miR-93-5p (1R,4S,5R,8S,12R,13R)-9-[[(E)-4-[[(1R,4S,5R,8S,12R,13R)-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3.1.04,13.08,13]hexadec-9-en-9-yl]methoxy]but-2-enoxy]methyl]-1,5-dimethyl-10-(trifluoromethyl)-11,14,15,16-tetraoxatetracyclo[10.3 54612586 NSC724781 sensitive
hsa-miR-93-5p (1R,5S,8E)-8-benzylidene-5-(3-hydroxyphenyl)-2-methyl-2-azabicyclo[3.3.1]nonan-7-one;perchloric acid 45489959 NSC678345 sensitive
hsa-miR-93-5p (1S,2S,4R,7Z,11S)-4,8-dimethyl-12-methylidene-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-ene-9,13-dione 5459262 NSC672120 sensitive
hsa-miR-93-5p (1s,4e,8e,12r,13r)-12-hydroxy-4,8,12-trimethyl-16-methylidene-14-oxabicyclo[11.3.1]heptadeca-4,8-dien-15-one 24204797 NSC732954 sensitive
hsa-miR-93-5p (1s,4s,6s,9r,11r,14r,15r)-14-hydroxy-4,9,14-trimethyl-18-methylidene-5,10,16-trioxatetracyclo[13.3.1.04,6.09,11]nonadecan-17-one 24205276 NSC734913 sensitive
hsa-miR-93-5p (2-azanidylcyclohexyl)azanide;platinum(2+);selenic acid;hydrate 430708 NSC281279 sensitive
hsa-miR-93-5p (2-methoxyphenyl) (e)-3-(4-methoxyphenyl)prop-2-enoate 5928358 NSC700136 sensitive
hsa-miR-93-5p (2-methoxyphenyl)(naphthalen-2-yl)methanone 246624 NSC59937 sensitive
hsa-miR-93-5p (2-nitrophenyl)methyl (1s,5s,8z,12s,20r)-21-oxa-13-azapentacyclo[10.9.0.01,20.05,20.014,19]henicosa-8,14,16,18-tetraen-6,10-diyne-13-carboxylate 5469103 NSC683252 sensitive
hsa-miR-93-5p (2,3-dihydroxyphenyl)-[1-[(4-fluorophenyl)methyl]-4-hydroxyindol-3-yl]methanone 42624812 NSC746053 sensitive
hsa-miR-93-5p (2,4-dinitrophenyl)methyl carbamimidothioate;chloride 24183838 NSC30637 sensitive
hsa-miR-93-5p (2e)-2-(1,3-benzodioxol-5-ylmethylidene)-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516904 NSC639981 sensitive
hsa-miR-93-5p (2E)-2-[(2-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 6516827 NSC639520 sensitive
hsa-miR-93-5p (2E)-2-[(3,4-dichlorophenyl)methylidene]-6-[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 5468455 NSC670688 sensitive
hsa-miR-93-5p (2E)-2-[(3,4-dimethoxyphenyl)methylidene]-5-[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 21141940 NSC639516 sensitive
hsa-miR-93-5p (2E)-2-[(4-chlorophenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988453 NSC639517 sensitive
hsa-miR-93-5p (2E)-2-[(4-methoxyphenyl)methylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 50988775 NSC639512 sensitive
hsa-miR-93-5p (2E)-2-[(6aS)-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-8-ylidene]-N-[5-[[(2E)-2-[(6aS)-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-8-ylidene]acetyl]amino]pentyl]acetamide 5471190 NSC709362 sensitive
hsa-miR-93-5p (2e)-2-[[3-[2-(4-methoxyphenyl)-2-oxoethoxy]phenyl]methylidene]benzo[f]chromen-1-one 45028852 NSC744633 sensitive
hsa-miR-93-5p (2E)-2-[2-(4-bromophenyl)-2-oxoethylidene]-5-(2,4-dimethylphenyl)furan-3-one 5468713 NSC674919 sensitive
hsa-miR-93-5p (2E)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 21141970 NSC639976 sensitive
hsa-miR-93-5p (2E)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(piperidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54605003 NSC639978 sensitive
hsa-miR-93-5p (2e)-2-[2-[4-(2-methylpropyl)phenyl]propylidene]-5-(pyrrolidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608909 NSC639977 sensitive
hsa-miR-93-5p (2e)-2-butylidene-5-[(dimethylamino)methyl]cyclopentan-1-one;hydrochloride 5467289 NSC649903 sensitive
hsa-miR-93-5p (2E)-2-hexylidene-5-(morpholin-4-ylmethyl)cyclopentan-1-one;hydrochloride 21141930 NSC639503 sensitive
hsa-miR-93-5p (2E)-2-pentylidene-5-(piperidin-1-ylmethyl)cyclopentan-1-one;hydrochloride 54608096 NSC639501 sensitive
hsa-miR-93-5p (2e)-5,6-dimethoxy-2-[(3-phenacyloxyphenyl)methylidene]-3h-inden-1-one 45028869 NSC744650 sensitive
