pre-miRNA Information
pre-miRNA hsa-mir-26b   
Genomic Coordinates chr2: 218402646 - 218402722
Synonyms MIRN26B, hsa-mir-26b, miR-26b, MIR26B
Description Homo sapiens miR-26b stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-26b-5p
Sequence 12| UUCAAGUAAUUCAGGAUAGGU |32
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 2 + 218402660 26028588 MiREDiBase
A-to-I 13 2 + 218402669 26028588 MiREDiBase
C-to-U 12 2 + 218402668 28550310 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN15625173 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1173404354 12 dbSNP
rs1417663771 15 dbSNP
rs766205860 16 dbSNP
rs1381090830 17 dbSNP
rs1434330126 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BSR58L miR-26b-5p Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Polymerase chain reaction
Gene Information
Gene Symbol PARP4   
Synonyms ADPRTL1, ARTD4, PARP-4, PARPL, PH5P, VAULT3, VPARP, VWA5C, p193
Description poly(ADP-ribose) polymerase family member 4
Transcript NM_006437   
Expression
Putative miRNA Targets on PARP4
3'UTR of PARP4
(miRNA target sites are highlighted)
>PARP4|NM_006437|3'UTR
   1 GTCAAATGAAACTGAATTTTAAACTTTTTGCATGCTTCTATGTAGAAAATAATCAAATGATAATAGATACTTATAATGAA
  81 ACTTCATTAAGGTTTCATTCAGTGTAGCAATTACTGTCTTTAAAAATTAAGTGGAAGAAGAATTACTTTAATCAACTAAC
 161 AAGCAATAATAAAATGAAACTTAAAATAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uggauaggaCUUAAUGAACUu 5'
                   ||||||||| | 
Target 5' gtggaagaaGAATTACTTTAa 3'
131 - 151 128.00 -7.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN23899179 1 COSMIC
COSN13434896 40 COSMIC
COSN31537338 127 COSMIC
COSN30129097 128 COSMIC
COSN31525307 140 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs375778177 1 dbSNP
rs1180988502 13 dbSNP
rs1189817547 21 dbSNP
rs1396976010 22 dbSNP
rs1483077430 23 dbSNP
rs1475466849 24 dbSNP
rs1253407804 28 dbSNP
rs1256756745 33 dbSNP
rs759397022 36 dbSNP
rs374179211 40 dbSNP
rs1273169565 49 dbSNP
rs772161073 51 dbSNP
rs538448385 53 dbSNP
rs1203448072 58 dbSNP
rs1344595228 60 dbSNP
rs200290040 66 dbSNP
rs569759137 74 dbSNP
rs1232901047 91 dbSNP
rs1309586328 97 dbSNP
rs1355402986 102 dbSNP
rs1300314916 127 dbSNP
rs1053195470 128 dbSNP
rs549592250 138 dbSNP
rs1370933231 140 dbSNP
rs1255386322 143 dbSNP
rs1467232574 144 dbSNP
rs1193047615 147 dbSNP
rs1301995262 154 dbSNP
rs1381220308 155 dbSNP
rs1388595587 158 dbSNP
rs1371357227 162 dbSNP
rs529706457 164 dbSNP
rs1156985530 166 dbSNP
rs1406983542 172 dbSNP
rs1405696965 178 dbSNP
rs1297803229 181 dbSNP
rs202242712 183 dbSNP
rs901862031 183 dbSNP
rs1430693961 184 dbSNP
rs1331422195 188 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Gennarino VA; Sardiello M; Avellino R; et al.
- Genome research, 2009
MicroRNAs (miRNAs) are small noncoding RNAs that control gene expression by inducing RNA cleavage or translational inhibition. Most human miRNAs are intragenic and are transcribed as part of their hosting transcription units. We hypothesized that the expression profiles of miRNA host genes and of their targets are inversely correlated and devised a novel procedure, HOCTAR (host gene oppositely correlated targets), which ranks predicted miRNA target genes based on their anti-correlated expression behavior relative to their respective miRNA host genes. HOCTAR is the first tool for systematic miRNA target prediction that utilizes the same set of microarray experiments to monitor the expression of both miRNAs (through their host genes) and candidate targets. We applied the procedure to 178 human intragenic miRNAs and found that it performs better than currently available prediction softwares in pinpointing previously validated miRNA targets. The high-scoring HOCTAR predicted targets were enriched in Gene Ontology categories, which were consistent with previously published data, as in the case of miR-106b and miR-93. By means of overexpression and loss-of-function assays, we also demonstrated that HOCTAR is efficient in predicting novel miRNA targets and we identified, by microarray and qRT-PCR procedures, 34 and 28 novel targets for miR-26b and miR-98, respectively. Overall, we believe that the use of HOCTAR significantly reduces the number of candidate miRNA targets to be tested compared to the procedures based solely on target sequence recognition. Finally, our data further confirm that miRNAs have a significant impact on the mRNA levels of most of their targets.
LinkOut: [PMID: 19088304]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer 0.567 3.6e-4 0.371 1.8e-2 32 Click to see details
GSE21032 Prostate cancer 0.293 3.6e-3 0.251 1.1e-2 83 Click to see details
GSE19783 ER+ ER+ breast cancer 0.525 8.7e-3 0.424 3.1e-2 20 Click to see details
GSE28260 Renal cortex and medulla -0.504 4.0e-2 -0.555 2.4e-2 13 Click to see details
GSE21687 Ependynoma primary tumors 0.211 4.7e-2 0.096 2.3e-1 64 Click to see details
GSE38226 Liver fibrosis -0.28 1.1e-1 -0.087 3.5e-1 21 Click to see details
GSE17306 Multiple myeloma -0.149 1.5e-1 -0.158 1.4e-1 49 Click to see details
GSE19350 CNS germ cell tumors 0.298 1.7e-1 0.196 2.7e-1 12 Click to see details
GSE28544 Breast cancer 0.177 2.0e-1 0.039 4.3e-1 24 Click to see details
GSE27834 Pluripotent stem cells 0.216 2.1e-1 0.259 1.7e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.16 2.2e-1 -0.027 4.5e-1 25 Click to see details
GSE21849 B cell lymphoma 0.104 3.0e-1 0.001 5.0e-1 29 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.086 3.6e-1 0.298 1.0e-1 20 Click to see details
GSE14794 Lymphoblastoid cells 0.038 3.6e-1 0.001 5.0e-1 90 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.156 3.8e-1 -0.371 2.3e-1 6 Click to see details
GSE19783 ER- ER- breast cancer -0.031 3.9e-1 -0.057 3.1e-1 79 Click to see details
GSE19536 Breast cancer -0.024 4.1e-1 -0.027 3.9e-1 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.036 4.3e-1 -0.066 3.8e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.037 4.3e-1 0.114 3.0e-1 23 Click to see details
GSE26953 Aortic valvular endothelial cells 0.011 4.8e-1 0.079 3.6e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.691 0 0.711 0 32 Click to see details
KIRP -0.556 0 -0.532 0 32 Click to see details
KIRC -0.334 0 -0.259 0.02 68 Click to see details
THCA -0.248 0.03 -0.261 0.02 59 Click to see details
BLCA 0.369 0.07 0.311 0.1 18 Click to see details
PAAD 0.69 0.16 0.400 0.3 4 Click to see details
UCEC 0.233 0.17 0.316 0.09 19 Click to see details
PCPG 0.815 0.2 0.500 0.33 3 Click to see details
LUAD -0.251 0.22 -0.322 0.15 12 Click to see details
HNSC -0.117 0.23 -0.052 0.37 42 Click to see details
CESC 0.524 0.32 0.500 0.33 3 Click to see details
BRCA -0.045 0.34 -0.066 0.28 84 Click to see details
LIHC -0.052 0.36 -0.107 0.23 49 Click to see details
PRAD 0.038 0.4 -0.104 0.24 50 Click to see details
KICH 0.049 0.41 0.025 0.45 25 Click to see details
ESCA -0.076 0.41 -0.145 0.34 11 Click to see details
LUSC -0.031 0.43 -0.093 0.29 38 Click to see details
CHOL -0.034 0.47 -0.167 0.33 9 Click to see details
COAD -0.013 0.49 -0.119 0.39 8 Click to see details
COAD -0.013 0.49 -0.119 0.39 8 Click to see details
COAD -0.013 0.49 -0.119 0.39 8 Click to see details
1860 hsa-miR-26b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002312 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT003604 EP300 E1A binding protein p300 2 1
MIRT004659 PTGS2 prostaglandin-endoperoxide synthase 2 4 3
MIRT005508 EPHA2 EPH receptor A2 4 2
MIRT006307 CDK6 cyclin dependent kinase 6 2 1
MIRT006308 CCNE1 cyclin E1 3 2
MIRT006713 ABCA1 ATP binding cassette subfamily A member 1 3 2
MIRT006715 ARL4C ADP ribosylation factor like GTPase 4C 2 1
MIRT006808 GATA4 GATA binding protein 4 3 1
MIRT028745 ABCF1 ATP binding cassette subfamily F member 1 1 1
MIRT028746 DEFA3 defensin alpha 3 1 1
MIRT028747 ZNF324B zinc finger protein 324B 1 1
MIRT028748 SIDT1 SID1 transmembrane family member 1 1 1
MIRT028749 NDUFB4 NADH:ubiquinone oxidoreductase subunit B4 1 1
MIRT028750 PVALB parvalbumin 1 1
MIRT028751 ARRB1 arrestin beta 1 1 1
MIRT028752 MDH1 malate dehydrogenase 1 1 1
MIRT028753 PARP4 poly(ADP-ribose) polymerase family member 4 1 1
MIRT028754 FKBP2 FK506 binding protein 2 1 1
MIRT028755 TIMP1 TIMP metallopeptidase inhibitor 1 1 1
MIRT028756 SPRY2 sprouty RTK signaling antagonist 2 1 1
MIRT028757 TP53TG5 TP53 target 5 1 1
MIRT028758 CRYGC crystallin gamma C 1 1
MIRT028759 NYX nyctalopin 1 1
MIRT028760 PRYP4 PTPN13-like, Y-linked pseudogene 4 1 1
MIRT028761 KLRC1 killer cell lectin like receptor C1 1 1
MIRT028762 FOXE1 forkhead box E1 1 1
MIRT028763 MRPS28 mitochondrial ribosomal protein S28 1 1
MIRT028764 NFE2L2 nuclear factor, erythroid 2 like 2 1 1
MIRT028765 CYB561D2 cytochrome b561 family member D2 1 1
MIRT028766 TRMT2B tRNA methyltransferase 2 homolog B 1 1
MIRT028767 PRICKLE3 prickle planar cell polarity protein 3 1 1
MIRT028768 LIG4 DNA ligase 4 1 1
MIRT028769 ZDHHC7 zinc finger DHHC-type containing 7 1 1
MIRT028770 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 1 1
MIRT028771 MAGEA9 MAGE family member A9 1 1
MIRT028772 ELAVL3 ELAV like RNA binding protein 3 1 1
MIRT028773 NACC2 NACC family member 2 1 1
MIRT028774 SOX5 SRY-box 5 1 1
MIRT028775 PFKFB3 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 1 1
MIRT028776 LRRC2 leucine rich repeat containing 2 1 1
MIRT028777 DONSON downstream neighbor of SON 1 1
MIRT028778 ALG3 ALG3, alpha-1,3- mannosyltransferase 1 1
MIRT028779 C1GALT1C1 C1GALT1 specific chaperone 1 1 1
MIRT028780 CA1 carbonic anhydrase 1 1 1
MIRT028781 WDR83OS WD repeat domain 83 opposite strand 1 1
MIRT028782 SRP14 signal recognition particle 14 1 1
MIRT028783 TAX1BP3 Tax1 binding protein 3 1 1
MIRT028784 TRIM13 tripartite motif containing 13 1 1
MIRT028785 NMRK1 nicotinamide riboside kinase 1 1 1
MIRT028786 ZBTB25 zinc finger and BTB domain containing 25 1 1
MIRT028787 ZSCAN16 zinc finger and SCAN domain containing 16 1 1
MIRT028788 RSAD2 radical S-adenosyl methionine domain containing 2 1 1
MIRT028789 TMEM165 transmembrane protein 165 1 1
MIRT028790 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 1 1
MIRT028791 PODXL podocalyxin like 1 1
MIRT028792 PSMC1 proteasome 26S subunit, ATPase 1 1 1
MIRT028793 SNRPC small nuclear ribonucleoprotein polypeptide C 1 1
MIRT028794 USB1 U6 snRNA biogenesis phosphodiesterase 1 1 1
MIRT028795 DUSP1 dual specificity phosphatase 1 1 1
MIRT028796 RNASE1 ribonuclease A family member 1, pancreatic 1 1
MIRT028797 FOXF2 forkhead box F2 1 1
MIRT028798 PIGA phosphatidylinositol glycan anchor biosynthesis class A 1 1
MIRT028799 LHX6 LIM homeobox 6 1 1
MIRT028800 TUBD1 tubulin delta 1 1 1
MIRT028801 FAM212B family with sequence similarity 212 member B 1 1
MIRT028802 C6orf15 chromosome 6 open reading frame 15 1 1
MIRT028803 EMC6 ER membrane protein complex subunit 6 1 1
MIRT028804 CDKL2 cyclin dependent kinase like 2 1 1
MIRT028805 TSPAN13 tetraspanin 13 1 1
MIRT028806 BGLAP bone gamma-carboxyglutamate protein 1 1
MIRT028807 MARCH3 membrane associated ring-CH-type finger 3 1 1
MIRT028808 ATP5SL distal membrane arm assembly complex 2 1 1
MIRT028809 SNRNP70 small nuclear ribonucleoprotein U1 subunit 70 1 1
MIRT028810 DBNL drebrin like 1 1
MIRT028811 PCDHB8 protocadherin beta 8 1 1
MIRT028812 ACN9 succinate dehydrogenase complex assembly factor 3 1 1
MIRT028813 ICT1 mitochondrial ribosomal protein L58 1 1
MIRT028814 COQ2 coenzyme Q2, polyprenyltransferase 1 1
MIRT028815 CMPK1 cytidine/uridine monophosphate kinase 1 1 1
MIRT028816 VNN2 vanin 2 1 1
MIRT028817 PPAP2A phospholipid phosphatase 1 1 1
MIRT028818 CHMP6 charged multivesicular body protein 6 1 1
MIRT028819 RXRB retinoid X receptor beta 1 1
MIRT028820 AUP1 ancient ubiquitous protein 1 1 1
MIRT028821 PLCB2 phospholipase C beta 2 1 1
MIRT028822 OTC ornithine carbamoyltransferase 1 1
MIRT028823 S100A1 S100 calcium binding protein A1 1 1
MIRT028824 MEP1A meprin A subunit alpha 1 1
MIRT028825 GNB5 G protein subunit beta 5 1 1
MIRT028826 HIST2H4A histone cluster 2 H4 family member a 1 1
MIRT028827 MCM3 minichromosome maintenance complex component 3 1 1
MIRT028828 OR2J3 olfactory receptor family 2 subfamily J member 3 1 1
