miRTarBase - #MIRT032110


—
pre-miRNA Information
pre-miRNA hsa-let-7d   
Genomic Coordinates chr9: 94178834 - 94178920
Synonyms LET7D, MIRNLET7D, hsa-let-7d, let-7d, MIRLET7D
Description Homo sapiens let-7d stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-let-7d-5p
Sequence 8| AGAGGUAGUAGGUUGCAUAGUU |29
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 9 + 94178843 27292188 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1462778813 2 dbSNP
rs1467512593 13 dbSNP
rs1329655735 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NR4A1   
Synonyms GFRP1, HMR, N10, NAK-1, NGFIB, NP10, NUR77, TR3
Description nuclear receptor subfamily 4 group A member 1
Transcript NM_002135   
Other Transcripts NM_173157   
Expression
Putative miRNA Targets on NR4A1
3'UTR of NR4A1
(miRNA target sites are highlighted)		 
>NR4A1|NM_002135|3'UTR
   1 CCCCTGCCTGGGAACACGTGTGCACATGCGCACTCTCATATGCCACCCCATGTGCCTTTAGTCCACGGACCCCCAGAGCA
  81 CCCCCAAGCCTGGGCTTGAGCTGCAGAATGACTCCACCTTCTCACCTGCTCCAGGAGGTTTGCAGGGAGCTCAAGCCCTT
 161 GGGGAGGGGGATGCCTTCATGGGGGTGACCCCACGATTTGTCTTATCCCCCCCAGCCTGGCCCCGGCCTTTATGTTTTTT
 241 GTAAGATAAACCGTTTTTAACACATAGCGCCGTGCTGTAAATAAGCCCAGTGCTGCTGTAAATACAGGAAGAAAGAGCTT
 321 GAGGTGGGAGCGGGGCTGGGAGGAAGGGATGGGCCCCGCCTTCCTGGGCAGCCTTTCCAGCCTCCTGCTGGCTCTCTCTT
 401 CCTACCCTCCTTCCACATGTACATAAACTGTCACTCTAGGAAGAAGACAAATGACAGATTCTGACATTTATATTTGTGTA
 481 TTTTCCTGGATTTATAGTATGTGACTTTTCTGATTAATATATTTAATATATTGAATAAAAAATAGACATGTAGTTGGAAC
 561 TGAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuGAUACGUUGG--AUGAUGGAGa 5'
            ||: |||:||  | | :|||| 
Target 5' tcCTGGGCAGCCTTTCCAGCCTCc 3'
 362 - 385 118.00 -17.20
2 
miRNA  3' uugauacguuGGAUGAU-GGAGa 5'
                    |:| ||| |||| 
Target 5' ctggctctctCTTCCTACCCTCc 3'
 388 - 410 116.00 -10.20
3 
miRNA  3' uugaUAC---GUUGGAUGA-UGGAga 5'
              |||   | |||| || ||||  
Target 5' cagaATGACTCCACCTTCTCACCTgc 3'
 104 - 129 110.00 -9.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30510170 4 COSMIC
COSN31501453 13 COSMIC
COSN30637510 31 COSMIC
COSN16855431 38 COSMIC
COSN31555240 67 COSMIC
COSN30105828 102 COSMIC
COSN28868561 214 COSMIC
COSN5323918 300 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs374214087 2 dbSNP
rs1204631474 5 dbSNP
rs1230387694 7 dbSNP
rs377130441 16 dbSNP
rs761680805 18 dbSNP
rs767505400 19 dbSNP
rs781539365 24 dbSNP
rs796831046 27 dbSNP
rs45496793 30 dbSNP
rs527336390 31 dbSNP
rs766268444 32 dbSNP
rs374615853 34 dbSNP
rs775548290 34 dbSNP
rs1376519030 35 dbSNP
rs752914743 36 dbSNP
rs377389753 37 dbSNP
rs943732575 39 dbSNP
rs1456480523 42 dbSNP
rs777748779 43 dbSNP
rs370405147 48 dbSNP
rs372746627 50 dbSNP
rs1474099506 52 dbSNP
rs932436147 57 dbSNP
rs564212218 67 dbSNP
rs374892003 68 dbSNP
rs1346122658 72 dbSNP
rs1447675398 85 dbSNP
rs549779202 88 dbSNP
rs1271487590 89 dbSNP
rs1315547813 97 dbSNP
rs45491997 98 dbSNP
rs909933604 99 dbSNP
rs940070083 107 dbSNP
rs1228668800 110 dbSNP
rs1196283587 118 dbSNP
rs1358430567 134 dbSNP
rs1037147101 138 dbSNP
rs1268321808 145 dbSNP
rs1245956459 153 dbSNP
rs538537684 159 dbSNP
rs931663165 163 dbSNP
rs575198044 167 dbSNP
rs1239896371 169 dbSNP
rs568310291 172 dbSNP
rs1003587712 175 dbSNP
rs1356826837 180 dbSNP
rs1166159327 181 dbSNP
rs1465170116 190 dbSNP
rs113063973 191 dbSNP
rs550028551 192 dbSNP
rs944506237 194 dbSNP
rs1475987778 196 dbSNP
rs1402757677 201 dbSNP
rs1385358021 206 dbSNP
rs1036600832 207 dbSNP
rs1468258161 207 dbSNP
rs1253830969 208 dbSNP
rs897659739 211 dbSNP
rs930520765 212 dbSNP