hsa-miR-93-5p (2E)-N-[2-[[(6aS)-2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl]oxy]ethyl]-2-[(6aS)-2-methoxy-11-oxo-3-phenylmethoxy-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-8-ylidene]acetamide 10032352 NSC728035 sensitive
hsa-miR-93-5p (2e)-n-propyl-2-[1-(pyridin-2-yl)ethylidene]hydrazine-1-carbothioamide 5371176 NSC317908 sensitive
hsa-miR-93-5p (2e,4e,6z,8e)-n-(1,3-benzodioxol-5-yl)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenamide 24202490 NSC672131 sensitive
hsa-miR-93-5p (2E,4Z)-5-chloro-1-(7-chloro-3-methyl-1,4-dioxidoquinoxaline-1,4-diium-2-yl)-5-(3,4,5-trimethoxyphenyl)penta-2,4-dien-1-one 155808203 NSC757002 sensitive
hsa-miR-93-5p (2E,6E)-2-[[4-hydroxy-3-(piperidin-1-ylmethyl)phenyl]methylidene]-6-[(4-methylphenyl)methylidene]cyclohexan-1-one 5469357 NSC687005 sensitive
hsa-miR-93-5p (2E,6E)-2,6-bis[(4-bromophenyl)methylidene]cyclohexan-1-one 5716584 NSC632831 sensitive
hsa-miR-93-5p (2r,13r,17s,18s)-7-(4-fluorophenyl)-2,18-dimethyl-6,7,9-triazapentacyclo[11.7.0.02,10.04,8.014,18]icosa-4(8),5-dien-17-ol 376242 NSC656925 sensitive
hsa-miR-93-5p (2R,3R,4R,5R,7R)-4-[tert-butyl(dimethyl)silyl]oxy-7-[[tert-butyl(dimethyl)silyl]oxymethyl]-5-(5-methyl-2,4-dioxopyrimidin-1-yl)-1,6-dioxaspiro[2.4]heptane-2-carbohydrazide 397691 NSC706091 sensitive
hsa-miR-93-5p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 sensitive
hsa-miR-93-5p (2R,6R)-9,11-dibromo-4-sulfanylidene-3-oxa-10-thia-5-azatricyclo[6.3.0.02,6]undeca-1(11),8-dien-7-one 5471246 NSC709971 sensitive
hsa-miR-93-5p (2R,6R)-9,11-dibromo-5-oxa-10-thia-3-azatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 383027 NSC671009 sensitive
hsa-miR-93-5p (2S)-2-[(E,2S)-2-hydroxy-4-oxo-6-phenylhex-5-enyl]-2,3-dihydropyran-6-one 5468230 NSC666388 sensitive
hsa-miR-93-5p (2s)-2-[2,2-bis(4-chlorophenyl)ethyl]-2-(4-chlorophenyl)-1,3-thiazolidin-4-one 402438 NSC716408 sensitive
hsa-miR-93-5p (2S,10R,11R,15R)-13-methyl-3-(trifluoromethylsulfonyl)-3,13,23-triazahexacyclo[14.7.0.02,10.04,9.011,15.017,22]tricosa-1(16),4,6,8,17,19,21-heptaene-12,14-dione 392225 NSC692358 sensitive
hsa-miR-93-5p (2z)-2-[(4-hydroxyphenyl)methylidene]-5-methoxy-1-benzofuran-3-one 54613041 NSC747169 sensitive
hsa-miR-93-5p (2z)-2-[(4z)-3-chloro-4-hydroxyiminocyclohexa-2,5-dien-1-ylidene]-2-(4-chlorophenyl)acetonitrile 5715133 NSC102225 sensitive
hsa-miR-93-5p (2z)-5-methoxy-2-[(3-phenacyloxyphenyl)methylidene]-1-benzofuran-3-one 45028682 NSC743694 sensitive
hsa-miR-93-5p (2Z,5Z)-5-[(4-chlorophenyl)methylidene]-2-[(E)-(3,5-dimethyl-1-phenylpyrazol-4-yl)methylidenehydrazinylidene]-3-phenyl-1,3-thiazolidin-4-one 9572522 NSC720057 sensitive
hsa-miR-93-5p (2Z,6Z)-2,6-bis[[3-[(dimethylamino)methyl]-4-hydroxyphenyl]methylidene]cyclohexan-1-one 6067712 NSC683834 sensitive
hsa-miR-93-5p (3-bromophenyl) (e)-3-phenylprop-2-enoate 5876919 NSC700124 sensitive
hsa-miR-93-5p (3-sulfanylidene-5,6-dihydroimidazo[2,1-c][1,2,4]thiadiazol-7-yl) 2-[[4-(trifluoromethoxy)phenyl]sulfonylamino]-4,5-dihydroimidazole-1-carbodithioate 24205510 NSC736065 sensitive
hsa-miR-93-5p (3,4,4-trichloro-2-nitro-1-phenylsulfanylbuta-1,3-dienyl)sulfanylbenzene 379911 NSC665103 sensitive
hsa-miR-93-5p (3,7,7-trimethyl-5,14-dioxo-13-propan-2-yl-4-oxatricyclo[9.4.0.03,8]pentadeca-1(15),8,10,12-tetraen-15-yl) acetate 363975 NSC629595 sensitive
hsa-miR-93-5p (3aR)-7-[3-[4-[3-[[(3aR)-8-methoxy-10-oxo-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-7-yl]oxy]propyl]piperazin-1-yl]propoxy]-8-methoxy-2,3,3a,10a-tetrahydro-1H-cyclopenta[c][1]benzazepin-10-one 24202913 NSC726262 sensitive
hsa-miR-93-5p (3e)-3-[(2-chloro-1-methylindol-3-yl)methylidene]-1h-indol-2-one 24203155 NSC726904 sensitive
hsa-miR-93-5p (3e)-3-[(2-chloro-1-phenylindol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471471 NSC711611 sensitive