MIRT028829 SEC61G Sec61 translocon gamma subunit 1 1
MIRT028830 ZNF141 zinc finger protein 141 1 1
MIRT028831 AP3M2 adaptor related protein complex 3 mu 2 subunit 1 1
MIRT028832 UGDH UDP-glucose 6-dehydrogenase 1 1
MIRT028833 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT028834 RGS20 regulator of G protein signaling 20 1 1
MIRT028835 DNAJC2 DnaJ heat shock protein family (Hsp40) member C2 1 1
MIRT028836 KIAA1033 WASH complex subunit 4 1 1
MIRT028837 TRAF1 TNF receptor associated factor 1 1 1
MIRT028838 IMPG1 interphotoreceptor matrix proteoglycan 1 1 1
MIRT028839 VPS54 VPS54, GARP complex subunit 1 1
MIRT028840 LIAS lipoic acid synthetase 1 1
MIRT028841 MED22 mediator complex subunit 22 1 1
MIRT028842 GCNT2 glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) 1 1
MIRT028843 XRCC2 X-ray repair cross complementing 2 1 1
MIRT028844 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 1 1
MIRT028845 PTCD3 pentatricopeptide repeat domain 3 1 1
MIRT028846 DMXL2 Dmx like 2 1 1
MIRT028847 CLOCK clock circadian regulator 1 1
MIRT028848 PLCB4 phospholipase C beta 4 1 1
MIRT028849 CAB39L calcium binding protein 39 like 1 1
MIRT028850 RAP1B RAP1B, member of RAS oncogene family 1 1
MIRT028851 ITFG1 integrin alpha FG-GAP repeat containing 1 1 1
MIRT028852 DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 1 1
MIRT028853 MT1M metallothionein 1M 1 1
MIRT028854 TNKS tankyrase 1 1
MIRT028855 LRRC40 leucine rich repeat containing 40 1 1
MIRT028856 DNMBP dynamin binding protein 2 2
MIRT028857 TOP1 DNA topoisomerase I 1 1
MIRT028858 ARMCX2 armadillo repeat containing, X-linked 2 1 1
MIRT028859 TMC7 transmembrane channel like 7 1 1
MIRT028860 MDM2 MDM2 proto-oncogene 2 10
MIRT028861 BMPR2 bone morphogenetic protein receptor type 2 2 2
MIRT028862 ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 1 1
MIRT028863 LUC7L LUC7 like 1 1
MIRT028864 SUCO SUN domain containing ossification factor 1 1
MIRT028865 MMP10 matrix metallopeptidase 10 1 1
MIRT028866 NAGK N-acetylglucosamine kinase 1 1
MIRT028867 CA11 carbonic anhydrase 11 1 1
MIRT028868 CLSTN1 calsyntenin 1 1 1
MIRT028869 LILRA4 leukocyte immunoglobulin like receptor A4 1 1
MIRT028870 PTRH2 peptidyl-tRNA hydrolase 2 1 1
MIRT028871 TMCO3 transmembrane and coiled-coil domains 3 1 1
MIRT028872 ZFPM2 zinc finger protein, FOG family member 2 1 1
MIRT028873 DEFA1 defensin alpha 1 1 1
MIRT028874 SUSD5 sushi domain containing 5 1 1
MIRT028875 MMP8 matrix metallopeptidase 8 1 1
MIRT028876 NSMAF neutral sphingomyelinase activation associated factor 1 1
MIRT028877 SLC1A6 solute carrier family 1 member 6 1 1
MIRT028878 PMPCA peptidase, mitochondrial processing alpha subunit 1 1
MIRT028879 ZC3H4 zinc finger CCCH-type containing 4 1 1
MIRT028880 ROM1 retinal outer segment membrane protein 1 1 1
MIRT028881 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 1 1
MIRT028882 CPA1 carboxypeptidase A1 1 1
MIRT028883 ANXA8L1 annexin A8 like 1 1 1
MIRT028884 C14orf2 chromosome 14 open reading frame 2 1 1
MIRT028885 P2RY6 pyrimidinergic receptor P2Y6 1 1
MIRT028886 SLC22A8 solute carrier family 22 member 8 1 1
MIRT028887 CDKN2D cyclin dependent kinase inhibitor 2D 1 1
MIRT028888 CXCL9 C-X-C motif chemokine ligand 9 1 1
MIRT028889 CYP4F11 cytochrome P450 family 4 subfamily F member 11 1 1
MIRT028890 RAB27A RAB27A, member RAS oncogene family 1 1
MIRT028891 IMP3 IMP3, U3 small nucleolar ribonucleoprotein 1 1
MIRT028892 TRIB1 tribbles pseudokinase 1 1 1
MIRT028893 RAD54L RAD54 like 1 1
MIRT028894 HSPA1L heat shock protein family A (Hsp70) member 1 like 1 1
MIRT028895 WLS wntless Wnt ligand secretion mediator 1 1
MIRT028896 GPR126 adhesion G protein-coupled receptor G6 1 1
MIRT028897 SRF serum response factor 1 1
MIRT028898 FAHD2A fumarylacetoacetate hydrolase domain containing 2A 1 1
MIRT028899 ITGB2 integrin subunit beta 2 1 1
MIRT028900 GRWD1 glutamate rich WD repeat containing 1 1 1
MIRT028901 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT028902 POLR2G RNA polymerase II subunit G 1 1
MIRT028903 C9orf114 SPOUT domain containing methyltransferase 1 1 1
MIRT028904 IGSF6 immunoglobulin superfamily member 6 1 1
MIRT028905 USP18 ubiquitin specific peptidase 18 1 1
MIRT028906 HEXA hexosaminidase subunit alpha 1 1
MIRT028907 SNORA70 small nucleolar RNA, H/ACA box 70 1 1
MIRT028908 CYBRD1 cytochrome b reductase 1 1 1
MIRT028909 GRB7 growth factor receptor bound protein 7 1 1
MIRT028910 PSMC6 proteasome 26S subunit, ATPase 6 1 1
MIRT028911 ZNF84 zinc finger protein 84 1 1
MIRT028912 PIDD p53-induced death domain protein 1 1 1
MIRT028913 NRN1 neuritin 1 1 1
MIRT028914 LRP1B LDL receptor related protein 1B 1 1
MIRT028915 ACOX2 acyl-CoA oxidase 2 1 1
MIRT028916 CXCL13 C-X-C motif chemokine ligand 13 1 1
MIRT028917 AGT angiotensinogen 1 1
MIRT028918 MYBPC1 myosin binding protein C, slow type 1 1
MIRT028919 PFDN5 prefoldin subunit 5 1 1
MIRT028920 SMPD3 sphingomyelin phosphodiesterase 3 1 1
MIRT028921 GRM8 glutamate metabotropic receptor 8 1 1
MIRT028922 IGHMBP2 immunoglobulin mu binding protein 2 1 1
MIRT028923 ZNF652 zinc finger protein 652 1 1
MIRT028924 PARK2 parkin RBR E3 ubiquitin protein ligase 1 1
MIRT028925 C22orf29 retrotransposon Gag like 10 1 1
MIRT028926 DGKI diacylglycerol kinase iota 1 1
MIRT028927 DLGAP4 DLG associated protein 4 1 1
MIRT028928 XDH xanthine dehydrogenase 1 1
MIRT028929 RRAGC Ras related GTP binding C 1 1
MIRT028930 PRRG3 proline rich and Gla domain 3 1 1
MIRT028931 DCAF16 DDB1 and CUL4 associated factor 16 1 1
MIRT028932 POU2F3 POU class 2 homeobox 3 1 1
MIRT028933 ERCC6L ERCC excision repair 6 like, spindle assembly checkpoint helicase 1 1
MIRT028934 AGL amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase 1 1
MIRT028935 APBB2 amyloid beta precursor protein binding family B member 2 1 1
MIRT028936 TRAF3 TNF receptor associated factor 3 1 1
MIRT028937 MAP2K4 mitogen-activated protein kinase kinase 4 1 1
MIRT028938 PPM1D protein phosphatase, Mg2+/Mn2+ dependent 1D 1 1
MIRT028939 BTG1 BTG anti-proliferation factor 1 1 1
MIRT028940 PCYOX1 prenylcysteine oxidase 1 1 1
MIRT028941 ATP6V0D1 ATPase H+ transporting V0 subunit d1 1 1
MIRT028942 DNAJA2 DnaJ heat shock protein family (Hsp40) member A2 1 1
MIRT028943 USP3 ubiquitin specific peptidase 3 2 2
MIRT028944 RNF125 ring finger protein 125 1 1
MIRT028945 TMEM168 transmembrane protein 168 1 1
MIRT028946 ACADM acyl-CoA dehydrogenase, C-4 to C-12 straight chain 1 1
MIRT028947 GREB1 growth regulation by estrogen in breast cancer 1 1 1
MIRT028948 HAUS8 HAUS augmin like complex subunit 8 2 3
MIRT028949 FKBP1B FK506 binding protein 1B 1 1
MIRT028950 TRAM1 translocation associated membrane protein 1 1 1
MIRT028951 KMT2C lysine methyltransferase 2C 1 1
MIRT028952 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT028953 NUBP2 nucleotide binding protein 2 1 1
MIRT028954 CA9 carbonic anhydrase 9 1 1
MIRT028955 TFPT TCF3 fusion partner 1 1
MIRT028956 GABRE gamma-aminobutyric acid type A receptor epsilon subunit 1 1
MIRT028957 HHLA3 HERV-H LTR-associating 3 1 1
MIRT028958 ZNF556 zinc finger protein 556 1 1
MIRT028959 KIFC3 kinesin family member C3 1 1
MIRT028960 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 1 1
MIRT028961 STON1-GTF2A1L STON1-GTF2A1L readthrough 1 1
MIRT028962 IL17RC interleukin 17 receptor C 1 1
MIRT028963 POLG DNA polymerase gamma, catalytic subunit 1 1
MIRT028964 GTPBP4 GTP binding protein 4 1 1
MIRT028965 TMEM230 transmembrane protein 230 1 1
MIRT028966 CYP4A11 cytochrome P450 family 4 subfamily A member 11 1 1
MIRT028967 ZCCHC8 zinc finger CCHC-type containing 8 1 1
MIRT028968 BCL11B B-cell CLL/lymphoma 11B 1 1
MIRT028969 POLA1 DNA polymerase alpha 1, catalytic subunit 1 1
MIRT028970 ADGB androglobin 1 1
MIRT028971 CREG1 cellular repressor of E1A stimulated genes 1 1 1
MIRT028972 NCBP1 nuclear cap binding protein subunit 1 1 1
MIRT028973 SCGB1D2 secretoglobin family 1D member 2 1 1
MIRT028974 GSTT2 glutathione S-transferase theta 2 (gene/pseudogene) 1 1
MIRT028975 WDR91 WD repeat domain 91 1 1
MIRT028976 CCNI cyclin I 1 1
MIRT028977 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 1 1
MIRT028978 AIFM1 apoptosis inducing factor mitochondria associated 1 1 1
MIRT028979 PCDHA6 protocadherin alpha 6 1 1
MIRT028980 SMAD7 SMAD family member 7 1 1
MIRT028981 WHAMMP3 WAS protein homolog associated with actin, golgi membranes and microtubules pseudogene 3 1 1
MIRT028982 SRGN serglycin 1 1
MIRT028983 TNFSF9 TNF superfamily member 9 1 1
MIRT028984 C17orf59 BLOC-1 related complex subunit 6 1 1
MIRT028985 TADA3 transcriptional adaptor 3 1 1
MIRT028986 NDUFS7 NADH:ubiquinone oxidoreductase core subunit S7 1 1
MIRT028987 CAAP1 caspase activity and apoptosis inhibitor 1 1 1
MIRT028988 SLC38A10 solute carrier family 38 member 10 1 1
MIRT028989 POMP proteasome maturation protein 1 1
MIRT028990 NR0B2 nuclear receptor subfamily 0 group B member 2 1 1
MIRT028991 STAT6 signal transducer and activator of transcription 6 1 1
MIRT028992 GYS1 glycogen synthase 1 1 1
MIRT028993 MAGEC3 MAGE family member C3 1 1
MIRT028994 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 1 1
MIRT028995 TGFBI transforming growth factor beta induced 1 1
MIRT028996 FBXO24 F-box protein 24 1 1
MIRT028997 NMRK2 nicotinamide riboside kinase 2 1 1
MIRT028998 PCDHA4 protocadherin alpha 4 1 1
MIRT028999 GJA5 gap junction protein alpha 5 1 1
MIRT029000 MAFG MAF bZIP transcription factor G 1 1
MIRT029001 ANAPC13 anaphase promoting complex subunit 13 1 1
MIRT029002 MAGT1 magnesium transporter 1 1 1
MIRT029003 OR10H2 olfactory receptor family 10 subfamily H member 2 1 1
MIRT029004 FHL5 four and a half LIM domains 5 1 1
MIRT029005 CMTM6 CKLF like MARVEL transmembrane domain containing 6 1 1
MIRT029006 FUT8 fucosyltransferase 8 1 1
MIRT029007 TRAPPC13 trafficking protein particle complex 13 1 1
MIRT029008 PSTPIP2 proline-serine-threonine phosphatase interacting protein 2 1 1
MIRT029009 RIPK4 receptor interacting serine/threonine kinase 4 1 1
MIRT029010 CHST4 carbohydrate sulfotransferase 4 1 1
MIRT029011 GPR27 G protein-coupled receptor 27 1 1
MIRT029012 TRIM58 tripartite motif containing 58 1 1
MIRT029013 IVNS1ABP influenza virus NS1A binding protein 1 1
MIRT029014 HIST2H2BF histone cluster 2 H2B family member f 1 1
MIRT029015 GFOD2 glucose-fructose oxidoreductase domain containing 2 1 1
MIRT029016 FGF23 fibroblast growth factor 23 1 1
MIRT029017 TRMT11 tRNA methyltransferase 11 homolog 1 1
MIRT029018 TRIM44 tripartite motif containing 44 1 1
MIRT029019 GRIK2 glutamate ionotropic receptor kainate type subunit 2 1 1
MIRT029020 TAZ tafazzin 1 1
MIRT029021 MLXIP MLX interacting protein 1 1
MIRT029022 MTERF mitochondrial transcription termination factor 1 1 1
MIRT029023 PCNT pericentrin 1 1
MIRT029024 ZFY zinc finger protein, Y-linked 1 1
MIRT029025 TMEM156 transmembrane protein 156 1 1
MIRT029026 RASAL2 RAS protein activator like 2 1 1
MIRT029027 CACNG3 calcium voltage-gated channel auxiliary subunit gamma 3 1 1
MIRT029028 GID4 GID complex subunit 4 homolog 1 1
MIRT029029 KIF1C kinesin family member 1C 1 1
MIRT029030 NPRL2 NPR2 like, GATOR1 complex subunit 1 1
MIRT029031 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT029032 MEF2C myocyte enhancer factor 2C 1 1
MIRT029033 SALL1 spalt like transcription factor 1 1 1
MIRT029034 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 1 1
MIRT029035 HOXC4 homeobox C4 1 1
MIRT029036 ADARB1 adenosine deaminase, RNA specific B1 1 1
MIRT029037 TMEM206 transmembrane protein 206 1 1
MIRT029038 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 1
MIRT029039 RNF6 ring finger protein 6 2 6
MIRT029040 KLHL24 kelch like family member 24 2 2
MIRT029041 ZBTB18 zinc finger and BTB domain containing 18 3 7
MIRT029042 SLC13A4 solute carrier family 13 member 4 1 1
MIRT029044 DGAT1 diacylglycerol O-acyltransferase 1 1 1
MIRT029045 LACTB2 lactamase beta 2 1 1
MIRT029046 CPA4 carboxypeptidase A4 1 1
MIRT029047 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT029048 ABCB6 ATP binding cassette subfamily B member 6 (Langereis blood group) 1 1
MIRT029049 PLXNA4 plexin A4 1 1
MIRT029050 BAHD1 bromo adjacent homology domain containing 1 1 1