rs895409781 213 dbSNP
rs1002184970 214 dbSNP
rs111547428 214 dbSNP
rs1293776908 218 dbSNP
rs117329085 225 dbSNP
rs967301564 226 dbSNP
rs1411070381 228 dbSNP
rs1392561557 229 dbSNP
rs539423088 230 dbSNP
rs1453844722 244 dbSNP
rs998547272 253 dbSNP
rs139430017 254 dbSNP
rs1231020527 264 dbSNP
rs1468746795 264 dbSNP
rs1203552281 265 dbSNP
rs1031416693 269 dbSNP
rs774435625 270 dbSNP
rs188847442 272 dbSNP
rs976389049 273 dbSNP
rs921145014 278 dbSNP
rs1028550779 288 dbSNP
rs1288679054 297 dbSNP
rs1370703341 304 dbSNP
rs1279404664 309 dbSNP
rs1410789313 314 dbSNP
rs954006548 318 dbSNP
rs984468914 325 dbSNP
rs1200647455 328 dbSNP
rs954318280 331 dbSNP
rs909703228 333 dbSNP
rs1434572716 334 dbSNP
rs1260977989 337 dbSNP
rs985751462 338 dbSNP
rs911596553 343 dbSNP
rs966145198 345 dbSNP
rs1407496666 350 dbSNP
rs939870147 353 dbSNP
rs1477425489 358 dbSNP
rs1194268044 359 dbSNP
rs1425921849 372 dbSNP
rs1456452050 377 dbSNP
rs1801546 378 dbSNP
rs1185712685 379 dbSNP
rs1037117691 383 dbSNP
rs192628927 384 dbSNP
rs971846934 386 dbSNP
rs116293794 389 dbSNP
rs1314805605 391 dbSNP
rs1407469675 392 dbSNP
rs1352747427 393 dbSNP
rs930511333 397 dbSNP
rs866659865 399 dbSNP
rs1296688468 405 dbSNP
rs1304703703 406 dbSNP
rs1048946706 412 dbSNP
rs373434588 417 dbSNP
rs1344640071 424 dbSNP
rs1160227977 429 dbSNP
rs562011019 437 dbSNP
rs1413917789 438 dbSNP
rs1340276217 444 dbSNP
rs572262139 450 dbSNP
rs937947564 451 dbSNP
rs1056478018 456 dbSNP
rs1042459 462 dbSNP
rs939300640 482 dbSNP
rs896490458 485 dbSNP
rs1055147258 493 dbSNP
rs1280640205 499 dbSNP
rs1208982456 500 dbSNP
rs1042491810 501 dbSNP
rs1271738754 510 dbSNP
rs1042473 511 dbSNP
rs541253697 520 dbSNP
rs564152147 529 dbSNP
rs1011137697 530 dbSNP
rs1322907632 531 dbSNP
rs2603751 555 dbSNP
rs902679176 558 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUSC 0.477 0 0.542 0 38 Click to see details
LIHC -0.21 0.07 -0.257 0.04 49 Click to see details
PRAD -0.199 0.08 -0.217 0.07 50 Click to see details
BRCA -0.147 0.09 -0.143 0.1 84 Click to see details
STAD -0.241 0.09 -0.277 0.06 32 Click to see details
THCA 0.123 0.18 0.137 0.15 59 Click to see details
CHOL 0.342 0.18 0.367 0.17 9 Click to see details
BLCA -0.204 0.21 -0.238 0.17 18 Click to see details
KIRC -0.096 0.22 -0.081 0.26 68 Click to see details
PCPG 0.76 0.23 0.500 0.33 3 Click to see details
CESC 0.733 0.24 0.500 0.33 3 Click to see details
PAAD -0.502 0.25 -0.200 0.4 4 Click to see details
KIRP 0.096 0.3 0.040 0.41 32 Click to see details
COAD -0.164 0.35 -0.214 0.31 8 Click to see details
KICH 0.081 0.35 0.108 0.3 25 Click to see details
ESCA -0.12 0.36 0.036 0.46 11 Click to see details
UCEC 0.064 0.4 0.072 0.38 19 Click to see details
LUAD -0.022 0.47 -0.035 0.46 12 Click to see details
HNSC -0.002 0.49 -0.002 0.49 42 Click to see details
HNSC -0.002 0.49 -0.002 0.49 42 Click to see details
HNSC -0.002 0.49 -0.002 0.49 42 Click to see details
370 hsa-let-7d-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000401 BDNF brain derived neurotrophic factor 1 1
MIRT000402 CDK6 cyclin dependent kinase 6 1 1
MIRT000403 CDC25A cell division cycle 25A 1 1
MIRT000405 BCL2 BCL2, apoptosis regulator 1 1
MIRT000406 KRAS KRAS proto-oncogene, GTPase 1 1
MIRT002005 HMGA2 high mobility group AT-hook 2 6 8
MIRT003901 APP amyloid beta precursor protein 2 1
MIRT004347 DICER1 dicer 1, ribonuclease III 3 1
MIRT004505 SLC11A2 solute carrier family 11 member 2 6 5
MIRT005549 PDGFA platelet derived growth factor subunit A 3 1