hsa-miR-93-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1-methylindol-2-one 24205817 NSC736793 sensitive
hsa-miR-93-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471419 NSC711074 sensitive
hsa-miR-93-5p (3e)-3-[(3,4-dihydroxyphenyl)methylidene]-6-phenylchromen-4-one 45029091 NSC745449 sensitive
hsa-miR-93-5p (3E)-3-[[3-[1-(4-fluorophenyl)sulfonylpiperidin-4-yl]imidazo[1,5-a]pyridin-1-yl]methylidene]-1H-indol-2-one 54613720 NSC750970 resistant
hsa-miR-93-5p (3e)-3-[[6-[(e)-(2-oxo-1h-indol-3-ylidene)methyl]pyridin-2-yl]methylidene]-1h-indol-2-one 5473214 NSC724448 sensitive
hsa-miR-93-5p (3e)-4-chloro-3-[(6-chloroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471415 NSC711070 resistant
hsa-miR-93-5p (3e)-5-methoxy-3-[(6-phenyl-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471411 NSC711066 sensitive
hsa-miR-93-5p (3e)-7-chloro-4-hydroxy-1-oxido-3-(p-tolylimino)quinoxalin-1-ium-2-carbonitrile 135457335 NSC693867 sensitive
hsa-miR-93-5p (3E,5E)-1-acetyl-3,5-dibenzylidenepiperidin-4-one 5387998 NSC630599 sensitive
hsa-miR-93-5p (3E,5E)-1-methyl-3,5-bis[(2-nitrophenyl)methylidene]piperidin-4-one;hydrochloride 5468196 NSC666038 sensitive
hsa-miR-93-5p (3E,5E)-3,5-bis[[4-(dimethylamino)phenyl]methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 5386914 NSC618757 sensitive
hsa-miR-93-5p (3R,5R,8R,9S,10S,13R,14S,17R)-17-[(2R)-4-(4,5-dihydro-1H-imidazol-2-yl)butan-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-ol 391085 NSC689620 sensitive
hsa-miR-93-5p (3S)-3-[(5R)-9-bromo-4-methoxy-6-methyl-7,8-dihydro-5H-[1,3]dioxolo[4,5-g]isoquinolin-5-yl]-6,7-dimethoxy-3H-2-benzofuran-1-one 10255081 NSC733397 sensitive
hsa-miR-93-5p (3s,5s)-4-benzyl-3,5-bis(2-methoxyphenyl)hexahydro-1h-pyrrolizinium chloride 402114 NSC715973 sensitive
hsa-miR-93-5p (3s,6s)-3,6-bis(5-bromo-1h-indol-3-yl)piperazine-2,5-dione 6712394 NSC679833 sensitive
hsa-miR-93-5p (3s,8r,9s,10r,13s,14s,16e)-3-hydroxy-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-17-one 5472098 NSC716261 resistant
hsa-miR-93-5p (3z)-3-[(2,6-dimethylimidazo[2,1-b][1,3,4]thiadiazol-5-yl)methylidene]-1h-indol-2-one 24205829 NSC736811 sensitive
hsa-miR-93-5p (3z)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-5-hydroxy-1-methylindol-2-one 24205836 NSC736818 sensitive
hsa-miR-93-5p (3z)-3-[[3-[2-(4-chlorophenyl)-2-oxoethoxy]phenyl]methylidene]-6-methylthiochromen-4-one 45028771 NSC744076 sensitive
hsa-miR-93-5p (3z)-3-[[3-[2-(4-methoxyphenyl)-2-oxoethoxy]phenyl]methylidene]-6-methylthiochromen-4-one 45028770 NSC744075 sensitive
hsa-miR-93-5p (3z)-5-chloro-3-[(2,6-dimethylimidazo[2,1-b][1,3,4]thiadiazol-5-yl)methylidene]-1h-indol-2-one 24205825 NSC736807 sensitive
hsa-miR-93-5p (3z)-5-hydroxy-3-[(3,4,5-trimethoxyphenyl)methylidene]-1h-indol-2-one 24205822 NSC736802 sensitive
hsa-miR-93-5p (3z)-6,7-dichloro-3-[(3,5-dibromo-4-hydroxyphenyl)methylidene]-1h-indol-2-one 45486324 NSC748498 sensitive
hsa-miR-93-5p (3Z,5E)-3,5-bis[(4-methoxyphenyl)methylidene]piperidin-4-one 6477975 NSC632840 sensitive
hsa-miR-93-5p (3Z,5E)-3,5-dibenzylidene-1-[(E)-3-phenylprop-2-enoyl]piperidin-4-one 5351375 NSC638634 sensitive
hsa-miR-93-5p (3Z,5Z)-1,1-dimethyl-3,5-bis[(E)-3-phenylprop-2-enylidene]piperidin-1-ium-4-one 6334460 NSC636679 sensitive
hsa-miR-93-5p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-93-5p (3Z,5Z)-3,5-dibenzylidene-1-[3-(diethylamino)propanoyl]piperidin-4-one 6477769 NSC634785 sensitive
hsa-miR-93-5p (3Z,5Z)-3,5-dibenzylidene-1-[3-(dimethylamino)propanoyl]piperidin-4-one 6477768 NSC634784 sensitive
hsa-miR-93-5p (3Z,8R,9S,10R,13S,14S,17R)-17-ethynyl-10,13-dimethyl-3-(2-pyrrolidin-1-ylethoxyimino)-2,6,7,8,9,11,12,14,15,16-decahydro-1H-cyclopenta[a]phenanthren-17-ol 6520040 NSC701574 sensitive
hsa-miR-93-5p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-3-(3,4-dimethoxyphenyl)-5-hydroxy-4h-pyrazol-1-yl]methanone 400820 NSC713326 sensitive