MIRT029051 PLXNC1 plexin C1 1 1
MIRT029052 ELOVL2 ELOVL fatty acid elongase 2 1 1
MIRT029053 SLC6A9 solute carrier family 6 member 9 1 1
MIRT029054 ZNF140 zinc finger protein 140 1 1
MIRT029055 MVD mevalonate diphosphate decarboxylase 1 1
MIRT029056 MYEF2 myelin expression factor 2 1 1
MIRT029057 EAF2 ELL associated factor 2 1 1
MIRT029058 GUF1 GUF1 homolog, GTPase 1 1
MIRT029059 SH3BP1 SH3 domain binding protein 1 1 1
MIRT029060 CMC4 C-X9-C motif containing 4 1 1
MIRT029061 ING2 inhibitor of growth family member 2 1 1
MIRT029062 MUC7 mucin 7, secreted 1 1
MIRT029063 NOC3L NOC3 like DNA replication regulator 1 1
MIRT029064 PLCH2 phospholipase C eta 2 1 1
MIRT029065 PLEKHA1 pleckstrin homology domain containing A1 1 1
MIRT029066 ROGDI rogdi homolog 1 1
MIRT029067 LGALSL galectin like 1 1
MIRT029068 KRTAP5-3 keratin associated protein 5-3 1 1
MIRT029069 NSF N-ethylmaleimide sensitive factor, vesicle fusing ATPase 1 1
MIRT029070 SMN2 survival of motor neuron 2, centromeric 1 1
MIRT029071 EIF1AY eukaryotic translation initiation factor 1A, Y-linked 1 1
MIRT029072 ZNF573 zinc finger protein 573 1 1
MIRT029073 PHLDA2 pleckstrin homology like domain family A member 2 1 1
MIRT029074 ZBED1 zinc finger BED-type containing 1 1 1
MIRT029075 FANCC Fanconi anemia complementation group C 1 1
MIRT029076 QDPR quinoid dihydropteridine reductase 1 1
MIRT029077 KIAA0922 transmembrane 131 like 1 1
MIRT029078 CMC2 C-X9-C motif containing 2 1 1
MIRT029079 FN1 fibronectin 1 1 1
MIRT029080 STARD7 StAR related lipid transfer domain containing 7 1 1
MIRT029081 ATF3 activating transcription factor 3 1 1
MIRT029082 RNASET2 ribonuclease T2 1 1
MIRT029083 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT029084 ZNF696 zinc finger protein 696 1 1
MIRT029085 RAD54L2 RAD54 like 2 1 1
MIRT029086 GSTT2B glutathione S-transferase theta 2B (gene/pseudogene) 1 1
MIRT029087 CRADD CASP2 and RIPK1 domain containing adaptor with death domain 1 1
MIRT029088 TMEM30A transmembrane protein 30A 2 2
MIRT029089 ASTN2 astrotactin 2 1 1
MIRT029090 FOLR2 folate receptor beta 1 1
MIRT029091 ITM2A integral membrane protein 2A 1 1
MIRT029092 RBM41 RNA binding motif protein 41 1 1
MIRT029093 IL20RA interleukin 20 receptor subunit alpha 1 1
MIRT029094 NARS2 asparaginyl-tRNA synthetase 2, mitochondrial (putative) 1 1
MIRT029095 OR10H5 olfactory receptor family 10 subfamily H member 5 1 1
MIRT029096 KHDC1 KH domain containing 1 1 1
MIRT029097 ARMC7 armadillo repeat containing 7 1 1
MIRT029098 WDR4 WD repeat domain 4 1 1
MIRT029099 ACADS acyl-CoA dehydrogenase, C-2 to C-3 short chain 1 1
MIRT029100 MT1P3 metallothionein 1 pseudogene 3 1 1
MIRT029101 MYBBP1A MYB binding protein 1a 1 1
MIRT029102 SLC34A2 solute carrier family 34 member 2 1 1
MIRT029103 INPP5A inositol polyphosphate-5-phosphatase A 1 1
MIRT029104 MKNK1 MAP kinase interacting serine/threonine kinase 1 1 1
MIRT029105 SLC27A6 solute carrier family 27 member 6 1 1
MIRT029106 ATP7B ATPase copper transporting beta 1 1
MIRT029107 N6AMT1 N-6 adenine-specific DNA methyltransferase 1 1 1
MIRT029108 KRT222 keratin 222 1 1
MIRT029109 KIAA0232 KIAA0232 1 1
MIRT029110 SLBP stem-loop binding protein 1 1
MIRT029111 ST8SIA2 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2 1 1
MIRT029112 ZNF81 zinc finger protein 81 1 1
MIRT029113 KIAA1024 KIAA1024 1 1
MIRT029114 IGSF3 immunoglobulin superfamily member 3 1 1
MIRT029115 RBM12B RNA binding motif protein 12B 1 1
MIRT029116 LIN28A lin-28 homolog A 1 1
MIRT029117 PKD2 polycystin 2, transient receptor potential cation channel 1 1
MIRT029118 SYNE2 spectrin repeat containing nuclear envelope protein 2 1 1
MIRT029119 KIAA0368 KIAA0368 1 1
MIRT029120 BRD4 bromodomain containing 4 1 1
MIRT029121 JHDM1D lysine demethylase 7A 1 1
MIRT029122 IFNG interferon gamma 1 1
MIRT029123 MATR3 matrin 3 1 1
MIRT029124 SREK1IP1 SREK1 interacting protein 1 1 1
MIRT029125 MED23 mediator complex subunit 23 1 1
MIRT029126 RCBTB1 RCC1 and BTB domain containing protein 1 1 1
MIRT029127 RTF1 RTF1 homolog, Paf1/RNA polymerase II complex component 1 2
MIRT029128 OR10H1 olfactory receptor family 10 subfamily H member 1 1 1
MIRT029129 ADI1 acireductone dioxygenase 1 1 1
MIRT029130 FAM136A family with sequence similarity 136 member A 1 1
MIRT029131 SLC39A6 solute carrier family 39 member 6 1 1
MIRT029132 OR2F2 olfactory receptor family 2 subfamily F member 2 1 1
MIRT029133 TRPV6 transient receptor potential cation channel subfamily V member 6 1 1
MIRT029134 SPRY1 sprouty RTK signaling antagonist 1 1 1
MIRT029135 LONP1 lon peptidase 1, mitochondrial 1 1
MIRT029136 FAM168B family with sequence similarity 168 member B 1 1
MIRT029137 NPTN neuroplastin 1 1
MIRT029138 GSTA1 glutathione S-transferase alpha 1 1 1
MIRT029139 BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 1 1
MIRT029140 STK16 serine/threonine kinase 16 1 1
MIRT029141 RASGRF1 Ras protein specific guanine nucleotide releasing factor 1 1 1
MIRT029142 OR1A2 olfactory receptor family 1 subfamily A member 2 1 1
MIRT029143 LRRC8E leucine rich repeat containing 8 VRAC subunit E 1 1
MIRT029144 FADS2 fatty acid desaturase 2 1 1
MIRT029145 CNTLN centlein 1 1
MIRT029146 TMEM132A transmembrane protein 132A 1 1
MIRT029147 GTF2IRD2B GTF2I repeat domain containing 2B 1 1
MIRT029148 CAPN9 calpain 9 1 1
MIRT029149 SUN1 Sad1 and UNC84 domain containing 1 1 1
MIRT029150 KIR3DX1 killer cell immunoglobulin like receptor, three Ig domains X1 1 1
MIRT029151 CBLL1 Cbl proto-oncogene like 1 1 1
MIRT029152 SELENBP1 selenium binding protein 1 1 1
MIRT029153 ZNF35 zinc finger protein 35 1 1
MIRT029154 MYT1L myelin transcription factor 1 like 1 1
MIRT029155 OFD1 OFD1, centriole and centriolar satellite protein 1 1
MIRT029156 TMEM208 transmembrane protein 208 1 1
MIRT029157 PNMT phenylethanolamine N-methyltransferase 1 1
MIRT029158 CASP8 caspase 8 1 1
MIRT029159 TFB2M transcription factor B2, mitochondrial 1 1
MIRT029160 C11orf16 chromosome 11 open reading frame 16 1 1
MIRT029161 RPL39 ribosomal protein L39 1 1
MIRT029162 RASSF9 Ras association domain family member 9 1 1
MIRT029163 TRPC7 transient receptor potential cation channel subfamily C member 7 1 1
MIRT029164 PIAS2 protein inhibitor of activated STAT 2 1 1
MIRT029165 NVL nuclear VCP-like 1 1
MIRT029166 THAP3 THAP domain containing 3 1 1
MIRT029167 YIPF5 Yip1 domain family member 5 1 1
MIRT029168 USP14 ubiquitin specific peptidase 14 1 1
MIRT029169 UBE2E1 ubiquitin conjugating enzyme E2 E1 1 1
MIRT029170 CHMP3 charged multivesicular body protein 3 1 1
MIRT029171 POTEF POTE ankyrin domain family member F 1 1
MIRT029172 IL1RL1 interleukin 1 receptor like 1 1 1
MIRT029173 ALKBH4 alkB homolog 4, lysine demethylase 1 1
MIRT029174 DCHS2 dachsous cadherin-related 2 1 1
MIRT029175 KCND1 potassium voltage-gated channel subfamily D member 1 1 1
MIRT029176 TRIM6-TRIM34 TRIM6-TRIM34 readthrough 1 1
MIRT029177 CBY1 chibby family member 1, beta catenin antagonist 1 1
MIRT029178 CDH5 cadherin 5 1 1
MIRT029179 VAV1 vav guanine nucleotide exchange factor 1 1 1
MIRT029180 SIX5 SIX homeobox 5 1 1
MIRT029181 CYP2D7P1 cytochrome P450 family 2 subfamily D member 7 (gene/pseudogene) 1 1
MIRT029182 TCTA T-cell leukemia translocation altered 1 1
MIRT029183 SERPINB5 serpin family B member 5 1 1
MIRT029184 AKAP5 A-kinase anchoring protein 5 1 1
MIRT029185 ARMC1 armadillo repeat containing 1 1 1
MIRT029186 ICAM5 intercellular adhesion molecule 5 1 1
MIRT029187 TP53I3 tumor protein p53 inducible protein 3 1 1
MIRT029188 TARBP2 TARBP2, RISC loading complex RNA binding subunit 1 1
MIRT029189 CYTH1 cytohesin 1 1 1
MIRT029190 CXCR6 C-X-C motif chemokine receptor 6 1 1
MIRT029191 ZNF23 zinc finger protein 23 1 1
MIRT029192 VPS33A VPS33A, CORVET/HOPS core subunit 1 1
MIRT029193 NAE1 NEDD8 activating enzyme E1 subunit 1 1 1
MIRT029194 FDXR ferredoxin reductase 1 1
MIRT029195 BRD3 bromodomain containing 3 1 1
MIRT029196 NLGN4X neuroligin 4, X-linked 1 1
MIRT029197 DIABLO diablo IAP-binding mitochondrial protein 1 1
MIRT029198 KAT2B lysine acetyltransferase 2B 1 1
MIRT029199 CDK19 cyclin dependent kinase 19 1 1
MIRT029200 DNAL4 dynein axonemal light chain 4 1 1
MIRT029201 MICU2 mitochondrial calcium uptake 2 1 1
MIRT029202 PLAG1 PLAG1 zinc finger 1 1
MIRT029203 RAI14 retinoic acid induced 14 1 1
MIRT029204 TMEM50B transmembrane protein 50B 1 1
MIRT029205 LRPAP1 LDL receptor related protein associated protein 1 1 1
MIRT029206 UBE2V2 ubiquitin conjugating enzyme E2 V2 1 1
MIRT029207 ERCC8 ERCC excision repair 8, CSA ubiquitin ligase complex subunit 1 1
MIRT029208 MAGEA9B MAGE family member A9B 1 1
MIRT029209 CSNK1G1 casein kinase 1 gamma 1 1 1
MIRT029210 PSMD7 proteasome 26S subunit, non-ATPase 7 1 1
MIRT029211 ARHGAP44 Rho GTPase activating protein 44 1 1
MIRT029212 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT029213 SEC22A SEC22 homolog A, vesicle trafficking protein 1 1
MIRT029214 OSTM1 osteopetrosis associated transmembrane protein 1 1 1
MIRT029215 SPATA6 spermatogenesis associated 6 1 1
MIRT029216 MAT2A methionine adenosyltransferase 2A 2 11
MIRT029217 G3BP2 G3BP stress granule assembly factor 2 1 1
MIRT029218 POLR3G RNA polymerase III subunit G 2 3
MIRT029219 BOLA2 bolA family member 2 1 1
MIRT029220 S100P S100 calcium binding protein P 1 1
MIRT029221 METTL9 methyltransferase like 9 1 1
MIRT029222 OR2S2 olfactory receptor family 2 subfamily S member 2 (gene/pseudogene) 1 1
MIRT029223 TIPRL TOR signaling pathway regulator 1 1
MIRT029224 SLC22A13 solute carrier family 22 member 13 1 1
MIRT029225 RGCC regulator of cell cycle 1 1
MIRT029226 CRYL1 crystallin lambda 1 1 1
MIRT029227 INSR insulin receptor 1 1
MIRT029228 TAC3 tachykinin 3 1 1
MIRT029229 TCEAL1 transcription elongation factor A like 1 1 1
MIRT029230 PAF1 PAF1 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT029231 GPR135 G protein-coupled receptor 135 1 1
MIRT029232 RBMY1F RNA binding motif protein, Y-linked, family 1, member F 1 1
MIRT029233 INHA inhibin alpha subunit 1 1
MIRT029234 ATP6V1A ATPase H+ transporting V1 subunit A 1 1
MIRT029235 PRR4 proline rich 4 (lacrimal) 1 1
MIRT029236 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif 1 1 1
MIRT029237 PAK6 p21 (RAC1) activated kinase 6 1 1
MIRT029238 MANSC1 MANSC domain containing 1 1 1
MIRT029239 TCTN2 tectonic family member 2 1 1
MIRT029240 ZNF672 zinc finger protein 672 1 1
MIRT029241 ERAP2 endoplasmic reticulum aminopeptidase 2 1 1
MIRT029242 SESN1 sestrin 1 1 1
MIRT029243 MCUR1 mitochondrial calcium uniporter regulator 1 1 1
MIRT029244 CASP9 caspase 9 1 1
MIRT029245 CLEC2B C-type lectin domain family 2 member B 1 1
MIRT029246 EIF2B1 eukaryotic translation initiation factor 2B subunit alpha 1 1
MIRT029247 STX12 syntaxin 12 1 1
MIRT029248 TSEN34 tRNA splicing endonuclease subunit 34 1 1
MIRT029249 TNP2 transition protein 2 1 1
MIRT029250 BMP2 bone morphogenetic protein 2 1 1
MIRT029251 NELFE negative elongation factor complex member E 1 1
MIRT029252 KIAA1107 KIAA1107 1 1
MIRT029253 TIA1 TIA1 cytotoxic granule associated RNA binding protein 1 1
MIRT029254 TMEM187 transmembrane protein 187 1 1
MIRT029255 PUS7 pseudouridylate synthase 7 (putative) 1 1
MIRT029256 MPI mannose phosphate isomerase 1 1
MIRT029257 SNRPN small nuclear ribonucleoprotein polypeptide N 1 1
MIRT029258 DNAJC12 DnaJ heat shock protein family (Hsp40) member C12 1 1
MIRT029259 MGST3 microsomal glutathione S-transferase 3 1 1
MIRT029260 TPPP tubulin polymerization promoting protein 1 1
MIRT029261 CPN2 carboxypeptidase N subunit 2 1 1
MIRT029262 ADNP activity dependent neuroprotector homeobox 1 1
MIRT029263 HMGN5 high mobility group nucleosome binding domain 5 1 1
MIRT029264 KRT4 keratin 4 1 1
MIRT029265 SERPINB1 serpin family B member 1 1 1
MIRT029266 SCGB1D1 secretoglobin family 1D member 1 1 1
MIRT029267 GTF2IRD2 GTF2I repeat domain containing 2 1 1
MIRT029268 CLIC2 chloride intracellular channel 2 1 1
MIRT029269 DAK triokinase and FMN cyclase 1 1
MIRT029270 DUSP7 dual specificity phosphatase 7 1 1
MIRT029271 TESK1 testis-specific kinase 1 1 1
MIRT029272 SLC2A4RG SLC2A4 regulator 1 1
MIRT029273 NDUFA1 NADH:ubiquinone oxidoreductase subunit A1 1 1