MIRT006398 IL13 interleukin 13 2 1
MIRT006406 MPL MPL proto-oncogene, thrombopoietin receptor 1 1
MIRT032101 RABGAP1L RAB GTPase activating protein 1 like 1 1
MIRT032102 DRD3 dopamine receptor D3 1 1
MIRT032103 SMOX spermine oxidase 1 1
MIRT032104 DAD1 defender against cell death 1 1 1
MIRT032105 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 3 5
MIRT032106 CALCOCO2 calcium binding and coiled-coil domain 2 1 1
MIRT032107 GPR63 G protein-coupled receptor 63 1 1
MIRT032108 FAM135A family with sequence similarity 135 member A 1 1
MIRT032109 CPNE1 copine 1 1 1
MIRT032110 NR4A1 nuclear receptor subfamily 4 group A member 1 1 1
MIRT032111 BUB3 BUB3, mitotic checkpoint protein 1 1
MIRT032112 TBC1D9B TBC1 domain family member 9B 1 1
MIRT032113 LARP4B La ribonucleoprotein domain family member 4B 1 1
MIRT032114 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 2 3
MIRT032115 FBXO3 F-box protein 3 1 1
MIRT032116 ZNF763 zinc finger protein 763 1 1
MIRT032117 PCNP PEST proteolytic signal containing nuclear protein 1 1
MIRT032118 HOMER1 homer scaffolding protein 1 1 1
MIRT032119 RBM12 RNA binding motif protein 12 1 1
MIRT032120 KMT2A lysine methyltransferase 2A 1 1
MIRT032121 CBR4 carbonyl reductase 4 1 1
MIRT032122 THBS1 thrombospondin 1 2 4
MIRT032123 TLE4 transducin like enhancer of split 4 1 1
MIRT032124 TOMM20 translocase of outer mitochondrial membrane 20 1 1
MIRT032125 TMED4 transmembrane p24 trafficking protein 4 1 1
MIRT032126 AKAP8 A-kinase anchoring protein 8 2 4
MIRT032127 TST thiosulfate sulfurtransferase 1 1
MIRT032128 GPR137B G protein-coupled receptor 137B 1 1
MIRT032129 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 1 1
MIRT032130 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 4
MIRT032131 RPUSD2 RNA pseudouridylate synthase domain containing 2 1 1
MIRT032132 ZBTB24 zinc finger and BTB domain containing 24 1 1
MIRT032133 SPATA2 spermatogenesis associated 2 1 1
MIRT032134 GOLT1B golgi transport 1B 1 1
MIRT032135 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT032136 SREK1IP1 SREK1 interacting protein 1 1 1
MIRT032137 RFX5 regulatory factor X5 1 1
MIRT032138 BIN3 bridging integrator 3 1 1
MIRT032139 CEP120 centrosomal protein 120 2 3
MIRT032140 ZNF526 zinc finger protein 526 1 1
MIRT032141 ISL1 ISL LIM homeobox 1 1 1
MIRT032142 POLR2D RNA polymerase II subunit D 2 5
MIRT032143 SMCR7L mitochondrial elongation factor 1 1 4
MIRT032144 TMEM194A nuclear envelope integral membrane protein 1 1 1
MIRT032145 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT032146 C12orf4 chromosome 12 open reading frame 4 2 3
MIRT032147 TMEM2 transmembrane protein 2 1 1
MIRT032148 DLC1 DLC1 Rho GTPase activating protein 1 1
MIRT032149 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 3
MIRT032150 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 1 1
MIRT032151 ZNF354B zinc finger protein 354B 1 1
MIRT032152 ZNF200 zinc finger protein 200 2 4
MIRT032153 ADCY9 adenylate cyclase 9 1 1
MIRT032154 TNRC6A trinucleotide repeat containing 6A 1 1
MIRT032155 STK40 serine/threonine kinase 40 1 1
MIRT032156 PCGF3 polycomb group ring finger 3 2 6
MIRT032157 ZBTB39 zinc finger and BTB domain containing 39 1 1
MIRT032158 LIN52 lin-52 DREAM MuvB core complex component 1 1
MIRT032159 RAD9A RAD9 checkpoint clamp component A 1 1
MIRT032160 ARRDC4 arrestin domain containing 4 1 1
MIRT032161 SLC30A6 solute carrier family 30 member 6 1 1
MIRT032162 LBR lamin B receptor 1 1
MIRT032163 C9orf41 carnosine N-methyltransferase 1 1 1