hsa-miR-93-5p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-5-hydroxy-3-(4-methoxyphenyl)-4h-pyrazol-1-yl]methanone 400818 NSC713324 sensitive
hsa-miR-93-5p (4-methoxyphenyl)-(3,4,5-trimethoxyphenyl)methanol 368140 NSC638483 sensitive
hsa-miR-93-5p (4-methoxyphenyl)(2,3,4-trimethoxyphenyl)methanone 240478 NSC46683 sensitive
hsa-miR-93-5p (4-methylphenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388005 NSC630606 sensitive
hsa-miR-93-5p (4-nitrophenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388007 NSC630608 sensitive
hsa-miR-93-5p (4-oxo-2-phenylchromen-8-yl)methyl carbamimidothioate 431425 NSC293046 sensitive
hsa-miR-93-5p (4,4,11,11-tetramethyl-3,5,7,10,12-pentaoxatricyclo[7.3.0.02,6]dodecan-8-yl)methyl 2,2-diphenylacetate 359628 NSC620687 sensitive
hsa-miR-93-5p (4aR,9aR)-9-(4-methylphenyl)sulfonyl-3,4,4a,9a-tetrahydrocarbazole 372866 NSC648556 sensitive
hsa-miR-93-5p (4aS,4bR,10bS,12aS)-2-butyl-12a-methyl-8-(2-pyrrolidin-1-ylethoxy)-4,4a,4b,5,6,10b,11,12-octahydronaphtho[2,1-f]isoquinoline-1,3-dione 383426 NSC671765 sensitive
hsa-miR-93-5p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-1-[4-(difluoromethylsulfanyl)phenyl]-5-iminopyrrolidin-2-one 135543874 NSC744116 sensitive
hsa-miR-93-5p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-5-imino-1-(3-methoxyphenyl)pyrrolidin-2-one 135892287 NSC744115 sensitive
hsa-miR-93-5p (4r)-4-[(1r,4z,8e,10z,12s,15r,17r)-5,12-dimethyl-3-oxo-17-(2-phenylethoxy)-2,16-dioxabicyclo[13.3.1]nonadeca-4,8,10-trien-17-yl]-1,3-thiazolidin-2-one 46239554 NSC751494 resistant
hsa-miR-93-5p (4S,5R)-4-(2-methylpropyl)-3-[(1R)-1-phenylethyl]-5-phenylmethoxyoxathiazinane 2,2-dioxide 390837 NSC688895 sensitive
hsa-miR-93-5p (4s,8s,12s,16s)-4,8,12,16-tetrabenzyl-1,9-bis(prop-2-enyl)-1,5,9,13-tetrazacyclohexadecane-2,6,10,14-tetrone 403842 NSC719376 sensitive
hsa-miR-93-5p (4z)-n-[(2-chlorobenzylidene)amino]-4-(dimethylaminohydrazono)-5-methyl-pyrazole-3-carboxamide 135545659 NSC131257 sensitive
hsa-miR-93-5p (4z,5z)-1-[(e)-(2-hydroxyphenyl)methyleneamino]-3-phenyl-4,5-bis(phenylimino)imidazolidine-2-thione 135509182 NSC671409 resistant
hsa-miR-93-5p (4Z,9Z,14Z)-2,2,7,7,12,12,17,17-octamethyl-21-oxabicyclo[16.2.1]henicosa-1(20),4,9,14,18-pentaene-3,6,8,11,13,16-hexone 5387611 NSC625154 sensitive
hsa-miR-93-5p (5,11,12-triacetyloxy-1,8-dimethyl-4-tetracyclo[6.6.2.02,7.09,14]hexadeca-2,4,6,9,11,13-hexaenyl) acetate 361632 NSC624849 sensitive
hsa-miR-93-5p (5ar,6r,8ar)-6-(1,5-dimethylhexyl)-5a-methyl-2,3,4,5,6,7,8,8a-octahydro-1h-cyclopenta[b]azepine 403828 NSC719362 sensitive
hsa-miR-93-5p (5E)-2-(morpholin-4-ylmethyl)-5-nonylidenecyclopentan-1-one;hydrochloride 54612513 NSC639505 sensitive
hsa-miR-93-5p (5E)-2-[(4-chloroanilino)methyl]-5-[(4-hydroxyphenyl)methylidene]cyclopentan-1-one 5930524 NSC639541 sensitive
hsa-miR-93-5p (5e)-2-[(4-ethoxyanilino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one 5915890 NSC639539 sensitive
hsa-miR-93-5p (5e)-2-[(4-methylphenoxy)methyl]-5-[(5-nitrofuran-2-yl)methylidene]-1,3a-dihydro-[1,3]thiazolo[3,2-b][1,2,4]triazol-6-one 5471975 NSC715682 sensitive
hsa-miR-93-5p (5E)-2-[(dimethylamino)methyl]-5-(2-methylpropylidene)cyclopentan-1-one;hydrochloride 21141929 NSC639498 sensitive
hsa-miR-93-5p (5E)-2-[(dimethylamino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 5387758 NSC626874 sensitive
hsa-miR-93-5p (5E)-2-[(dimethylamino)methyl]-5-[(4-hydroxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 5387766 NSC626880 sensitive
hsa-miR-93-5p (5E)-2-[(dimethylamino)methyl]-5-[(4-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 21141935 NSC639511 sensitive
hsa-miR-93-5p (5E)-2-[(dimethylamino)methyl]-5-heptylidenecyclopentan-1-one;hydrochloride 5387764 NSC626879 sensitive