MIRT029274 CCDC15 coiled-coil domain containing 15 1 1
MIRT029275 IDH2 isocitrate dehydrogenase (NADP(+)) 2, mitochondrial 1 1
MIRT029276 ALX1 ALX homeobox 1 1 1
MIRT029277 CXCR1 C-X-C motif chemokine receptor 1 1 1
MIRT029278 PTPRJ protein tyrosine phosphatase, receptor type J 1 1
MIRT029279 SNX2 sorting nexin 2 1 1
MIRT029280 MADD MAP kinase activating death domain 1 1
MIRT029281 GNL3 G protein nucleolar 3 1 1
MIRT029282 VIPAS39 VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog 1 1
MIRT029283 SHOC2 SHOC2, leucine rich repeat scaffold protein 1 1
MIRT029284 RPL28 ribosomal protein L28 1 1
MIRT029285 TOR1B torsin family 1 member B 1 1
MIRT029286 POP4 POP4 homolog, ribonuclease P/MRP subunit 1 1
MIRT029287 MDM1 Mdm1 nuclear protein 1 1
MIRT029288 ANKRD46 ankyrin repeat domain 46 1 1
MIRT029289 RPA3 replication protein A3 1 1
MIRT029290 BNC2 basonuclin 2 1 1
MIRT029291 SYNE1 spectrin repeat containing nuclear envelope protein 1 1 1
MIRT029292 ROS1 ROS proto-oncogene 1, receptor tyrosine kinase 1 1
MIRT029293 PCCB propionyl-CoA carboxylase beta subunit 1 1
MIRT029294 RYR3 ryanodine receptor 3 1 1
MIRT029295 TSC22D2 TSC22 domain family member 2 3 3
MIRT029296 CDK14 cyclin dependent kinase 14 1 1
MIRT029297 IFRD1 interferon related developmental regulator 1 1 1
MIRT029298 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT029299 TMEM2 transmembrane protein 2 3 3
MIRT029300 KIAA1704 GPALPP motifs containing 1 1 1
MIRT029301 FAM98A family with sequence similarity 98 member A 1 1
MIRT029302 MESDC2 mesoderm development LRP chaperone 1 1
MIRT029303 PPP3R1 protein phosphatase 3 regulatory subunit B, alpha 1 1
MIRT029304 PTP4A1 protein tyrosine phosphatase type IVA, member 1 1 1
MIRT029305 IL3 interleukin 3 1 1
MIRT029306 MRPS18B mitochondrial ribosomal protein S18B 1 1
MIRT029307 HMOX1 heme oxygenase 1 1 1
MIRT029308 DNAJA3 DnaJ heat shock protein family (Hsp40) member A3 1 1
MIRT029309 PSMB8 proteasome subunit beta 8 1 1
MIRT029310 LGMN legumain 1 1
MIRT029311 KANK2 KN motif and ankyrin repeat domains 2 1 1
MIRT029312 MED31 mediator complex subunit 31 1 1
MIRT029313 MPDU1 mannose-P-dolichol utilization defect 1 1 1
MIRT029314 C8orf33 chromosome 8 open reading frame 33 1 1
MIRT029315 RAD51C RAD51 paralog C 1 1
MIRT029316 CERK ceramide kinase 1 1
MIRT029317 ACSF2 acyl-CoA synthetase family member 2 1 1
MIRT029318 PDK1 pyruvate dehydrogenase kinase 1 1 1
MIRT029319 PPP1R14B protein phosphatase 1 regulatory inhibitor subunit 14B 1 1
MIRT029320 GSTP1 glutathione S-transferase pi 1 1 1
MIRT029321 HNRNPM heterogeneous nuclear ribonucleoprotein M 1 1
MIRT029322 CYP4A22 cytochrome P450 family 4 subfamily A member 22 1 1
MIRT029323 TLE4 transducin like enhancer of split 4 1 1
MIRT029324 SAMD14 sterile alpha motif domain containing 14 1 1
MIRT029325 PSMC4 proteasome 26S subunit, ATPase 4 1 1
MIRT029326 HSF2 heat shock transcription factor 2 1 1
MIRT029327 CYB5R4 cytochrome b5 reductase 4 1 1
MIRT029328 COMMD3 COMM domain containing 3 1 1
MIRT029329 HECA hdc homolog, cell cycle regulator 1 1
MIRT029330 RRP15 ribosomal RNA processing 15 homolog 1 1
MIRT029331 ASNA1 arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) 1 1
MIRT029332 EI24 EI24, autophagy associated transmembrane protein 1 1
MIRT029333 ID1 inhibitor of DNA binding 1, HLH protein 1 1
MIRT029334 ZMAT4 zinc finger matrin-type 4 1 1
MIRT029335 AEN apoptosis enhancing nuclease 1 1
MIRT029336 GEM GTP binding protein overexpressed in skeletal muscle 1 1
MIRT029337 NEK9 NIMA related kinase 9 1 1
MIRT029338 CCDC181 coiled-coil domain containing 181 1 1
MIRT029339 RCBTB2 RCC1 and BTB domain containing protein 2 1 1
MIRT029340 KCNN2 potassium calcium-activated channel subfamily N member 2 1 1
MIRT029341 COL4A4 collagen type IV alpha 4 chain 1 1
MIRT029342 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 1 1
MIRT029343 KIAA1644 KIAA1644 1 1
MIRT029344 CD97 adhesion G protein-coupled receptor E5 1 1
MIRT029345 LY6D lymphocyte antigen 6 family member D 1 1
MIRT029346 CDK18 cyclin dependent kinase 18 1 1
MIRT029347 CCDC109B mitochondrial calcium uniporter dominant negative beta subunit 1 1
MIRT029348 BUD31 BUD31 homolog 1 1
MIRT029349 GPX4 glutathione peroxidase 4 1 1
MIRT029350 METTL16 methyltransferase like 16 1 1
MIRT029351 YIF1A Yip1 interacting factor homolog A, membrane trafficking protein 1 1
MIRT029352 PLS1 plastin 1 1 1
MIRT029353 CRELD1 cysteine rich with EGF like domains 1 1 1
MIRT029354 GP1BB glycoprotein Ib platelet beta subunit 1 1
MIRT029355 EMP3 epithelial membrane protein 3 1 1
MIRT029356 BRSK2 BR serine/threonine kinase 2 1 1
MIRT029357 GDI1 GDP dissociation inhibitor 1 1 1
MIRT029358 ZKSCAN3 zinc finger with KRAB and SCAN domains 3 1 1
MIRT029359 HSF4 heat shock transcription factor 4 1 1
MIRT029360 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT029361 TMEM74B transmembrane protein 74B 1 1
MIRT029362 USP32P1 ubiquitin specific peptidase 32 pseudogene 1 1 1
MIRT029363 NTSR1 neurotensin receptor 1 1 1
MIRT029364 WASF2 WAS protein family member 2 1 1
MIRT029365 ARL5A ADP ribosylation factor like GTPase 5A 1 1
MIRT029366 HSD17B2 hydroxysteroid 17-beta dehydrogenase 2 1 1
MIRT029367 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT029368 FAM20B FAM20B, glycosaminoglycan xylosylkinase 1 1
MIRT029369 MMD monocyte to macrophage differentiation associated 1 1
MIRT029370 MIA3 MIA family member 3, ER export factor 1 1
MIRT029371 DUSP21 dual specificity phosphatase 21 1 1
MIRT029372 MCMBP minichromosome maintenance complex binding protein 1 1
MIRT029373 TAF4B TATA-box binding protein associated factor 4b 1 1
MIRT029374 PDE12 phosphodiesterase 12 3 3
MIRT029375 PEX5L peroxisomal biogenesis factor 5 like 1 1
MIRT029376 GINS4 GINS complex subunit 4 1 1
MIRT029377 SMNDC1 survival motor neuron domain containing 1 1 1
MIRT029378 DYNC2LI1 dynein cytoplasmic 2 light intermediate chain 1 1 1
MIRT029379 PDSS2 decaprenyl diphosphate synthase subunit 2 1 1
MIRT029380 GDE1 glycerophosphodiester phosphodiesterase 1 1 1
MIRT029381 FAM118A family with sequence similarity 118 member A 1 1
MIRT029382 GTF2A2 general transcription factor IIA subunit 2 1 1
MIRT029383 MNAT1 MNAT1, CDK activating kinase assembly factor 1 1
MIRT029384 FGF9 fibroblast growth factor 9 1 1
MIRT029385 RPS6KA6 ribosomal protein S6 kinase A6 1 1
MIRT029386 SIRT4 sirtuin 4 1 1
MIRT029387 RSRC2 arginine and serine rich coiled-coil 2 1 1
MIRT029388 RAP2C RAP2C, member of RAS oncogene family 1 1
MIRT029389 CREBZF CREB/ATF bZIP transcription factor 2 6
MIRT029390 TEX30 testis expressed 30 1 1
MIRT029391 THOC7 THO complex 7 1 1
MIRT029392 UQCRC2 ubiquinol-cytochrome c reductase core protein II 1 1
MIRT029393 UPF3B UPF3B, regulator of nonsense mediated mRNA decay 1 1
MIRT029394 UBE3C ubiquitin protein ligase E3C 1 1
MIRT029395 PDHA2 pyruvate dehydrogenase E1 alpha 2 subunit 1 1
MIRT029396 KIF4A kinesin family member 4A 1 1
MIRT029397 HSPB7 heat shock protein family B (small) member 7 1 1
MIRT029398 SF3B2 splicing factor 3b subunit 2 1 1
MIRT029399 TXNRD1 thioredoxin reductase 1 1 1
MIRT029400 ODAM odontogenic, ameloblast associated 1 1
MIRT029401 NR4A3 nuclear receptor subfamily 4 group A member 3 1 1
MIRT029402 EFNA4 ephrin A4 1 1
MIRT029403 DCTN3 dynactin subunit 3 1 1
MIRT029404 RAB36 RAB36, member RAS oncogene family 1 1
MIRT029405 FOXG1 forkhead box G1 1 1
MIRT029406 KHK ketohexokinase 1 1
MIRT029407 GBP2 guanylate binding protein 2 1 1
MIRT029408 ADAM18 ADAM metallopeptidase domain 18 1 1
MIRT029409 CCL7 C-C motif chemokine ligand 7 1 1
MIRT029410 MRPS15 mitochondrial ribosomal protein S15 1 1
MIRT029411 ARL17A ADP ribosylation factor like GTPase 17A 1 1
MIRT029412 MTX1 metaxin 1 1 1
MIRT029413 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT029414 WRAP73 WD repeat containing, antisense to TP73 1 1
MIRT029415 GPRC5A G protein-coupled receptor class C group 5 member A 1 1
MIRT029416 ABCD1 ATP binding cassette subfamily D member 1 1 1
MIRT029417 LBH limb bud and heart development 1 1
MIRT029418 SRP9 signal recognition particle 9 1 1
MIRT029419 LMCD1 LIM and cysteine rich domains 1 1 1
MIRT029420 GABBR1 gamma-aminobutyric acid type B receptor subunit 1 1 1
MIRT029421 RAB32 RAB32, member RAS oncogene family 1 1
MIRT029422 RBM19 RNA binding motif protein 19 1 1
MIRT029423 TK1 thymidine kinase 1 1 1
MIRT029424 BOLA2B bolA family member 2B 1 1
MIRT029425 GLRX glutaredoxin 1 1
MIRT029426 ZNF549 zinc finger protein 549 1 1
MIRT029427 GPBP1L1 GC-rich promoter binding protein 1 like 1 1 1
MIRT029428 PDGFRL platelet derived growth factor receptor like 1 1
MIRT029429 RBMY1HP RNA binding motif protein, Y-linked, family 1, member H, pseudogene 1 1
MIRT029430 CTSZ cathepsin Z 1 1
MIRT029431 GAS2 growth arrest specific 2 1 1
MIRT029432 IKBKAP elongator complex protein 1 1 1
MIRT029433 KLRC2 killer cell lectin like receptor C2 1 1
MIRT029434 BLVRB biliverdin reductase B 1 1
MIRT029435 SLC25A23 solute carrier family 25 member 23 1 1
MIRT029436 VIM vimentin 1 1
MIRT029437 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 1 1
MIRT029438 TGM1 transglutaminase 1 1 1
MIRT029439 CBLC Cbl proto-oncogene C 1 1
MIRT029440 STIL STIL, centriolar assembly protein 1 1
MIRT029441 IFI16 interferon gamma inducible protein 16 1 1
MIRT029442 ANO2 anoctamin 2 1 1
MIRT029443 IL17RB interleukin 17 receptor B 1 1
MIRT029444 PDGFB platelet derived growth factor subunit B 1 1
MIRT029445 OXCT1 3-oxoacid CoA-transferase 1 1 1
MIRT029446 UFSP2 UFM1 specific peptidase 2 1 1
MIRT029447 VCP valosin containing protein 1 1
MIRT029448 CBX6 chromobox 6 1 1
MIRT029449 UBQLN3 ubiquilin 3 1 1
MIRT029450 SUPT5H SPT5 homolog, DSIF elongation factor subunit 1 1
MIRT029451 PRY PTPN13-like, Y-linked 1 1
MIRT029452 ECT2 epithelial cell transforming 2 1 1
MIRT029453 DUT deoxyuridine triphosphatase 1 1
MIRT029454 SMN1 survival of motor neuron 1, telomeric 1 1
MIRT029455 PDIA5 protein disulfide isomerase family A member 5 1 1
MIRT029456 RABL3 RAB, member of RAS oncogene family like 3 1 1
MIRT029457 NMD3 NMD3 ribosome export adaptor 1 1
MIRT029458 PSAT1 phosphoserine aminotransferase 1 3 7
MIRT029459 SNAPC5 small nuclear RNA activating complex polypeptide 5 1 1
MIRT029460 IGF2R insulin like growth factor 2 receptor 1 1
MIRT029461 KIAA1462 junctional cadherin 5 associated 1 1
MIRT029462 CDC14B cell division cycle 14B 1 1
MIRT029463 SACM1L SAC1 like phosphatidylinositide phosphatase 1 1
MIRT029464 ASXL3 additional sex combs like 3, transcriptional regulator 3 3
MIRT029465 MRPL22 mitochondrial ribosomal protein L22 1 1
MIRT029466 SKIL SKI like proto-oncogene 1 1
MIRT029467 COL5A1 collagen type V alpha 1 chain 1 1
MIRT029468 INTS7 integrator complex subunit 7 1 1
MIRT029469 FBXO3 F-box protein 3 1 1
MIRT029470 ADAP2 ArfGAP with dual PH domains 2 1 1
MIRT029471 ENOSF1 enolase superfamily member 1 1 1
MIRT029472 CPM carboxypeptidase M 1 1
MIRT029473 ATAD2B ATPase family, AAA domain containing 2B 1 1
MIRT029474 CHERP calcium homeostasis endoplasmic reticulum protein 1 1
MIRT029475 SRSF6 serine and arginine rich splicing factor 6 1 1
MIRT029476 BEND4 BEN domain containing 4 1 1
MIRT029477 FAM49B family with sequence similarity 49 member B 1 1
MIRT029478 VANGL2 VANGL planar cell polarity protein 2 2 4
MIRT029479 BABAM1 BRISC and BRCA1 A complex member 1 1 1
MIRT029480 FAM208B family with sequence similarity 208 member B 1 1
MIRT029481 BAG3 BCL2 associated athanogene 3 1 1
MIRT029482 CYP2F1 cytochrome P450 family 2 subfamily F member 1 1 1
MIRT029483 CCND1 cyclin D1 1 1
MIRT029484 PBXIP1 PBX homeobox interacting protein 1 1 1
MIRT029485 LRP4 LDL receptor related protein 4 1 1
MIRT029486 ZNF133 zinc finger protein 133 1 1
MIRT029487 MGP matrix Gla protein 1 1
MIRT029488 RBM3 RNA binding motif (RNP1, RRM) protein 3 1 1
MIRT029489 MEAF6 MYST/Esa1 associated factor 6 1 1
MIRT029490 PRDM13 PR/SET domain 13 1 1
MIRT029491 NFKBIE NFKB inhibitor epsilon 1 1
MIRT029492 CDCA3 cell division cycle associated 3 1 1
MIRT029493 PPT1 palmitoyl-protein thioesterase 1 1 1
MIRT029494 RAE1 ribonucleic acid export 1 1 1
MIRT029495 ASNS asparagine synthetase (glutamine-hydrolyzing) 1 1