MIRT032164 ESPL1 extra spindle pole bodies like 1, separase 2 5
MIRT032165 ABT1 activator of basal transcription 1 2 9
MIRT032166 NHLRC3 NHL repeat containing 3 2 6
MIRT032167 GLMN glomulin, FKBP associated protein 1 1
MIRT032168 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT032169 ZNF644 zinc finger protein 644 2 3
MIRT032170 C11orf57 chromosome 11 open reading frame 57 2 5
MIRT032171 FAM104A family with sequence similarity 104 member A 2 2
MIRT032172 SPRYD4 SPRY domain containing 4 1 1
MIRT032173 ARID3A AT-rich interaction domain 3A 2 3
MIRT032174 SLC10A7 solute carrier family 10 member 7 2 6
MIRT032175 ONECUT2 one cut homeobox 2 2 3
MIRT032176 USP24 ubiquitin specific peptidase 24 1 1
MIRT032177 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT032178 TGFBR1 transforming growth factor beta receptor 1 1 1
MIRT032179 HAND1 heart and neural crest derivatives expressed 1 2 3
MIRT032180 KPNA5 karyopherin subunit alpha 5 2 8
MIRT032181 IGF1R insulin like growth factor 1 receptor 2 9
MIRT032182 TMEM135 transmembrane protein 135 1 1
MIRT032183 SLC20A1 solute carrier family 20 member 1 2 4
MIRT032184 ZNF280B zinc finger protein 280B 1 1
MIRT032185 LIN28B lin-28 homolog B 1 1
MIRT032186 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 3
MIRT051710 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 1 1
MIRT051711 PRR13 proline rich 13 1 1
MIRT051712 ZNF746 zinc finger protein 746 1 1
MIRT051713 SLC35A4 solute carrier family 35 member A4 1 1
MIRT051714 RPL31 ribosomal protein L31 1 1
MIRT051715 TPD52L2 tumor protein D52 like 2 1 1
MIRT051716 MRPL51 mitochondrial ribosomal protein L51 1 1
MIRT051717 CTDP1 CTD phosphatase subunit 1 1 1
MIRT051718 RPS6 ribosomal protein S6 1 1
MIRT051719 SENP5 SUMO1/sentrin specific peptidase 5 1 1
MIRT051720 PAXBP1 PAX3 and PAX7 binding protein 1 1 1
MIRT051721 DHX57 DExH-box helicase 57 1 1
MIRT051722 H2AFX H2A histone family member X 1 1
MIRT051723 DSC3 desmocollin 3 1 1
MIRT051724 CIZ1 CDKN1A interacting zinc finger protein 1 1 1
MIRT051725 NCOA1 nuclear receptor coactivator 1 1 1
MIRT051726 LRRC42 leucine rich repeat containing 42 1 1
MIRT051727 UTP6 UTP6, small subunit processome component 1 1
MIRT063194 ADIPOR2 adiponectin receptor 2 2 2
MIRT068153 TXLNA taxilin alpha 2 2
MIRT068788 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT073005 ARID3B AT-rich interaction domain 3B 2 6
MIRT076222 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT083299 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT084975 BACH1 BTB domain and CNC homolog 1 4 3
MIRT095765 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT112241 MDM4 MDM4, p53 regulator 2 4
MIRT118585 STK4 serine/threonine kinase 4 2 2
MIRT120920 PDE12 phosphodiesterase 12 2 8
MIRT123316 CALU calumenin 2 2
MIRT123975 POLR3D RNA polymerase III subunit D 2 2
MIRT152271 TNFSF9 TNF superfamily member 9 2 2
MIRT153846 NCOA3 nuclear receptor coactivator 3 2 2
MIRT168582 HMGA1 high mobility group AT-hook 1 2 4
MIRT180602 CRY2 cryptochrome circadian clock 2 2 2
MIRT187716 SUOX sulfite oxidase 2 2
MIRT191403 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT193100 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT215719 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT218814 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT240329 UBXN2B UBX domain protein 2B 2 2
MIRT243472 TRIM71 tripartite motif containing 71 2 2
MIRT244068 EDN1 endothelin 1 2 2
MIRT252329 SALL3 spalt like transcription factor 3 2 2