hsa-miR-93-5p (5E)-2-[(dimethylamino)methyl]-5-octylidenecyclopentan-1-one;hydrochloride 6516817 NSC639504 sensitive
hsa-miR-93-5p (5E)-2-benzyl-2-[(dimethylamino)methyl]-5-[(2-methoxyphenyl)methylidene]cyclopentan-1-one;hydrochloride 6516829 NSC639521 sensitive
hsa-miR-93-5p (5e)-3-benzyl-5-benzylidene-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470510 NSC702359 sensitive
hsa-miR-93-5p (5e)-5-[[(5e)-5-[[5-[(z)-(4,4-dimethyl-5-oxopyrrolidin-2-ylidene)methyl]-4,4-dimethylpyrrol-2-yl]methylidene]-4,4-dimethyl-1-(trifluoromethylsulfonyl)pyrrol-2-yl]methylidene]-2,4,4-trimethyl-1-(triflu 5471912 NSC715335 sensitive
hsa-miR-93-5p (5E,6Z)-5,6-bis[(6,8-dibromoquinazolin-4-yl)hydrazinylidene]hexane-1,2,3,4-tetrol 54611942 NSC716034 sensitive
hsa-miR-93-5p (5r,6s)-5-phenyl-3,4-diazatricyclo[8.4.0.02,6]tetradeca-1(14),2,10,12-tetraene-4-carbothioamide 5467466 NSC652809 sensitive
hsa-miR-93-5p (5Z)-2-[(dimethylamino)methyl]-5-pentylidenecyclopentan-1-one;hydrochloride 5387762 NSC626878 sensitive
hsa-miR-93-5p (5z)-3-(4,7-dimethoxy-1,3-benzothiazol-2-yl)-5-[[4-(dimethylamino)phenyl]methylidene]-2-phenylimidazol-4-one 1273997 NSC711830 sensitive
hsa-miR-93-5p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-93-5p (5z)-5-[(2-chlorophenyl)methylidene]-3-(furan-2-ylmethyl)-2-phenylimidazol-4-one 24204861 NSC733164 sensitive
hsa-miR-93-5p (6-acetamido-7-methyl-5,8-dioxo-2,3-dihydro-1H-pyrrolo[1,2-a]benzimidazol-3-yl) 2-methoxyacetate 374010 NSC651084 sensitive
hsa-miR-93-5p (6,6-dibromo-5-oxo-8,9-dihydro-7H-benzo[7]annulen-4-yl) acetate 361590 NSC624771 sensitive
hsa-miR-93-5p (6aS)-3-[3-[4-[3-[[(6aS)-8,8-difluoro-2-methoxy-11-oxo-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-3-yl]oxy]propyl]piperazin-1-yl]propoxy]-8,8-difluoro-2-methoxy-7,9-dihydro-6aH-pyrrolo[2,1-c][1,4]benzodiazepin-11-one 44204058 NSC744331 sensitive
hsa-miR-93-5p (6as)-3-[4-[[(6as)-2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl]oxy]butoxy]-2-methoxy-6a,7,8,9-tetrahydro-5h-pyrrolo[2,1-c][1,4]benzodiazepine-6,11-dione 403688 NSC718812 sensitive
hsa-miR-93-5p (6aS)-3-[4-[4-[(E)-3-(2,4-dimethylquinolin-3-yl)-3-oxoprop-1-enyl]-2-methoxyphenoxy]butoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 44227495 NSC744989 sensitive
hsa-miR-93-5p (6aS)-3-[5-[4-(2-diethoxyphosphorylethyl)piperazin-1-yl]pentoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 25113728 NSC744025 sensitive
hsa-miR-93-5p (6aS,10aS)-6-(1H-indol-3-yl)-9-methyl-5,6,6a,7,8,10a-hexahydroindeno[2,1-b]indole 362974 NSC627506 sensitive
hsa-miR-93-5p (6E)-2-[(dimethylamino)methyl]-6-[(4-methoxyphenyl)methylidene]cyclohexan-1-one;hydrochloride 5468453 NSC670687 sensitive
hsa-miR-93-5p (6Z)-6-[(2-methoxyphenyl)methylidene]-3-(3-nitrophenyl)-[1,3]thiazolo[2,3-b][1,3]thiazol-4-ium-5-one 5847653 NSC657446 sensitive
hsa-miR-93-5p (6Z,10E)-5-hydroxy-6-methyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-10-carbaldehyde 6477353 NSC645998 sensitive
hsa-miR-93-5p (7ar)-1,6-bis(4-methoxyphenyl)-7a-phenyltetrahydroimidazo[1,5-b][1,2,4]oxadiazol-2(1h)-one 402882 NSC717189 sensitive
hsa-miR-93-5p (7e)-5-methyl-2-phenyl-3-thiophen-2-yl-7-(thiophen-2-ylmethylidene)-3,3a,4,6-tetrahydropyrazolo[4,3-c]pyridine 5470914 NSC706211 sensitive
hsa-miR-93-5p (7E)-6-(methoxymethoxy)-2-methylcyclododec-7-en-3-yn-1-one 5467712 NSC658114 sensitive
hsa-miR-93-5p (7E)-7-benzylidene-2-chloro-5,6-dihydroquinolin-8-one 5470385 NSC700549 sensitive
hsa-miR-93-5p (7z)-6-(4-methoxyphenyl)-3-methyl-7-[[5-(4-nitrophenyl)furan-2-yl]methylidene]-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine 5471358 NSC710779 sensitive
hsa-miR-93-5p (7z)-7-[[5-(2-chloro-4-nitrophenyl)furan-2-yl]methylidene]-6-(2,4-dichlorophenyl)-3-methyl-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazine NSC725202 sensitive