MIRT029496 COL15A1 collagen type XV alpha 1 chain 1 1
MIRT029497 DSCC1 DNA replication and sister chromatid cohesion 1 1 1
MIRT029498 KDM4A lysine demethylase 4A 1 1
MIRT029499 MIR22HG MIR22 host gene 1 1
MIRT029500 COX7A2L cytochrome c oxidase subunit 7A2 like 1 1
MIRT029501 C17orf53 chromosome 17 open reading frame 53 1 1
MIRT029502 NRD1 nardilysin convertase 1 1
MIRT029503 TLX3 T-cell leukemia homeobox 3 1 1
MIRT029504 POLR2H RNA polymerase II subunit H 1 1
MIRT029505 QARS glutaminyl-tRNA synthetase 1 1
MIRT029506 INPP5K inositol polyphosphate-5-phosphatase K 1 1
MIRT029507 TUSC3 tumor suppressor candidate 3 1 1
MIRT029508 PBX3 PBX homeobox 3 1 1
MIRT029509 CCL27 C-C motif chemokine ligand 27 1 1
MIRT029510 TAS2R10 taste 2 receptor member 10 1 1
MIRT029511 CHST7 carbohydrate sulfotransferase 7 1 1
MIRT029512 SLC35C1 solute carrier family 35 member C1 1 1
MIRT029513 ALPI alkaline phosphatase, intestinal 1 1
MIRT029514 PRR14 proline rich 14 1 1
MIRT029515 POLD4 DNA polymerase delta 4, accessory subunit 1 1
MIRT029516 TPD52L2 tumor protein D52 like 2 1 1
MIRT029517 CLTA clathrin light chain A 1 1
MIRT029518 ATP1A3 ATPase Na+/K+ transporting subunit alpha 3 1 1
MIRT029519 ADPGK ADP dependent glucokinase 1 1
MIRT029520 AOX1 aldehyde oxidase 1 1 1
MIRT029521 IFRD2 interferon related developmental regulator 2 1 1
MIRT029522 CISH cytokine inducible SH2 containing protein 1 1
MIRT029523 GADD45GIP1 GADD45G interacting protein 1 1 1
MIRT029524 ARFRP1 ADP ribosylation factor related protein 1 1 1
MIRT029525 FKBP9L FK506 binding protein 9 pseudogene 1 1 1
MIRT029526 FAM114A2 family with sequence similarity 114 member A2 1 1
MIRT029527 CPB2 carboxypeptidase B2 1 1
MIRT029528 GINS1 GINS complex subunit 1 1 1
MIRT029529 CCDC25 coiled-coil domain containing 25 1 1
MIRT029530 AKT1 AKT serine/threonine kinase 1 1 1
MIRT029531 SLC35D2 solute carrier family 35 member D2 1 1
MIRT029532 NOP2 NOP2 nucleolar protein 1 1
MIRT029533 POLR2F RNA polymerase II subunit F 1 1
MIRT029534 CYP24A1 cytochrome P450 family 24 subfamily A member 1 1 1
MIRT029535 WISP3 WNT1 inducible signaling pathway protein 3 1 1
MIRT029536 LRRC17 leucine rich repeat containing 17 1 1
MIRT029537 RNF24 ring finger protein 24 1 1
MIRT029538 FOLH1 folate hydrolase 1 1 1
MIRT029539 BLNK B-cell linker 1 1
MIRT029540 MNDA myeloid cell nuclear differentiation antigen 1 1
MIRT029541 CXorf38 chromosome X open reading frame 38 1 1
MIRT029542 RABGGTA Rab geranylgeranyltransferase alpha subunit 1 1
MIRT029543 TXK TXK tyrosine kinase 1 1
MIRT029544 SCN2A sodium voltage-gated channel alpha subunit 2 1 1
MIRT029545 MST4 serine/threonine kinase 26 1 1
MIRT029546 COL4A2 collagen type IV alpha 2 chain 1 1
MIRT029547 IGFBP4 insulin like growth factor binding protein 4 1 1
MIRT029548 FAF1 Fas associated factor 1 1 1
MIRT029549 ASPM abnormal spindle microtubule assembly 1 1
MIRT029550 PTPRO protein tyrosine phosphatase, receptor type O 1 1
MIRT029551 FNDC3B fibronectin type III domain containing 3B 1 1
MIRT029552 PDE11A phosphodiesterase 11A 1 1
MIRT029553 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 1 1
MIRT029554 SORCS3 sortilin related VPS10 domain containing receptor 3 1 1
MIRT029555 PFN2 profilin 2 1 1
MIRT029556 MCC mutated in colorectal cancers 1 1
MIRT029557 HECTD3 HECT domain E3 ubiquitin protein ligase 3 2 2
MIRT029558 MCTP2 multiple C2 and transmembrane domain containing 2 1 1
MIRT029559 MXI1 MAX interactor 1, dimerization protein 1 1
MIRT029560 ICMT isoprenylcysteine carboxyl methyltransferase 1 1
MIRT029561 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT029562 SLC19A2 solute carrier family 19 member 2 1 1
MIRT029563 SACS sacsin molecular chaperone 2 11
MIRT029564 TRIM65 tripartite motif containing 65 1 1
MIRT029565 ADM adrenomedullin 2 10
MIRT029566 SLC6A16 solute carrier family 6 member 16 1 1
MIRT029567 IDI1 isopentenyl-diphosphate delta isomerase 1 1 1
MIRT029568 SPRR1A small proline rich protein 1A 1 1
MIRT029569 GNRHR gonadotropin releasing hormone receptor 1 1
MIRT029570 TRAFD1 TRAF-type zinc finger domain containing 1 1 1
MIRT029571 TIMM10 translocase of inner mitochondrial membrane 10 1 1
MIRT029572 GPR107 G protein-coupled receptor 107 1 1
MIRT029573 PKN1 protein kinase N1 1 1
MIRT029574 ZNF862 zinc finger protein 862 1 1
MIRT029575 COPZ2 coatomer protein complex subunit zeta 2 1 1
MIRT029576 CADM1 cell adhesion molecule 1 1 1
MIRT029577 KLRC4 killer cell lectin like receptor C4 1 1
MIRT029578 CYP2D6 cytochrome P450 family 2 subfamily D member 6 1 1
MIRT029579 TRIM22 tripartite motif containing 22 1 1
MIRT029580 SMG6 SMG6, nonsense mediated mRNA decay factor 1 1
MIRT029581 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT029582 LIF LIF, interleukin 6 family cytokine 1 1
MIRT029583 SH3GL2 SH3 domain containing GRB2 like 2, endophilin A1 1 1
MIRT029584 CIB1 calcium and integrin binding 1 1 1
MIRT029585 PRPS2 phosphoribosyl pyrophosphate synthetase 2 1 1
MIRT029586 MAP1LC3C microtubule associated protein 1 light chain 3 gamma 1 1
MIRT029587 GABRA3 gamma-aminobutyric acid type A receptor alpha3 subunit 1 1
MIRT029588 DOCK10 dedicator of cytokinesis 10 1 1
MIRT029589 PCCA propionyl-CoA carboxylase alpha subunit 1 1
MIRT029590 MAP3K12 mitogen-activated protein kinase kinase kinase 12 1 1
MIRT029591 MLNR motilin receptor 1 1
MIRT029592 TSKU tsukushi, small leucine rich proteoglycan 1 1
MIRT029593 SP4 Sp4 transcription factor 1 1
MIRT029594 PARP6 poly(ADP-ribose) polymerase family member 6 1 1
MIRT029595 KEAP1 kelch like ECH associated protein 1 1 1
MIRT029596 REPIN1 replication initiator 1 1 1
MIRT029597 MT1HL1 metallothionein 1H like 1 1 1
MIRT029598 TGFB1I1 transforming growth factor beta 1 induced transcript 1 1 1
MIRT029599 MRPS34 mitochondrial ribosomal protein S34 1 1
MIRT029600 PCBP3 poly(rC) binding protein 3 1 1
MIRT029601 ZNF195 zinc finger protein 195 1 1
MIRT029602 HIST1H2BI histone cluster 1 H2B family member i 1 1
MIRT029603 MFSD9 major facilitator superfamily domain containing 9 1 1
MIRT029604 CARS2 cysteinyl-tRNA synthetase 2, mitochondrial 1 1
MIRT029605 PNKP polynucleotide kinase 3'-phosphatase 1 1
MIRT029606 DPPA4 developmental pluripotency associated 4 1 1
MIRT029607 MB myoglobin 1 1
MIRT029608 TYMS thymidylate synthetase 1 1
MIRT029609 RAMP2-AS1 RAMP2 antisense RNA 1 1 1
MIRT029610 KDELC1 KDEL motif containing 1 1 1
MIRT029611 IFI44 interferon induced protein 44 1 1
MIRT029612 SND1 staphylococcal nuclease and tudor domain containing 1 1 1
MIRT029613 FBXL6 F-box and leucine rich repeat protein 6 1 1
MIRT029614 FCGR1B Fc fragment of IgG receptor Ib 1 1
MIRT029615 ARNT2 aryl hydrocarbon receptor nuclear translocator 2 1 1
MIRT029616 EVI2A ecotropic viral integration site 2A 1 1
MIRT029617 CASP3 caspase 3 1 1
MIRT029618 BTG2 BTG anti-proliferation factor 2 1 1
MIRT029619 PDLIM1 PDZ and LIM domain 1 1 1
MIRT029620 ATAT1 alpha tubulin acetyltransferase 1 1 1
MIRT029621 RGS3 regulator of G protein signaling 3 1 1
MIRT029622 DGKZ diacylglycerol kinase zeta 1 1
MIRT029623 TAF9 TATA-box binding protein associated factor 9 1 1
MIRT029624 FCN2 ficolin 2 1 1
MIRT029625 FAM105A family with sequence similarity 105 member A 1 1
MIRT029626 FAM3A family with sequence similarity 3 member A 1 1
MIRT029627 ATP6AP2 ATPase H+ transporting accessory protein 2 1 1
MIRT029628 RBMS2 RNA binding motif single stranded interacting protein 2 1 1
MIRT029629 CLINT1 clathrin interactor 1 1 1
MIRT029630 ENDOG endonuclease G 1 1
MIRT029631 CATSPERB cation channel sperm associated auxiliary subunit beta 1 1
MIRT029632 LRFN3 leucine rich repeat and fibronectin type III domain containing 3 1 1
MIRT029633 WFDC6 WAP four-disulfide core domain 6 1 1
MIRT029634 SF3B3 splicing factor 3b subunit 3 1 1
MIRT029635 SHFM1 SEM1, 26S proteasome complex subunit 1 1
MIRT029636 SMC4 structural maintenance of chromosomes 4 1 1
MIRT029637 WDHD1 WD repeat and HMG-box DNA binding protein 1 1 1
MIRT029638 SPAG1 sperm associated antigen 1 1 1
MIRT029639 JOSD1 Josephin domain containing 1 1 1
MIRT029640 RNASEH1 ribonuclease H1 1 1
MIRT029641 JUN Jun proto-oncogene, AP-1 transcription factor subunit 1 1
MIRT029642 HSPA12A heat shock protein family A (Hsp70) member 12A 1 1
MIRT029643 CDH1 cadherin 1 1 1
MIRT029644 USP6 ubiquitin specific peptidase 6 1 1
MIRT029645 CD28 CD28 molecule 1 1
MIRT029646 MME membrane metalloendopeptidase 1 1
MIRT029647 TMX4 thioredoxin related transmembrane protein 4 1 1
MIRT029648 RAB30 RAB30, member RAS oncogene family 1 1
MIRT029649 GPC4 glypican 4 1 1
MIRT029650 NCAM2 neural cell adhesion molecule 2 1 1
MIRT029651 CHORDC1 cysteine and histidine rich domain containing 1 4 3
MIRT029652 FBXO28 F-box protein 28 1 1
MIRT029653 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT029654 TXLNA taxilin alpha 1 1
MIRT029655 SLC5A3 solute carrier family 5 member 3 2 3
MIRT029656 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 8
MIRT029657 SAFB scaffold attachment factor B 1 1
MIRT029658 DRD3 dopamine receptor D3 1 1
MIRT029659 TTI2 TELO2 interacting protein 2 1 1
MIRT029660 CD248 CD248 molecule 1 1
MIRT029661 MEGF8 multiple EGF like domains 8 1 1
MIRT029662 G6PD glucose-6-phosphate dehydrogenase 1 1
MIRT029663 ZNHIT1 zinc finger HIT-type containing 1 1 1
MIRT029664 ARFIP2 ADP ribosylation factor interacting protein 2 1 1
MIRT029665 PCDHA11 protocadherin alpha 11 1 1
MIRT029666 PAQR4 progestin and adipoQ receptor family member 4 1 1
MIRT029667 GCH1 GTP cyclohydrolase 1 1 1
MIRT029668 C1D C1D nuclear receptor corepressor 1 1
MIRT029669 SIX1 SIX homeobox 1 1 1
MIRT029670 RNF187 ring finger protein 187 1 1
MIRT029671 DHODH dihydroorotate dehydrogenase (quinone) 1 1
MIRT029672 NDUFS8 NADH:ubiquinone oxidoreductase core subunit S8 1 1
MIRT029673 EMC7 ER membrane protein complex subunit 7 1 1
MIRT029674 ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif 12 1 1
MIRT029675 RTCB RNA 2',3'-cyclic phosphate and 5'-OH ligase 1 1
MIRT029676 THAP10 THAP domain containing 10 1 1
MIRT029677 KRT18 keratin 18 1 1
MIRT029678 KCTD9 potassium channel tetramerization domain containing 9 1 1
MIRT029679 HSD17B11 hydroxysteroid 17-beta dehydrogenase 11 1 1
MIRT029680 PRY2 PTPN13-like, Y-linked 2 1 1
MIRT029681 UBB ubiquitin B 1 1
MIRT029682 SEC61A2 Sec61 translocon alpha 2 subunit 1 1
MIRT029683 MRPL18 mitochondrial ribosomal protein L18 1 1
MIRT029684 FAHD2B fumarylacetoacetate hydrolase domain containing 2B 1 1
MIRT029685 ACBD3 acyl-CoA binding domain containing 3 1 1
MIRT029686 S100A2 S100 calcium binding protein A2 1 1
MIRT029687 TOP2B DNA topoisomerase II beta 1 1
MIRT029688 SSX7 SSX family member 7 1 1
MIRT029689 EGR3 early growth response 3 1 1
MIRT029690 PANK3 pantothenate kinase 3 1 1
MIRT029691 ZNF548 zinc finger protein 548 1 1
MIRT029692 SPECC1L sperm antigen with calponin homology and coiled-coil domains 1 like 1 1
MIRT029693 MED9 mediator complex subunit 9 1 1
MIRT029694 POTEJ POTE ankyrin domain family member J 1 1
MIRT029695 SCAND2P SCAN domain containing 2 pseudogene 1 1
MIRT029696 CACNA1S calcium voltage-gated channel subunit alpha1 S 1 1
MIRT029697 IL22RA1 interleukin 22 receptor subunit alpha 1 1 1
MIRT029698 CARD14 caspase recruitment domain family member 14 1 1
MIRT029699 CTSL2 cathepsin V 1 1
MIRT029700 HGD homogentisate 1,2-dioxygenase 1 1
MIRT029701 SLC35F5 solute carrier family 35 member F5 1 1
MIRT029702 WDR25 WD repeat domain 25 1 1
MIRT029703 IFIH1 interferon induced with helicase C domain 1 1 1
MIRT029704 HDAC5 histone deacetylase 5 1 1
MIRT029705 AGMAT agmatinase 1 1
MIRT029706 RAPGEF4 Rap guanine nucleotide exchange factor 4 1 1
MIRT029707 TEX2 testis expressed 2 1 1
MIRT029708 ABCA6 ATP binding cassette subfamily A member 6 1 1
MIRT029709 STUB1 STIP1 homology and U-box containing protein 1 1 1
MIRT029710 SRP9P1 signal recognition particle 9 pseudogene 1 1 1
MIRT029711 LCAT lecithin-cholesterol acyltransferase 1 1
MIRT029712 TCN1 transcobalamin 1 1 1
MIRT029713 C1QTNF9B-AS1 Pro-X-Gly collagen triple helix like repeat containing 1 1
MIRT029714 CXCL6 C-X-C motif chemokine ligand 6 1 1
MIRT029715 GHSR growth hormone secretagogue receptor 1 1