MIRT255313 CDV3 CDV3 homolog 2 2
MIRT259276 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT259478 TXLNG taxilin gamma 2 2
MIRT260706 CLDN12 claudin 12 2 6
MIRT266211 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT266625 CHTOP chromatin target of PRMT1 2 2
MIRT268838 C1ORF21 chromosome 1 open reading frame 21 2 2
MIRT284527 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT294445 ZNF264 zinc finger protein 264 2 2
MIRT297012 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT300036 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT300892 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT303319 MXD1 MAX dimerization protein 1 2 2
MIRT309845 NAT8L N-acetyltransferase 8 like 2 2
MIRT322427 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT324730 ACER2 alkaline ceramidase 2 2 2
MIRT402056 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT437855 EIF2C1 argonaute 1, RISC catalytic component 3 1
MIRT438633 TNFRSF10B TNF receptor superfamily member 10b 2 1
MIRT439136 ZEB2 zinc finger E-box binding homeobox 2 0 1
MIRT439137 MYC MYC proto-oncogene, bHLH transcription factor 0 1
MIRT442021 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT445659 ATP6V1G1 ATPase H+ transporting V1 subunit G1 2 6
MIRT447137 KIF27 kinesin family member 27 2 2
MIRT448263 ZNF774 zinc finger protein 774 2 2
MIRT449006 ANKRD46 ankyrin repeat domain 46 2 2
MIRT449954 FMNL3 formin like 3 2 2
MIRT451156 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451625 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451694 C1RL complement C1r subcomponent like 2 2
MIRT452093 NUCB2 nucleobindin 2 2 2
MIRT452432 QDPR quinoid dihydropteridine reductase 2 2
MIRT452944 DISC1 disrupted in schizophrenia 1 2 2
MIRT453402 RHD Rh blood group D antigen 2 6
MIRT454165 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT454281 FXN frataxin 2 2
MIRT454540 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT454855 ACOT9 acyl-CoA thioesterase 9 2 4
MIRT455677 GLO1 glyoxalase I 2 2
MIRT457249 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT457678 ZNF587 zinc finger protein 587 2 2
MIRT457888 THEM6 thioesterase superfamily member 6 2 4
MIRT458017 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT458280 FUT10 fucosyltransferase 10 2 2
MIRT459737 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT460454 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460501 FAM105A family with sequence similarity 105 member A 2 6
MIRT460939 NOA1 nitric oxide associated 1 2 4
MIRT461093 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT461365 COL8A1 collagen type VIII alpha 1 chain 2 2
MIRT462383 YAE1D1 Yae1 domain containing 1 2 2
MIRT462781 ZNF8 zinc finger protein 8 2 2
MIRT463418 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463663 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464266 VCL vinculin 2 2
MIRT465125 TSC22D2 TSC22 domain family member 2 2 4
MIRT466186 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466720 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT469103 RNF144B ring finger protein 144B 2 2
MIRT469713 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT470424 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT470860 PLXND1 plexin D1 2 2
MIRT471270 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT471965 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472738 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473135 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT473829 MAP2K7 mitogen-activated protein kinase kinase 7 2 2