hsa-miR-93-5p (8e)-2-amino-4-(3,4-dimethoxyphenyl)-8-[(3,4-dimethoxyphenyl)methylidene]-5-methyl-6,7-dihydro-5h-quinoline-3-carbonitrile NSC690754 sensitive
hsa-miR-93-5p (8r,9s,10r,13s,14s,16e)-10,13-dimethyl-16-[(3,4,5-trimethoxyphenyl)methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 5470702 NSC704614 sensitive
hsa-miR-93-5p (8r,9s,10r,13s,14s,16e)-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 5472100 NSC716263 sensitive
hsa-miR-93-5p (8R,9S,10R,13S,14S,16E)-10,13-dimethyl-16-[[3-(2-morpholin-4-ylethoxy)phenyl]methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 24205793 NSC736753 sensitive
hsa-miR-93-5p (8r,9s,10r,13s,14s,16r)-16-imidazol-1-yl-10,13-dimethyl-3-pyrrolidin-1-yl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1h-cyclopenta[a]phenanthren-17-ol 390532 NSC687980 sensitive
hsa-miR-93-5p (8R,9S,13S,14S,16E)-3-hydroxy-13-methyl-16-(pyridin-4-ylmethylidene)-6,7,8,9,11,12,14,15-octahydrocyclopenta[a]phenanthren-17-one 5470644 NSC703823 sensitive
hsa-miR-93-5p (8R,9S,13S,14S,17S)-13-methyl-2-(2,2,2-trifluoroethoxy)-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthrene-3,17-diol 386444 NSC678473 sensitive
hsa-miR-93-5p (8R,9S,13S,14S,17S)-3,17-dihydroxy-13-methyl-2-(2,2,2-trifluoroethoxy)-8,9,11,12,14,15,16,17-octahydro-7H-cyclopenta[a]phenanthren-6-one 387663 NSC681684 sensitive
hsa-miR-93-5p (8S,9S,10R,11S,13S,14S,17S)-11-hydroxy-10,13-dimethyl-17-(2-phenyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 261360 NSC93354 sensitive
hsa-miR-93-5p (8S,9S,10R,13S,14S,17S)-10,13-dimethyl-17-(2-methyl-1,3-thiazol-4-yl)-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-one 259211 NSC88916 sensitive
hsa-miR-93-5p (9-methoxy-5,11-dimethyl-6H-pyrido[4,3-b]carbazol-2-ium-2-yl)methyl benzoate;iodide 365242 NSC632620 sensitive
hsa-miR-93-5p (9,10-dioxoanthracen-2-yl)methyl 3-benzamido-2-hydroxy-3-phenylpropanoate 361915 NSC625350 resistant
hsa-miR-93-5p (9S)-9-(2-bromoacetyl)-7-(3-fluoro-4,5-dihydroxy-6-methyloxan-2-yl)oxy-6,9,11-trihydroxy-8,10-dihydro-7H-tetracene-5,12-dione 6712216 NSC659949 sensitive
hsa-miR-93-5p (e)-(5,7-dimethyl-3,6-dihydro-2h-1,4-diazepin-6-yl)-(2-methyl-3h-benzimidazol-5-yl)diazene 396642 NSC703141 sensitive
hsa-miR-93-5p (e)-1-(1,2-dihydroacenaphthylen-5-yl)-3-(4-nitrophenyl)prop-2-en-1-one 6167610 NSC746353 sensitive
hsa-miR-93-5p (e)-1-(1h-benzimidazol-2-yl)-3-(4-methylsulfanylphenyl)prop-2-en-1-one 5472117 NSC716334 sensitive
hsa-miR-93-5p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-93-5p (e)-1-(2,5-dimethoxyphenyl)-3-(2-fluoro-4,5-dihydroxyphenyl)prop-2-en-1-one 5471282 NSC710266 sensitive
hsa-miR-93-5p (E)-1-(3,4-dimethoxyphenyl)-3-[2-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl]prop-2-en-1-one 54599698 NSC750746 sensitive
hsa-miR-93-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-(3,4-dimethoxyphenyl)prop-2-en-1-one 5471156 NSC709100 sensitive
hsa-miR-93-5p (E)-1-(7-fluoro-3-methylquinoxalin-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45029310 NSC746087 sensitive
hsa-miR-93-5p (E)-1-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54612660 NSC741738 resistant
hsa-miR-93-5p (e)-1-(benzenesulfonyl)-3-(2-phenyl-1h-indol-3-yl)prop-2-en-1-one 54613416 NSC749193 sensitive
hsa-miR-93-5p (e)-1-[(4r,5r)-1,3-dibenzyl-2-oxo-4,5-diphenyl-1,3,2lambda5-diazaphospholidin-2-yl]-3-phenylprop-2-en-1-ol 5470796 NSC705149 sensitive
hsa-miR-93-5p (E)-1-[1-ethyl-4-hydroxy-1-methyl-4-[(E)-2-phenylethenyl]piperidin-1-ium-3-yl]-3-phenylprop-2-en-1-one;bromide 5386939 NSC618770 sensitive
hsa-miR-93-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3-methoxyphenyl)prop-2-en-1-one 45028634 NSC743528 sensitive
hsa-miR-93-5p (e)-1-[3-[(4,6-dianilino-1,3,5-triazin-2-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45028636 NSC743530 sensitive