MIRT029716 ARL8B ADP ribosylation factor like GTPase 8B 1 1
MIRT029717 RRS1 ribosome biogenesis regulator homolog 1 1
MIRT029718 OXA1L OXA1L, mitochondrial inner membrane protein 1 1
MIRT029719 C1orf216 chromosome 1 open reading frame 216 1 1
MIRT029720 ZNF584 zinc finger protein 584 1 1
MIRT029721 ANXA5 annexin A5 1 1
MIRT029722 MARC2 mitochondrial amidoxime reducing component 2 1 1
MIRT029723 CSGALNACT2 chondroitin sulfate N-acetylgalactosaminyltransferase 2 1 1
MIRT029724 LSAMP limbic system-associated membrane protein 1 1
MIRT029725 ANKRD36BP1 ankyrin repeat domain 36B pseudogene 1 1 1
MIRT029726 GREB1L growth regulation by estrogen in breast cancer 1 like 1 1
MIRT029727 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 1 1
MIRT029728 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 1 1
MIRT029729 ZNF136 zinc finger protein 136 1 1
MIRT029730 ELF4 E74 like ETS transcription factor 4 1 1
MIRT029731 KIF21B kinesin family member 21B 1 1
MIRT029732 CTNS cystinosin, lysosomal cystine transporter 3 3
MIRT029733 STARD5 StAR related lipid transfer domain containing 5 1 1
MIRT029734 NKX2-2 NK2 homeobox 2 1 1
MIRT029735 SMYD2 SET and MYND domain containing 2 1 1
MIRT029736 TRANK1 tetratricopeptide repeat and ankyrin repeat containing 1 1 1
MIRT029737 MARCH1 membrane associated ring-CH-type finger 1 1 1
MIRT029738 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT029739 KIAA0947 interactor of little elongation complex ELL subunit 1 1 1
MIRT029740 MFHAS1 malignant fibrous histiocytoma amplified sequence 1 1 1
MIRT029741 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 1 1
MIRT029742 GSR glutathione-disulfide reductase 1 1
MIRT029743 ZNF207 zinc finger protein 207 1 1
MIRT029744 HADH hydroxyacyl-CoA dehydrogenase 1 1
MIRT029745 FDFT1 farnesyl-diphosphate farnesyltransferase 1 1 1
MIRT029746 ANAPC1 anaphase promoting complex subunit 1 1 1
MIRT029747 PMP22 peripheral myelin protein 22 1 1
MIRT029748 BNC1 basonuclin 1 1 1
MIRT029749 SNAP91 synaptosome associated protein 91 1 1
MIRT029750 EED embryonic ectoderm development 1 1
MIRT029751 CAV2 caveolin 2 1 1
MIRT029752 GALK1 galactokinase 1 1 1
MIRT029753 CFI complement factor I 1 1
MIRT029754 HSD3B1 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 1 1
MIRT029755 APOO apolipoprotein O 1 1
MIRT029756 COQ9 coenzyme Q9 1 1
MIRT029757 SLC16A4 solute carrier family 16 member 4 1 1
MIRT029758 POU4F3 POU class 4 homeobox 3 1 1
MIRT029759 TSFM Ts translation elongation factor, mitochondrial 1 1
MIRT029760 ACAA2 acetyl-CoA acyltransferase 2 1 1
MIRT029761 GRTP1 growth hormone regulated TBC protein 1 1 1
MIRT029762 RPGRIP1 RPGR interacting protein 1 1 1
MIRT029763 GATA2 GATA binding protein 2 1 1
MIRT029764 PAQR6 progestin and adipoQ receptor family member 6 1 1
MIRT029765 NAA40 N(alpha)-acetyltransferase 40, NatD catalytic subunit 1 1
MIRT029766 RAB3A RAB3A, member RAS oncogene family 1 1
MIRT029767 C1orf63 arginine and serine rich protein 1 1 1
MIRT029768 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 1 1
MIRT029769 OXSR1 oxidative stress responsive 1 1 1
MIRT029770 METRN meteorin, glial cell differentiation regulator 1 1
MIRT029771 FSTL1 follistatin like 1 1 1
MIRT029772 HAGH hydroxyacylglutathione hydrolase 1 1
MIRT029773 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 1 1
MIRT029774 SERPINI2 serpin family I member 2 1 1
MIRT029775 WBP5 transcription elongation factor A like 9 1 1
MIRT029776 ACTR5 ARP5 actin related protein 5 homolog 1 1
MIRT029777 CLSTN2 calsyntenin 2 1 1
MIRT029778 ANXA8 annexin A8 1 1
MIRT029779 IL1R2 interleukin 1 receptor type 2 1 1
MIRT029780 FASLG Fas ligand 1 1
MIRT029781 ASF1B anti-silencing function 1B histone chaperone 1 1
MIRT029782 TPM3 tropomyosin 3 1 1
MIRT029783 CEND1 cell cycle exit and neuronal differentiation 1 1 1
MIRT029784 STXBP3 syntaxin binding protein 3 1 1
MIRT029785 TRAM2 translocation associated membrane protein 2 1 1
MIRT029786 ETV4 ETS variant 4 1 1
MIRT029787 IL7R interleukin 7 receptor 1 1
MIRT029788 PNOC prepronociceptin 1 1
MIRT029789 RAD51D RAD51 paralog D 1 1
MIRT029790 CSPG5 chondroitin sulfate proteoglycan 5 1 1
MIRT029791 DDX25 DEAD-box helicase 25 1 1
MIRT029792 ADRA2A adrenoceptor alpha 2A 1 1
MIRT029793 IKZF1 IKAROS family zinc finger 1 1 1
MIRT029794 GPR17 G protein-coupled receptor 17 1 1
MIRT029795 KIAA0101 PCNA clamp associated factor 1 1
MIRT029796 FKBP9 FK506 binding protein 9 1 1
MIRT029797 BMP8B bone morphogenetic protein 8b 1 1
MIRT029798 F3 coagulation factor III, tissue factor 1 1
MIRT029799 TRMT2A tRNA methyltransferase 2 homolog A 1 1
MIRT029800 IL36RN interleukin 36 receptor antagonist 1 1
MIRT029801 TIPARP TCDD inducible poly(ADP-ribose) polymerase 1 1
MIRT029802 PODNL1 podocan like 1 1 1
MIRT029803 SLC3A2 solute carrier family 3 member 2 1 1
MIRT029804 IER5 immediate early response 5 1 1
MIRT029805 KRTAP5-7 keratin associated protein 5-7 1 1
MIRT029806 ZBTB20 zinc finger and BTB domain containing 20 1 1
MIRT029807 AAMDC adipogenesis associated Mth938 domain containing 1 1
MIRT029808 MBIP MAP3K12 binding inhibitory protein 1 1 1
MIRT029809 GPR183 G protein-coupled receptor 183 1 1
MIRT029810 BRDT bromodomain testis associated 1 1
MIRT029811 RPS6KB2 ribosomal protein S6 kinase B2 1 1
MIRT029812 RPLP1 ribosomal protein lateral stalk subunit P1 1 1
MIRT029813 EIF1AX eukaryotic translation initiation factor 1A, X-linked 1 1
MIRT029814 BCHE butyrylcholinesterase 1 1
MIRT029815 CNTRL centriolin 1 1
MIRT029816 RRAS2 RAS related 2 1 1
MIRT029817 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 1 1
MIRT029818 MAT2B methionine adenosyltransferase 2B 1 1
MIRT029819 DDX60 DExD/H-box helicase 60 1 1
MIRT029820 SMPDL3A sphingomyelin phosphodiesterase acid like 3A 1 1
MIRT029821 PACRG parkin coregulated 1 1
MIRT029822 ZNF85 zinc finger protein 85 1 1
MIRT029823 TBCCD1 TBCC domain containing 1 1 1
MIRT029824 CHM CHM, Rab escort protein 1 1 1
MIRT029825 C7orf10 succinyl-CoA:glutarate-CoA transferase 1 1
MIRT029826 CH25H cholesterol 25-hydroxylase 1 1
MIRT029827 SUPT3H SPT3 homolog, SAGA and STAGA complex component 1 1
MIRT029828 RFX7 regulatory factor X7 1 1
MIRT029829 SEPT7 septin 7 1 1
MIRT029830 ALG9 ALG9, alpha-1,2-mannosyltransferase 1 1
MIRT029831 RCN2 reticulocalbin 2 1 1
MIRT029832 PLOD2 procollagen-lysine,2-oxoglutarate 5-dioxygenase 2 1 1
MIRT029833 DDX3X DEAD-box helicase 3, X-linked 2 3
MIRT029834 C18orf25 chromosome 18 open reading frame 25 1 1
MIRT029835 CCR6 C-C motif chemokine receptor 6 1 1
MIRT029836 UBL3 ubiquitin like 3 1 1
MIRT029837 CASD1 CAS1 domain containing 1 1 1
MIRT029838 GALNT11 polypeptide N-acetylgalactosaminyltransferase 11 1 1
MIRT029839 FAM127B retrotransposon Gag like 8A 1 1
MIRT029840 STOML2 stomatin like 2 1 1
MIRT029841 EBNA1BP2 EBNA1 binding protein 2 1 1
MIRT029842 POM121L1P POM121 transmembrane nucleoporin like 1, pseudogene 1 1
MIRT029843 POFUT2 protein O-fucosyltransferase 2 1 1
MIRT029844 GRHL2 grainyhead like transcription factor 2 1 1
MIRT029845 DHX30 DExH-box helicase 30 1 1
MIRT029846 TPRKB TP53RK binding protein 1 1
MIRT029847 RASIP1 Ras interacting protein 1 1 1
MIRT029848 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 1 1
MIRT029849 LMNB1 lamin B1 1 1
MIRT029850 DSC1 desmocollin 1 1 1
MIRT029851 C9orf16 chromosome 9 open reading frame 16 1 1
MIRT029852 MEF2D myocyte enhancer factor 2D 1 1
MIRT029853 CYTIP cytohesin 1 interacting protein 1 1
MIRT029854 CNTFR ciliary neurotrophic factor receptor 1 1
MIRT029855 TMPRSS11E transmembrane protease, serine 11E 1 1
MIRT029856 RXFP3 relaxin/insulin like family peptide receptor 3 1 1
MIRT029857 POTEG POTE ankyrin domain family member G 1 1
MIRT029858 CTSD cathepsin D 1 1
MIRT029859 CNPY3 canopy FGF signaling regulator 3 1 1
MIRT029860 TNFSF15 TNF superfamily member 15 1 1
MIRT029861 DPM1 dolichyl-phosphate mannosyltransferase subunit 1, catalytic 1 1
MIRT029862 KLHL21 kelch like family member 21 1 1
MIRT029863 TNFAIP3 TNF alpha induced protein 3 1 1
MIRT029864 FBLN5 fibulin 5 1 1
MIRT029865 DEFB4A defensin beta 4A 1 1
MIRT029866 SETD5 SET domain containing 5 1 1
MIRT029867 EPPIN epididymal peptidase inhibitor 1 1
MIRT029868 LAMP3 lysosomal associated membrane protein 3 1 1
MIRT029869 CEP85 centrosomal protein 85 1 1
MIRT029870 TEAD3 TEA domain transcription factor 3 1 1
MIRT029871 CTDNEP1 CTD nuclear envelope phosphatase 1 1 1
MIRT029872 TRIOBP TRIO and F-actin binding protein 1 1
MIRT029873 CYP11B2 cytochrome P450 family 11 subfamily B member 2 1 1
MIRT029874 DCUN1D2 defective in cullin neddylation 1 domain containing 2 1 1
MIRT029875 DCTPP1 dCTP pyrophosphatase 1 1 1
MIRT029876 ZNF480 zinc finger protein 480 1 1
MIRT029877 NR2E1 nuclear receptor subfamily 2 group E member 1 1 1
MIRT029878 MTHFS methenyltetrahydrofolate synthetase 1 1
MIRT029879 TMEM41B transmembrane protein 41B 1 1
MIRT029880 GADD45A growth arrest and DNA damage inducible alpha 1 1
MIRT029881 GGH gamma-glutamyl hydrolase 1 1
MIRT029882 RAB23 RAB23, member RAS oncogene family 1 1
MIRT029883 SERPINH1 serpin family H member 1 1 1
MIRT029884 IFITM3 interferon induced transmembrane protein 3 1 1
MIRT029885 GABARAP GABA type A receptor-associated protein 1 1
MIRT029886 SLC25A28 solute carrier family 25 member 28 1 1
MIRT029887 TSPAN12 tetraspanin 12 1 1
MIRT029888 IRGC immunity related GTPase cinema 1 1
MIRT029889 TLX1 T-cell leukemia homeobox 1 1 1
MIRT029890 CHPF chondroitin polymerizing factor 1 1
MIRT029891 SFMBT1 Scm like with four mbt domains 1 1 1
MIRT029892 EFNA2 ephrin A2 1 1
MIRT029893 TRIM6 tripartite motif containing 6 1 1
MIRT029894 EMC3 ER membrane protein complex subunit 3 1 1
MIRT029895 MTCH2 mitochondrial carrier 2 1 1
MIRT029896 ACTR8 ARP8 actin related protein 8 homolog 1 1
MIRT029897 SNAI1 snail family transcriptional repressor 1 1 1
MIRT029898 FKRP fukutin related protein 1 1
MIRT029899 EXT2 exostosin glycosyltransferase 2 1 1
MIRT029900 ZKSCAN7 zinc finger with KRAB and SCAN domains 7 1 1
MIRT029901 STAG1 stromal antigen 1 1 1
MIRT029902 CNIH4 cornichon family AMPA receptor auxiliary protein 4 1 1
MIRT029903 MRPS16 mitochondrial ribosomal protein S16 1 1
MIRT029904 CENPQ centromere protein Q 1 1
MIRT029905 DTNB dystrobrevin beta 1 1
MIRT029906 CCSER2 coiled-coil serine rich protein 2 1 1
MIRT029907 WRB tryptophan rich basic protein 1 1
MIRT029908 SLC17A6 solute carrier family 17 member 6 1 1
MIRT029909 PER3 period circadian clock 3 1 1
MIRT029910 CCDC144A coiled-coil domain containing 144A 1 1
MIRT029911 DPY19L1 dpy-19 like C-mannosyltransferase 1 1 1
MIRT029912 NTNG1 netrin G1 1 1
MIRT029913 MTCP1 mature T-cell proliferation 1 1 1
MIRT029914 JAM2 junctional adhesion molecule 2 1 1
MIRT029915 PRR5L proline rich 5 like 1 1
MIRT029916 TRPC4 transient receptor potential cation channel subfamily C member 4 1 1
MIRT029917 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT029918 SLC7A11 solute carrier family 7 member 11 1 1
MIRT029919 GSPT2 G1 to S phase transition 2 1 1
MIRT029920 UNC13A unc-13 homolog A 1 1
MIRT029921 NOX3 NADPH oxidase 3 1 1
MIRT029922 TASP1 taspase 1 1 1
MIRT029923 GLI2 GLI family zinc finger 2 1 1
MIRT029924 PSMB7 proteasome subunit beta 7 1 1
MIRT029925 MAPKAP1 mitogen-activated protein kinase associated protein 1 1 1
MIRT029926 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 1 1
MIRT029927 ZNF551 zinc finger protein 551 1 1
MIRT029928 GDF11 growth differentiation factor 11 1 1
MIRT029929 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 1 1
MIRT029930 TCEB3B elongin A2 1 1
MIRT029931 FGGY FGGY carbohydrate kinase domain containing 1 1
MIRT029932 OAZ2 ornithine decarboxylase antizyme 2 1 1
MIRT029933 NRBP1 nuclear receptor binding protein 1 1 1
MIRT029934 KCTD14 potassium channel tetramerization domain containing 14 1 1
MIRT029935 GKN1 gastrokine 1 1 1
MIRT029936 TULP2 tubby like protein 2 1 1
MIRT029937 LRRC8D leucine rich repeat containing 8 VRAC subunit D 1 1
MIRT029938 ZNF839 zinc finger protein 839 1 1
MIRT029939 TRPM1 transient receptor potential cation channel subfamily M member 1 1 1
MIRT029940 RELB RELB proto-oncogene, NF-kB subunit 1 1
MIRT029941 NOP10 NOP10 ribonucleoprotein 1 1