MIRT473941 LYN LYN proto-oncogene, Src family tyrosine kinase 2 2
MIRT474024 LRRC20 leucine rich repeat containing 20 2 2
MIRT474501 KLHDC8B kelch domain containing 8B 2 2
MIRT474760 KIAA0930 KIAA0930 2 2
MIRT474908 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT475332 IFNLR1 interferon lambda receptor 1 2 2
MIRT475380 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT475734 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT476549 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT476974 FAM83G family with sequence similarity 83 member G 2 4
MIRT477679 EFHD2 EF-hand domain family member D2 2 2
MIRT479750 CCND1 cyclin D1 2 2
MIRT481194 ATXN7L3B ataxin 7 like 3B 2 4
MIRT481239 ATXN7L3 ataxin 7 like 3 2 2
MIRT481364 ATG9A autophagy related 9A 2 2
MIRT481389 ATG12 autophagy related 12 2 2
MIRT481653 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT481853 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT482185 AHR aryl hydrocarbon receptor 2 2
MIRT482221 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT485297 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT486660 ZNF28 zinc finger protein 28 2 2
MIRT489414 TUBB2A tubulin beta 2A class IIa 2 2
MIRT491865 ZBTB5 zinc finger and BTB domain containing 5 2 8
MIRT492211 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492625 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT493322 LIMD2 LIM domain containing 2 2 2
MIRT493902 FAM43A family with sequence similarity 43 member A 2 4
MIRT495969 TBC1D19 TBC1 domain family member 19 2 2
MIRT496113 SNX17 sorting nexin 17 2 2
MIRT497876 SLC12A7 solute carrier family 12 member 7 2 2
MIRT498118 PLEKHO1 pleckstrin homology domain containing O1 2 4
MIRT499406 PLCG2 phospholipase C gamma 2 2 4
MIRT499494 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 2
MIRT499654 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 2 2
MIRT499943 MFSD8 major facilitator superfamily domain containing 8 2 2
MIRT499998 HIST1H2BD histone cluster 1 H2B family member d 2 4
MIRT500899 STRN striatin 2 4
MIRT501113 SLC5A6 solute carrier family 5 member 6 2 4
MIRT501209 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT501247 SEMA4C semaphorin 4C 2 6
MIRT501327 RNFT1 ring finger protein, transmembrane 1 2 2
MIRT501349 RNF44 ring finger protein 44 2 4
MIRT501388 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT501442 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT501752 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT501941 MBD2 methyl-CpG binding domain protein 2 2 8
MIRT502121 KMT2D lysine methyltransferase 2D 2 4
MIRT502783 CEP135 centrosomal protein 135 2 2
MIRT502840 CELF1 CUGBP Elav-like family member 1 2 2
MIRT505579 SMC1A structural maintenance of chromosomes 1A 2 6
MIRT506360 NUP155 nucleoporin 155 2 6
MIRT507243 FIGN fidgetin, microtubule severing factor 2 8
MIRT507689 COIL coilin 2 6
MIRT508402 C1orf210 chromosome 1 open reading frame 210 2 6
MIRT508666 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT508933 AK4 adenylate kinase 4 2 4
MIRT510392 ZNF566 zinc finger protein 566 2 6
MIRT510514 YOD1 YOD1 deubiquitinase 2 6
MIRT511387 IKZF3 IKAROS family zinc finger 3 2 4
MIRT512747 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT515955 C9orf156 tRNA methyltransferase O 2 2
MIRT516084 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 2 4
MIRT521390 RDX radixin 2 4