hsa-miR-93-5p (E)-1-[4-(quinazolin-4-ylamino)phenyl]-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 155816064 NSC760015 sensitive
hsa-miR-93-5p (e)-1-[4-[(7-chloroquinolin-4-yl)amino]phenyl]-3-(furan-2-yl)prop-2-en-1-one 42631501 NSC743864 sensitive
hsa-miR-93-5p (E)-1-[4-[(E)-4,4-dimethyl-3-oxo-5-piperidin-1-ylpent-1-enyl]phenyl]-4,4-dimethyl-5-piperidin-1-ylpent-1-en-3-one;hydrobromide 5386918 NSC618759 sensitive
hsa-miR-93-5p (e)-1-[4-[[4-(4-chloroanilino)-6-(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-[4-(dimethylamino)phenyl]prop-2-en-1-one 45028715 NSC743884 sensitive
hsa-miR-93-5p (e)-1-[4-[[4-anilino-6-(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 54613477 NSC749379 sensitive
hsa-miR-93-5p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(2-methoxyphenyl)prop-2-en-1-one 24205906 NSC737225 sensitive
hsa-miR-93-5p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 24205912 NSC737231 sensitive
hsa-miR-93-5p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(4-methoxyphenyl)prop-2-en-1-one 24205905 NSC737224 sensitive
hsa-miR-93-5p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(furan-2-yl)prop-2-en-1-one 24205907 NSC737226 sensitive
hsa-miR-93-5p (e)-1-[4-[2-[bis(4-fluorophenyl)methoxy]ethyl]piperazin-1-yl]-3-(4-nitrophenyl)prop-2-en-1-one NSC707832 sensitive
hsa-miR-93-5p (e)-1,3-diphenyl-2-(piperidin-1-ylmethyl)prop-2-en-1-one 6147837 NSC109154 sensitive
hsa-miR-93-5p (E)-2-(3,4-dihydroxybenzoyl)-3-(1H-indol-3-yl)prop-2-enenitrile 5329275 NSC650934 sensitive
hsa-miR-93-5p (e)-3-(1,3-benzodioxol-5-yl)-1-(3,5-ditert-butyl-4-hydroxyphenyl)prop-2-en-1-one 5471158 NSC709102 sensitive
hsa-miR-93-5p (E)-3-(2-methoxyphenyl)-1-phenylprop-2-en-1-one 5383464 NSC636918 sensitive
hsa-miR-93-5p (E)-3-(2-nitrophenyl)-1-(3,6,7-trimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)prop-2-en-1-one 5351352 NSC621486 resistant
hsa-miR-93-5p (e)-3-(2-thienyl)-1-[6-[(e)-3-(2-thienyl)prop-2-enoyl]-2-pyridyl]prop-2-en-1-one 5470457 NSC702046 sensitive
hsa-miR-93-5p (e)-3-(3,4-dimethoxyphenyl)-1-(6-methoxynaphthalen-2-yl)prop-2-en-1-one 8857297 NSC729531 sensitive
hsa-miR-93-5p (E)-3-(3,4-dimethoxyphenyl)-1-[6-[(E)-3-(3,4-dimethoxyphenyl)prop-2-enoyl]pyridin-2-yl]prop-2-en-1-one 5470456 NSC702045 sensitive
hsa-miR-93-5p (e)-3-(4-chlorophenyl)-1-[4-[(7-chloroquinolin-4-yl)amino]phenyl]prop-2-en-1-one 25113941 NSC743862 sensitive
hsa-miR-93-5p (E)-3-(4-chlorophenyl)-1-[4-[(E)-2-(4-chlorophenyl)ethenyl]-1-ethyl-4-hydroxy-1-methylpiperidin-1-ium-3-yl]prop-2-en-1-one;iodide 5469649 NSC691276 sensitive
hsa-miR-93-5p (e)-3-(4-hydroxyphenyl)-1-[5-methyl-1-[8-(trifluoromethyl)quinolin-4-yl]triazol-4-yl]prop-2-en-1-one NSC736153 sensitive
hsa-miR-93-5p (E)-3-(4-methoxyphenyl)-2-(4-oxo-3H-quinazolin-2-yl)prop-2-enenitrile 135454458 NSC684969 resistant
hsa-miR-93-5p (E)-3-(4-phenylphenyl)-1-thiophen-2-ylprop-2-en-1-one 5782484 NSC700125 sensitive
hsa-miR-93-5p (E)-3-(6-thiophen-2-ylimidazo[2,1-b][1,3]thiazol-5-yl)-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 50908742 NSC750743 sensitive
hsa-miR-93-5p (E)-3-(7-methoxy-3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 53362835 NSC749076 sensitive
hsa-miR-93-5p (E)-3-[4-(dimethylamino)phenyl]-1-(4-hydroxyphenyl)prop-2-en-1-one 5468166 NSC665694 sensitive
hsa-miR-93-5p (e)-3-[4-[2-oxo-2-(4-phenylpiperazin-1-yl)ethoxy]phenyl]-1-phenyl-prop-2-en-1-one 5466903 NSC645389 sensitive
hsa-miR-93-5p (e)-3-chloro-2-(3,4-dimethoxyphenyl)-3-(3,4-dipropoxyphenyl)prop-2-enal 3004402 NSC650594 sensitive
hsa-miR-93-5p (e)-3-chloro-2-(4-fluorophenyl)-3-(4-methoxyphenyl)prop-2-enal 5387394 NSC623173 sensitive
hsa-miR-93-5p (e)-3-chloro-3-(3,4-dimethoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387397 NSC623176 sensitive
hsa-miR-93-5p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 sensitive