MIRT029942 CASQ1 calsequestrin 1 1 1
MIRT029943 COLEC12 collectin subfamily member 12 1 1
MIRT029944 SCO2 SCO2, cytochrome c oxidase assembly protein 1 1
MIRT029945 FICD FIC domain containing 1 1
MIRT029946 GREM2 gremlin 2, DAN family BMP antagonist 1 1
MIRT029947 CYP27B1 cytochrome P450 family 27 subfamily B member 1 1 1
MIRT029948 IBSP integrin binding sialoprotein 1 1
MIRT029949 DERA deoxyribose-phosphate aldolase 1 1
MIRT029950 SULT1B1 sulfotransferase family 1B member 1 1 1
MIRT029951 PSME1 proteasome activator subunit 1 1 1
MIRT029952 PRYP3 PTPN13-like, Y-linked pseudogene 3 1 1
MIRT029953 ZWINT ZW10 interacting kinetochore protein 1 1
MIRT029954 GNB3 G protein subunit beta 3 1 1
MIRT029955 PARK7 Parkinsonism associated deglycase 1 1
MIRT029956 PMF1 polyamine modulated factor 1 1 1
MIRT029957 ANKRD36B ankyrin repeat domain 36B 1 1
MIRT029958 GAL3ST1 galactose-3-O-sulfotransferase 1 1 1
MIRT029959 B3GALT1 beta-1,3-galactosyltransferase 1 1 1
MIRT029960 FES FES proto-oncogene, tyrosine kinase 1 1
MIRT029961 NME5 NME/NM23 family member 5 1 1
MIRT029962 GPR39 G protein-coupled receptor 39 1 1
MIRT029963 TRIM17 tripartite motif containing 17 1 1
MIRT029964 CCNB1IP1 cyclin B1 interacting protein 1 1 1
MIRT029965 TOR4A torsin family 4 member A 1 1
MIRT029966 MAP4K3 mitogen-activated protein kinase kinase kinase kinase 3 1 1
MIRT029967 GMNN geminin, DNA replication inhibitor 1 1
MIRT029968 ECH1 enoyl-CoA hydratase 1 1 1
MIRT029969 TSGA10 testis specific 10 1 1
MIRT029970 UXT ubiquitously expressed prefoldin like chaperone 1 1
MIRT029971 VTN vitronectin 1 1
MIRT029972 ARID3B AT-rich interaction domain 3B 1 1
MIRT029973 TNFRSF11A TNF receptor superfamily member 11a 1 1
MIRT029974 HIST2H4B histone cluster 2 H4 family member b 1 1
MIRT029975 KCNF1 potassium voltage-gated channel modifier subfamily F member 1 1 1
MIRT029976 NDUFB1 NADH:ubiquinone oxidoreductase subunit B1 1 1
MIRT029977 OSTF1 osteoclast stimulating factor 1 1 1
MIRT029978 DDB2 damage specific DNA binding protein 2 1 1
MIRT029979 KDM5D lysine demethylase 5D 1 1
MIRT029980 FOXD2 forkhead box D2 1 1
MIRT029981 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT029982 HSF1 heat shock transcription factor 1 1 1
MIRT029983 SLC17A5 solute carrier family 17 member 5 1 1
MIRT029984 GPATCH2 G-patch domain containing 2 1 1
MIRT029985 AFAP1 actin filament associated protein 1 1 1
MIRT029986 TMED5 transmembrane p24 trafficking protein 5 1 1
MIRT029987 URB2 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) 1 1
MIRT029988 PAPPA pappalysin 1 1 1
MIRT029989 EXOC6B exocyst complex component 6B 1 1
MIRT029990 NET1 neuroepithelial cell transforming 1 1 1
MIRT029991 ITGA3 integrin subunit alpha 3 1 1
MIRT029992 TMEM62 transmembrane protein 62 1 1
MIRT029993 RNF111 ring finger protein 111 1 1
MIRT029994 HPS4 HPS4, biogenesis of lysosomal organelles complex 3 subunit 2 1 1
MIRT029995 PCSK1 proprotein convertase subtilisin/kexin type 1 1 1
MIRT029996 FAM198B family with sequence similarity 198 member B 1 1
MIRT029997 PLGRKT plasminogen receptor with a C-terminal lysine 1 1
MIRT029998 RPS6KC1 ribosomal protein S6 kinase C1 1 1
MIRT029999 NPTXR neuronal pentraxin receptor 1 1
MIRT030000 CCDC41 centrosomal protein 83 1 1
MIRT030001 TCF12 transcription factor 12 1 1
MIRT030002 TRPS1 transcriptional repressor GATA binding 1 1 1
MIRT030003 CCDC28A coiled-coil domain containing 28A 1 1
MIRT030004 NABP1 nucleic acid binding protein 1 3 8
MIRT030005 GFOD1 glucose-fructose oxidoreductase domain containing 1 1 1
MIRT030006 PPTC7 PTC7 protein phosphatase homolog 1 1
MIRT030007 NIP7 NIP7, nucleolar pre-rRNA processing protein 1 1
MIRT030008 DDX6 DEAD-box helicase 6 1 1
MIRT030009 IL12A interleukin 12A 1 1
MIRT030010 MYOG myogenin 1 1
MIRT030011 HEXB hexosaminidase subunit beta 1 1
MIRT030012 BTN3A3 butyrophilin subfamily 3 member A3 1 1
MIRT030013 F13B coagulation factor XIII B chain 1 1
MIRT030014 RORB RAR related orphan receptor B 1 1
MIRT030015 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma 1 1
MIRT030016 TMPRSS6 transmembrane protease, serine 6 1 1
MIRT030017 MORC4 MORC family CW-type zinc finger 4 1 1
MIRT030018 RECQL RecQ like helicase 1 1
MIRT030019 PPIC peptidylprolyl isomerase C 1 1
MIRT030020 TINF2 TERF1 interacting nuclear factor 2 1 1
MIRT030021 OR2W1 olfactory receptor family 2 subfamily W member 1 1 1
MIRT030022 NKX2-5 NK2 homeobox 5 1 1
MIRT030023 INPP5J inositol polyphosphate-5-phosphatase J 1 1
MIRT030024 CAV1 caveolin 1 1 1
MIRT030025 DUSP14 dual specificity phosphatase 14 1 1
MIRT030026 GABRG3 gamma-aminobutyric acid type A receptor gamma3 subunit 1 1
MIRT030027 TMCC2 transmembrane and coiled-coil domain family 2 1 1
MIRT030028 IGFLR1 IGF like family receptor 1 1 1
MIRT030029 SLCO1B1 solute carrier organic anion transporter family member 1B1 1 1
MIRT030030 LINC00483 long intergenic non-protein coding RNA 483 1 1
MIRT030031 DPYSL3 dihydropyrimidinase like 3 1 1
MIRT030032 FTH1 ferritin heavy chain 1 1 1
MIRT030033 TFEB transcription factor EB 1 1
MIRT030034 TSTA3 tissue specific transplantation antigen P35B 1 1
MIRT030035 IFNGR2 interferon gamma receptor 2 1 1
MIRT030036 HSD17B14 hydroxysteroid 17-beta dehydrogenase 14 1 1
MIRT030037 MATN3 matrilin 3 1 1
MIRT030038 TPO thyroid peroxidase 1 1
MIRT030039 LSM1 LSM1 homolog, mRNA degradation associated 1 1
MIRT030040 PHGDH phosphoglycerate dehydrogenase 1 1
MIRT030041 DPF3 double PHD fingers 3 1 1
MIRT030042 USP20 ubiquitin specific peptidase 20 1 1
MIRT030043 COL4A5 collagen type IV alpha 5 chain 1 1
MIRT030044 SKIV2L2 Ski2 like RNA helicase 2 1 1
MIRT030045 ODF2 outer dense fiber of sperm tails 2 1 1
MIRT030046 CYP4F8 cytochrome P450 family 4 subfamily F member 8 1 1
MIRT030047 ABCG4 ATP binding cassette subfamily G member 4 1 1
MIRT030048 P2RX2 purinergic receptor P2X 2 1 1
MIRT030049 LYZ lysozyme 1 1
MIRT030050 RAB40B RAB40B, member RAS oncogene family 1 1
MIRT030051 STX1A syntaxin 1A 1 1
MIRT030052 HTT huntingtin 1 1
MIRT030053 APOF apolipoprotein F 1 1
MIRT030054 SERPINB2 serpin family B member 2 1 1
MIRT030055 HSD11B1 hydroxysteroid 11-beta dehydrogenase 1 1 1
MIRT030056 PRR7 proline rich 7, synaptic 1 1
MIRT030057 SLC28A1 solute carrier family 28 member 1 1 1
MIRT030058 C12orf5 TP53 induced glycolysis regulatory phosphatase 1 1
MIRT030059 NDUFB11 NADH:ubiquinone oxidoreductase subunit B11 1 1
MIRT030060 COASY Coenzyme A synthase 1 1
MIRT030061 HIST1H2BC histone cluster 1 H2B family member c 1 1
MIRT030062 PQBP1 polyglutamine binding protein 1 1 1
MIRT030063 CDK2 cyclin dependent kinase 2 1 1
MIRT030064 GNA13 G protein subunit alpha 13 1 1
MIRT030065 ANXA1 annexin A1 1 1
MIRT030066 SECISBP2 SECIS binding protein 2 1 1
MIRT030067 GALR3 galanin receptor 3 1 1
MIRT030068 MRM1 mitochondrial rRNA methyltransferase 1 1 1
MIRT030069 TSPAN3 tetraspanin 3 1 1
MIRT030070 FOXM1 forkhead box M1 1 1
MIRT030071 KIAA1045 PHD finger protein 24 1 1
MIRT030072 DEC1 deleted in esophageal cancer 1 1 1
MIRT030073 TNS4 tensin 4 1 1
MIRT030074 DUSP12 dual specificity phosphatase 12 1 1
MIRT030075 GALT galactose-1-phosphate uridylyltransferase 1 1
MIRT030076 FKBP14 FK506 binding protein 14 1 1
MIRT030077 MPDZ multiple PDZ domain crumbs cell polarity complex component 1 1
MIRT030078 C11orf30 EMSY, BRCA2 interacting transcriptional repressor 1 1
MIRT030079 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT030080 LRRC20 leucine rich repeat containing 20 1 1
MIRT030081 XK X-linked Kx blood group 1 1
MIRT030082 CYTH2 cytohesin 2 1 1
MIRT030083 SLAMF1 signaling lymphocytic activation molecule family member 1 1 1
MIRT030084 TMEM248 transmembrane protein 248 1 1
MIRT030085 MREG melanoregulin 1 1
MIRT030086 FKTN fukutin 3 3
MIRT030087 SOWAHC sosondowah ankyrin repeat domain family member C 1 1
MIRT030088 FGL2 fibrinogen like 2 1 1
MIRT030089 ASPN asporin 1 1
MIRT030090 MCL1 MCL1, BCL2 family apoptosis regulator 1 1
MIRT030091 CACNB4 calcium voltage-gated channel auxiliary subunit beta 4 1 1
MIRT030092 HOXA9 homeobox A9 1 1
MIRT030093 REEP3 receptor accessory protein 3 1 1
MIRT030094 CA2 carbonic anhydrase 2 2 2
MIRT030095 UNC93B1 unc-93 homolog B1, TLR signaling regulator 1 1
MIRT030096 CEMP1 cementum protein 1 1 1
MIRT030097 SDHB succinate dehydrogenase complex iron sulfur subunit B 1 1
MIRT030098 PDK4 pyruvate dehydrogenase kinase 4 1 1
MIRT030099 FGFR3 fibroblast growth factor receptor 3 1 1
MIRT030100 LPHN2 adhesion G protein-coupled receptor L2 1 1
MIRT030101 IAPP islet amyloid polypeptide 1 1
MIRT030102 POU4F1 POU class 4 homeobox 1 1 1
MIRT030103 S100A7 S100 calcium binding protein A7 1 1
MIRT030104 CRTAM cytotoxic and regulatory T-cell molecule 1 1
MIRT030105 ATXN2L ataxin 2 like 1 1
MIRT030106 AK4 adenylate kinase 4 1 1
MIRT030107 TAGLN3 transgelin 3 1 1
MIRT030108 CIAO1 cytosolic iron-sulfur assembly component 1 1 1
MIRT030109 CD36 CD36 molecule 1 1
MIRT030110 SLC2A6 solute carrier family 2 member 6 1 1
MIRT030111 IL13RA2 interleukin 13 receptor subunit alpha 2 1 1
MIRT030112 UFC1 ubiquitin-fold modifier conjugating enzyme 1 1 1
MIRT030113 CHST15 carbohydrate sulfotransferase 15 1 1
MIRT030114 BATF3 basic leucine zipper ATF-like transcription factor 3 1 1
MIRT030115 CYR61 cysteine rich angiogenic inducer 61 1 1
MIRT030116 KIF1B kinesin family member 1B 1 1
MIRT030117 ZNF468 zinc finger protein 468 1 1
MIRT030118 CCNL2 cyclin L2 1 1
MIRT030119 AMDHD2 amidohydrolase domain containing 2 1 1
MIRT030120 DEFB4B defensin beta 4B 1 1
MIRT030121 CCT7 chaperonin containing TCP1 subunit 7 1 1
MIRT030122 RMI1 RecQ mediated genome instability 1 1 1
MIRT030123 SPC25 SPC25, NDC80 kinetochore complex component 1 1
MIRT030124 SOX3 SRY-box 3 1 1
MIRT030125 ZNHIT2 zinc finger HIT-type containing 2 1 1
MIRT030126 RORC RAR related orphan receptor C 1 1
MIRT030127 NXPH4 neurexophilin 4 1 1
MIRT030128 SCARA3 scavenger receptor class A member 3 1 1
MIRT030129 LPCAT1 lysophosphatidylcholine acyltransferase 1 1 1
MIRT030130 RUVBL1 RuvB like AAA ATPase 1 1 1
MIRT030131 AGTR1 angiotensin II receptor type 1 1 1
MIRT030132 TBC1D2B TBC1 domain family member 2B 1 1
MIRT030133 CST2 cystatin SA 1 1
MIRT030134 TLR1 toll like receptor 1 1 1
MIRT030135 TMEM30B transmembrane protein 30B 1 1
MIRT030136 FAM193A family with sequence similarity 193 member A 1 1
MIRT030137 GALR2 galanin receptor 2 1 1
MIRT030138 CCDC53 WASH complex subunit 3 1 1
MIRT030139 NKX3-2 NK3 homeobox 2 1 1
MIRT030140 ISOC2 isochorismatase domain containing 2 1 1
MIRT030141 WARS tryptophanyl-tRNA synthetase 1 1
MIRT030142 PPAT phosphoribosyl pyrophosphate amidotransferase 1 1
MIRT030143 HOXB1 homeobox B1 1 1
MIRT030144 SV2B synaptic vesicle glycoprotein 2B 1 1
MIRT030145 BRD8 bromodomain containing 8 1 1
MIRT030146 KREMEN2 kringle containing transmembrane protein 2 1 1
MIRT030147 KCNA5 potassium voltage-gated channel subfamily A member 5 1 1
MIRT030148 ARMC8 armadillo repeat containing 8 1 1
MIRT030149 EPHX1 epoxide hydrolase 1 1 1
MIRT030150 TSHB thyroid stimulating hormone beta 1 1
MIRT030151 EIF4A3 eukaryotic translation initiation factor 4A3 1 1
MIRT030152 GRB14 growth factor receptor bound protein 14 1 1
MIRT030153 CDC25B cell division cycle 25B 1 1
MIRT030154 ANXA3 annexin A3 1 1
MIRT030155 GPR1 G protein-coupled receptor 1 1 1
MIRT030156 BACE1 beta-secretase 1 1 1
MIRT030157 ACE2 angiotensin I converting enzyme 2 1 1
MIRT030158 VANGL1 VANGL planar cell polarity protein 1 1 1
MIRT030159 SSH1 slingshot protein phosphatase 1 1 1
MIRT030160 CRIM1 cysteine rich transmembrane BMP regulator 1 1 1
MIRT030161 SCP2 sterol carrier protein 2 1 1
MIRT030162 CCDC170 coiled-coil domain containing 170 1 1
MIRT030163 YOD1 YOD1 deubiquitinase 1 1
MIRT030164 HSPA4 heat shock protein family A (Hsp70) member 4 1 1
MIRT030165 GUSB glucuronidase beta 1 1
MIRT030166 DAB2 DAB2, clathrin adaptor protein 1 1
MIRT030167 NUP153 nucleoporin 153 1 1
MIRT030168 SLC26A4 solute carrier family 26 member 4 1 1
MIRT030169 MTERFD2 mitochondrial transcription termination factor 4 1 1
MIRT030170 TDRD7 tudor domain containing 7 1 1
MIRT030171 TAF9B TATA-box binding protein associated factor 9b 1 1