hsa-miR-93-5p (E)-5-(diethylamino)-1-[4-[(E)-5-(diethylamino)-4,4-dimethyl-3-oxopent-1-enyl]phenyl]-4,4-dimethylpent-1-en-3-one 5916501 NSC602066 sensitive
hsa-miR-93-5p (e)-5-(diethylamino)-1-phenylpent-1-en-3-one;hydrochloride 6519127 NSC678343 sensitive
hsa-miR-93-5p (e)-but-2-enedioic acid;1-(7,8,9,10-tetrahydrophenanthridin-6-yl)piperidin-4-amine 5471308 NSC710333 sensitive
hsa-miR-93-5p (E)-but-2-enedioic acid;1-[[3-(diethylamino)-2-hydroxypropyl]amino]-4-(oxiran-2-ylmethylamino)anthracene-9,10-dione 5388837 NSC639366 sensitive
hsa-miR-93-5p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-fluorophenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351427 NSC670226 sensitive
hsa-miR-93-5p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-methylphenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351426 NSC670225 sensitive
hsa-miR-93-5p (E)-N-[[(17S)-3,17-dihydroxy-13-methyl-7,8,9,11,12,14,15,16-octahydro-6H-cyclopenta[a]phenanthren-17-yl]methyl]-3-(4-hydroxy-3-methoxyphenyl)prop-2-enamide 24205473 NSC735946 sensitive
hsa-miR-93-5p (E)-N-ethyl-3-(4-methoxyphenyl)-2-(3,4,5-trimethoxyphenyl)prop-2-enamide 5388754 NSC638409 sensitive
hsa-miR-93-5p (NE)-N-(1-benzyl-4-morpholin-4-yl-2-bicyclo[2.2.2]octanylidene)hydroxylamine 5831070 NSC666707 resistant
hsa-miR-93-5p (ne)-n-[(3e,8r,9s,10r,13s,14s,16e)-16-[(3,4-dimethoxyphenyl)methylidene]-3-hydroxyimino-10,13-dimethyl-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthren-17-ylidene]hydroxylamine 9572443 NSC716260 sensitive
hsa-miR-93-5p (ne)-n-[1-[4-(furo[3,2-c]quinolin-4-ylamino)phenyl]ethylidene]hydroxylamine 9572572 NSC720561 sensitive
hsa-miR-93-5p (ne)-n-[1-[4-[(9-methoxy-11-nitroso-5h-indeno[1,2-c]quinolin-6-yl)amino]phenyl]ethylidene]hydroxylamine 24205213 NSC734631 sensitive
hsa-miR-93-5p (r,r)-diop 122582 NSC699412 sensitive
hsa-miR-93-5p (z)-1-iodo-2-phenyl-1-penten-3-one 5468684 NSC674455 sensitive
hsa-miR-93-5p (z)-1,3-diphenyl-3-triphenylplumbyloxy-prop-2-en-1-one NSC644908 sensitive
hsa-miR-93-5p (z)-3-(2-methoxyphenyl)-2-(4-methoxyphenyl)prop-2-enenitrile 5793739 NSC130862 sensitive
hsa-miR-93-5p (Z)-3-(benzenesulfinyl)-N-benzyl-N-tert-butylprop-2-enamide 5470812 NSC705331 sensitive
hsa-miR-93-5p (z)-3-[[(4z)-4-(5,5-dimethyl-4-methyliminofuran-2-yl)imino-5,5-dimethylfuran-2-yl]amino]-4-hydroxy-4-methylpent-2-enenitrile NSC670995 sensitive
hsa-miR-93-5p (Z)-3-amino-1-(5-amino-3-phenylpyrazol-1-yl)-3-phenylprop-2-en-1-one 21825201 NSC749518 sensitive
hsa-miR-93-5p (z)-4-bromo-4-iodo-3-phenyl-3-buten-2-one 3004479 NSC657561 sensitive
hsa-miR-93-5p (z)-n-(1,3-benzodioxol-5-ylmethyl)-n-tert-butyl-3-phenylsulfanylprop-2-enamide 5470808 NSC705327 sensitive
hsa-miR-93-5p (z) 2',3,4,5-tetramethoxystilbene 5388740 NSC638390 sensitive
hsa-miR-93-5p (z) 3,3',4,5-tetramethoxystilbene 5388774 NSC638492 sensitive
hsa-miR-93-5p .alpha.-sarcin NSC46401 resistant
hsa-miR-93-5p .beta.-d-glucopyranose, 2,3-o-(diethylstannylene)- 16683462 NSC306911 sensitive
hsa-miR-93-5p .beta.-phenylethyl 2,4,5-trihydroxycinnamate 5933247 NSC666592 sensitive
hsa-miR-93-5p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 sensitive
hsa-miR-93-5p [(11bR)-9,10-dimethoxy-4-phenylimino-2,6,7,11b-tetrahydro-1H-[1,3]thiazino[4,3-a]isoquinolin-1-yl]methyl benzoate 371073 NSC645016 sensitive
hsa-miR-93-5p [(1e,3e)-4-(benzenesulfonyl)buta-1,3-dienyl]sulfinylbenzene 5468034 NSC662784 sensitive
hsa-miR-93-5p [(1R)-3-methyl-1-[[(2S)-4-phenyl-2-(quinoline-2-carbonylamino)butanoyl]amino]butyl]boronic acid 388335 NSC683086 sensitive
hsa-miR-93-5p [(1r,2r,3ar,4s,5s,6e,9s,10r,11s,13r,13as)-2,4,13-triacetyloxy-1-benzoyloxy-3a,10-dihydroxy-2,5,8,8-tetramethyl-12-methylidene-11-(2-methylpropoxy)-3,4,5,9,10,11,13,13a-octahydro-1h-cyclopenta[12]annul 5469445 NSC688235