MIRT030172 MSMO1 methylsterol monooxygenase 1 1 1
MIRT030173 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 1 1
MIRT030174 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT030175 FAM107B family with sequence similarity 107 member B 1 1
MIRT030176 CRYZ crystallin zeta 1 1
MIRT030177 CNOT4 CCR4-NOT transcription complex subunit 4 1 1
MIRT030178 HLA-DQB2 major histocompatibility complex, class II, DQ beta 2 1 1
MIRT030179 CRYAA crystallin alpha A 1 1
MIRT030180 UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus 1 1
MIRT030181 C3 complement C3 1 1
MIRT030182 COX8A cytochrome c oxidase subunit 8A 1 1
MIRT030183 SLC6A14 solute carrier family 6 member 14 1 1
MIRT030184 PCOLCE2 procollagen C-endopeptidase enhancer 2 1 1
MIRT030185 OAZ1 ornithine decarboxylase antizyme 1 1 1
MIRT030186 NUDC nuclear distribution C, dynein complex regulator 1 1
MIRT030187 ERI2 ERI1 exoribonuclease family member 2 1 1
MIRT030188 SLC10A3 solute carrier family 10 member 3 1 1
MIRT030189 TOM1L2 target of myb1 like 2 membrane trafficking protein 1 1
MIRT030190 C5AR1 complement C5a receptor 1 1 1
MIRT030191 DHRS11 dehydrogenase/reductase 11 1 1
MIRT030192 DCTD dCMP deaminase 1 1
MIRT030193 RNF2 ring finger protein 2 1 1
MIRT030194 RPL6 ribosomal protein L6 1 1
MIRT030195 TENC1 tensin 2 1 1
MIRT030196 FIGF vascular endothelial growth factor D 1 1
MIRT030197 RPN1 ribophorin I 1 1
MIRT030198 PSMD5 proteasome 26S subunit, non-ATPase 5 1 1
MIRT030199 NUCB2 nucleobindin 2 1 1
MIRT030200 RNASE6 ribonuclease A family member k6 1 1
MIRT030201 TAS2R9 taste 2 receptor member 9 1 1
MIRT030202 CSN3 casein kappa 1 1
MIRT030203 MAGIX MAGI family member, X-linked 1 1
MIRT030204 ITGAX integrin subunit alpha X 1 1
MIRT030205 TRAPPC3 trafficking protein particle complex 3 1 1
MIRT030206 GPR22 G protein-coupled receptor 22 1 1
MIRT030207 RNF38 ring finger protein 38 1 1
MIRT030208 LTA4H leukotriene A4 hydrolase 1 1
MIRT030209 WDR60 WD repeat domain 60 1 1
MIRT030210 CAMKMT calmodulin-lysine N-methyltransferase 1 1
MIRT030211 HTRA1 HtrA serine peptidase 1 1 1
MIRT030212 L1CAM L1 cell adhesion molecule 1 1
MIRT030213 KCNQ2 potassium voltage-gated channel subfamily Q member 2 1 1
MIRT030214 FIG4 FIG4 phosphoinositide 5-phosphatase 1 1
MIRT030215 LAMA3 laminin subunit alpha 3 1 1
MIRT030216 BATF basic leucine zipper ATF-like transcription factor 1 1
MIRT030217 VPREB1 V-set pre-B cell surrogate light chain 1 1 1
MIRT030218 SMS spermine synthase 1 1
MIRT030219 TUBGCP4 tubulin gamma complex associated protein 4 1 1
MIRT030220 INSL4 insulin like 4 1 1
MIRT030221 EDN2 endothelin 2 1 1
MIRT030222 HIST1H1D histone cluster 1 H1 family member d 1 1
MIRT030223 LMAN2L lectin, mannose binding 2 like 1 1
MIRT030224 KIAA1324 KIAA1324 1 1
MIRT030225 SMAD6 SMAD family member 6 1 1
MIRT030226 KRT8 keratin 8 1 1
MIRT030227 FRS3 fibroblast growth factor receptor substrate 3 1 1
MIRT030228 CELA3B chymotrypsin like elastase family member 3B 1 1
MIRT030229 CASP4 caspase 4 1 1
MIRT030230 SH2B3 SH2B adaptor protein 3 1 1
MIRT030231 BCL3 B-cell CLL/lymphoma 3 1 1
MIRT030232 SDC3 syndecan 3 1 1
MIRT030233 SNURF SNRPN upstream reading frame 1 1
MIRT030234 CASP7 caspase 7 1 1
MIRT030235 CXCR4 C-X-C motif chemokine receptor 4 1 1
MIRT030236 KCNH4 potassium voltage-gated channel subfamily H member 4 1 1
MIRT030237 CDK2AP2 cyclin dependent kinase 2 associated protein 2 1 1
MIRT030238 MAST4 microtubule associated serine/threonine kinase family member 4 1 1
MIRT030239 DCSTAMP dendrocyte expressed seven transmembrane protein 1 1
MIRT030240 ACADSB acyl-CoA dehydrogenase, short/branched chain 1 1
MIRT030241 LDB2 LIM domain binding 2 1 1
MIRT030242 NFKB1 nuclear factor kappa B subunit 1 1 1
MIRT030243 GDAP1 ganglioside induced differentiation associated protein 1 1 1
MIRT030244 YAP1 Yes associated protein 1 1 1
MIRT030245 NELFCD negative elongation factor complex member C/D 1 1
MIRT030246 FAM135A family with sequence similarity 135 member A 1 1
MIRT030247 GPNMB glycoprotein nmb 1 1
MIRT030248 TOX thymocyte selection associated high mobility group box 1 1
MIRT030249 CHMP7 charged multivesicular body protein 7 1 1
MIRT030250 INPP5B inositol polyphosphate-5-phosphatase B 1 1
MIRT030251 ALPK3 alpha kinase 3 1 1
MIRT030252 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 1 1
MIRT030253 DNAJC6 DnaJ heat shock protein family (Hsp40) member C6 1 1
MIRT030254 S100A7A S100 calcium binding protein A7A 1 1
MIRT030255 VAMP7 vesicle associated membrane protein 7 1 1
MIRT030256 ZBTB38 zinc finger and BTB domain containing 38 1 1
MIRT030257 CAMK4 calcium/calmodulin dependent protein kinase IV 1 1
MIRT030258 PBLD phenazine biosynthesis like protein domain containing 1 1
MIRT030259 EIF2AK3 eukaryotic translation initiation factor 2 alpha kinase 3 1 1
MIRT030260 PDHX pyruvate dehydrogenase complex component X 1 1
MIRT030261 TBC1D13 TBC1 domain family member 13 2 2
MIRT030262 TET3 tet methylcytosine dioxygenase 3 2 4
MIRT030263 SSH2 slingshot protein phosphatase 2 1 2
MIRT030264 ELAVL2 ELAV like RNA binding protein 2 1 2
MIRT030265 TERF2 telomeric repeat binding factor 2 1 1
MIRT030266 PRSS16 protease, serine 16 1 1
MIRT030267 ABCD4 ATP binding cassette subfamily D member 4 1 1
MIRT030268 INPP5D inositol polyphosphate-5-phosphatase D 1 1
MIRT030269 ARPC5 actin related protein 2/3 complex subunit 5 1 1
MIRT030270 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT030271 CST3 cystatin C 1 1
MIRT030272 TRIB3 tribbles pseudokinase 3 1 1
MIRT030273 ST18 ST18, C2H2C-type zinc finger 1 1
MIRT030274 MFSD12 major facilitator superfamily domain containing 12 1 1
MIRT030275 FBXO5 F-box protein 5 1 1
MIRT030276 KRT32 keratin 32 1 1
MIRT030277 CCL2 C-C motif chemokine ligand 2 1 1
MIRT030278 NSL1 NSL1, MIS12 kinetochore complex component 1 1
MIRT030279 C1QTNF1 C1q and TNF related 1 1 1
MIRT030280 ENOX1 ecto-NOX disulfide-thiol exchanger 1 1 1
MIRT030281 TRIP6 thyroid hormone receptor interactor 6 1 1
MIRT030282 HOXB7 homeobox B7 1 1
MIRT030283 ADAM9 ADAM metallopeptidase domain 9 1 1
MIRT030284 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 1 1
MIRT030285 TAS2R13 taste 2 receptor member 13 1 1
MIRT030286 SRPX sushi repeat containing protein, X-linked 1 1
MIRT030287 GLRX2 glutaredoxin 2 1 1
MIRT030288 LIG1 DNA ligase 1 1 1
MIRT030289 RAB3GAP1 RAB3 GTPase activating protein catalytic subunit 1 1 1
MIRT030290 RAB8A RAB8A, member RAS oncogene family 1 1
MIRT030291 ADAM29 ADAM metallopeptidase domain 29 1 1
MIRT030292 DFNA5 DFNA5, deafness associated tumor suppressor 1 1
MIRT030293 TMSB15A thymosin beta 15a 1 1
MIRT030294 MPC1 mitochondrial pyruvate carrier 1 1 1
MIRT030295 GPR63 G protein-coupled receptor 63 1 1
MIRT030296 SIPA1 signal-induced proliferation-associated 1 1 1
MIRT030297 PHKA2 phosphorylase kinase regulatory subunit alpha 2 1 1
MIRT030298 SLC38A6 solute carrier family 38 member 6 1 1
MIRT030299 CRIP2 cysteine rich protein 2 1 1
MIRT030300 DTL denticleless E3 ubiquitin protein ligase homolog 1 1
MIRT030301 SLFN12 schlafen family member 12 1 1
MIRT030302 COA4 cytochrome c oxidase assembly factor 4 homolog 1 1
MIRT030303 MPC2 mitochondrial pyruvate carrier 2 1 1
MIRT030304 FARP1 FERM, ARH/RhoGEF and pleckstrin domain protein 1 1 1
MIRT030305 C1QB complement C1q B chain 1 1
MIRT030306 DUSP22 dual specificity phosphatase 22 1 1
MIRT030307 PIM2 Pim-2 proto-oncogene, serine/threonine kinase 1 1
MIRT030308 CRLF1 cytokine receptor like factor 1 1 1
MIRT030309 NAT1 N-acetyltransferase 1 1 1
MIRT030310 ZNF423 zinc finger protein 423 1 1
MIRT030311 PEX11A peroxisomal biogenesis factor 11 alpha 1 1
MIRT030312 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT030313 TAGLN transgelin 1 1
MIRT030314 KANSL3 KAT8 regulatory NSL complex subunit 3 1 1
MIRT030315 TRIM68 tripartite motif containing 68 1 1
MIRT030316 SI sucrase-isomaltase 1 1
MIRT030317 ATP6AP1 ATPase H+ transporting accessory protein 1 1 1
MIRT030318 PDCL3 phosducin like 3 1 1
MIRT030319 MAGEA11 MAGE family member A11 1 1
MIRT030320 FMO3 flavin containing monooxygenase 3 1 1
MIRT030321 RNF144A ring finger protein 144A 1 1
MIRT030322 ARHGEF5 Rho guanine nucleotide exchange factor 5 1 1
MIRT030323 PFKP phosphofructokinase, platelet 1 1
MIRT030324 TRAPPC6A trafficking protein particle complex 6A 1 1
MIRT030325 CDH9 cadherin 9 1 1
MIRT030326 DVL3 dishevelled segment polarity protein 3 1 1
MIRT030327 DHX35 DEAH-box helicase 35 1 1
MIRT030328 NCAPG2 non-SMC condensin II complex subunit G2 1 1
MIRT030329 ERBB2IP erbb2 interacting protein 1 1
MIRT030330 FZD5 frizzled class receptor 5 1 1
MIRT030331 TMEM50A transmembrane protein 50A 1 1
MIRT030332 ERAP1 endoplasmic reticulum aminopeptidase 1 1 1
MIRT030333 CES3 carboxylesterase 3 1 1
MIRT030334 SLC30A10 solute carrier family 30 member 10 1 1
MIRT030335 GDF10 growth differentiation factor 10 1 1
MIRT030336 VPS13C vacuolar protein sorting 13 homolog C 1 1
MIRT030337 MPHOSPH8 M-phase phosphoprotein 8 1 1
MIRT030338 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT030339 ARL4A ADP ribosylation factor like GTPase 4A 1 1
MIRT030340 PKIA cAMP-dependent protein kinase inhibitor alpha 1 1
MIRT030341 POU2F1 POU class 2 homeobox 1 1 1
MIRT030342 PDGFRA platelet derived growth factor receptor alpha 1 1
MIRT030343 CYLC2 cylicin 2 1 1
MIRT030344 POLE3 DNA polymerase epsilon 3, accessory subunit 1 1
MIRT030345 SFRP4 secreted frizzled related protein 4 1 1
MIRT030346 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 1 1
MIRT030347 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT030348 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 1 1
MIRT030349 PLXNA2 plexin A2 1 1
MIRT030350 CCNDBP1 cyclin D1 binding protein 1 1 1
MIRT030351 PCNA proliferating cell nuclear antigen 1 1
MIRT030352 CXADR CXADR, Ig-like cell adhesion molecule 1 1
MIRT030353 CTH cystathionine gamma-lyase 1 1
MIRT030354 SLC25A44 solute carrier family 25 member 44 1 1
MIRT030355 RARS2 arginyl-tRNA synthetase 2, mitochondrial 1 1
MIRT030356 JARID2 jumonji and AT-rich interaction domain containing 2 1 1
MIRT030357 FBXO11 F-box protein 11 1 2
MIRT050038 DCAF10 DDB1 and CUL4 associated factor 10 1 2
MIRT050039 MANF mesencephalic astrocyte derived neurotrophic factor 1 1
MIRT050040 IPO13 importin 13 1 1
MIRT050041 XRCC5 X-ray repair cross complementing 5 1 1
MIRT050042 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT050043 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 1 1
MIRT050044 BCLAF1 BCL2 associated transcription factor 1 1 1
MIRT050045 DERL1 derlin 1 1 1
MIRT050046 TRIM36 tripartite motif containing 36 1 1
MIRT050047 HMGB1 high mobility group box 1 1 1
MIRT050048 ACVR1B activin A receptor type 1B 1 1
MIRT050049 PPP1CC protein phosphatase 1 catalytic subunit gamma 1 1
MIRT050050 SRPR SRP receptor alpha subunit 1 1
MIRT050051 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT050052 NAP1L1 nucleosome assembly protein 1 like 1 1 1
MIRT054554 NR2C2 nuclear receptor subfamily 2 group C member 2 3 1
MIRT054555 TAB1 TGF-beta activated kinase 1 (MAP3K7) binding protein 1 3 1
MIRT054718 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 4 1
MIRT054765 USP9X ubiquitin specific peptidase 9, X-linked 3 1
MIRT062178 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT064736 CCND2 cyclin D2 4 8
MIRT066810 ZDHHC18 zinc finger DHHC-type containing 18 2 3
MIRT067541 METAP2 methionyl aminopeptidase 2 1 1
MIRT072093 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 5
MIRT073376 ABHD2 abhydrolase domain containing 2 1 1
MIRT075112 C16ORF70 chromosome 16 open reading frame 70 2 5
MIRT086008 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087900 TNRC6B trinucleotide repeat containing 6B 2 5
MIRT090518 SLC25A36 solute carrier family 25 member 36 2 2
MIRT122041 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 1 1
MIRT133478 EP400 E1A binding protein p400 1 1
MIRT134088 KLHL42 kelch like family member 42 1 1
MIRT136530 KPNA6 karyopherin subunit alpha 6 1 1
MIRT137415 RLF rearranged L-myc fusion 1 1
MIRT137578 RCOR1 REST corepressor 1 1 1
MIRT137723 EIF5 eukaryotic translation initiation factor 5 1 1
MIRT147275 KPNA2 karyopherin subunit alpha 2