MIRT522349 NCKIPSD NCK interacting protein with SH3 domain 2 4
MIRT523627 FZD9 frizzled class receptor 9 2 4
MIRT523734 FBXW2 F-box and WD repeat domain containing 2 2 4
MIRT523983 DVL3 dishevelled segment polarity protein 3 2 2
MIRT524115 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT525728 SOD2 superoxide dismutase 2 2 2
MIRT527764 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT529728 OPRL1 opioid related nociceptin receptor 1 2 2
MIRT533189 WASL Wiskott-Aldrich syndrome like 2 6
MIRT536379 LEFTY1 left-right determination factor 1 2 2
MIRT543786 RBM12B RNA binding motif protein 12B 2 4
MIRT543869 SLC16A9 solute carrier family 16 member 9 2 2
MIRT545388 PM20D2 peptidase M20 domain containing 2 2 2
MIRT546329 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547372 MSI2 musashi RNA binding protein 2 2 2
MIRT547573 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT548266 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548346 EPHA4 EPH receptor A4 2 2
MIRT548535 DUSP1 dual specificity phosphatase 1 2 2
MIRT548564 DNAL1 dynein axonemal light chain 1 2 2
MIRT548780 COLEC12 collectin subfamily member 12 2 2
MIRT548972 CCNT2 cyclin T2 2 2
MIRT549022 CBX5 chromobox 5 2 2
MIRT549207 BEND4 BEN domain containing 4 2 4
MIRT549764 ZNF611 zinc finger protein 611 2 6
MIRT549800 KIAA0391 KIAA0391 2 2
MIRT549848 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT550727 PMPCA peptidase, mitochondrial processing alpha subunit 2 4
MIRT550899 ACTA1 actin, alpha 1, skeletal muscle 2 2
MIRT551284 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT551319 GSG2 histone H3 associated protein kinase 2 6
MIRT552004 RAD18 RAD18, E3 ubiquitin protein ligase 2 2
MIRT552411 ZNF460 zinc finger protein 460 2 4
MIRT553018 USP38 ubiquitin specific peptidase 38 2 2
MIRT555551 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555717 PDZD8 PDZ domain containing 8 2 2
MIRT557967 FAM222B family with sequence similarity 222 member B 2 2
MIRT559088 C19orf47 chromosome 19 open reading frame 47 2 4
MIRT559498 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT561776 PEG10 paternally expressed 10 2 2
MIRT564403 EMILIN2 elastin microfibril interfacer 2 2 4
MIRT565450 SURF4 surfeit 4 2 2
MIRT566519 PARP16 poly(ADP-ribose) polymerase family member 16 2 2
MIRT567430 GNG5 G protein subunit gamma 5 2 2
MIRT567718 E2F6 E2F transcription factor 6 2 2
MIRT568649 ABHD17C abhydrolase domain containing 17C 2 2
MIRT569499 THYN1 thymocyte nuclear protein 1 2 2
MIRT573821 TGOLN2 trans-golgi network protein 2 2 2
MIRT574364 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT574749 GOLGA4 golgin A4 2 2
MIRT576088 Poteg POTE ankyrin domain family, member G 2 2
MIRT576807 Thbs1 thrombospondin 1 2 3
MIRT616371 RWDD1 RWD domain containing 1 2 2
MIRT617852 FMO4 flavin containing monooxygenase 4 2 2
MIRT642395 ZNF556 zinc finger protein 556 2 2
MIRT680520 PRIM2 DNA primase subunit 2 2 2
MIRT680548 ZNF584 zinc finger protein 584 2 2
MIRT680801 ZNF578 zinc finger protein 578 2 2
MIRT680839 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT681142 INTS7 integrator complex subunit 7 2 2
MIRT681272 RFC2 replication factor C subunit 2 2 2
MIRT681324 ZFAND4 zinc finger AN1-type containing 4 2 4
MIRT681360 BRI3BP BRI3 binding protein 2 2
MIRT681507 STAT2 signal transducer and activator of transcription 2 2 2
MIRT681537 ZNF738 zinc finger protein 738 2 2
MIRT681659 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT681739 RAB19 RAB19, member RAS oncogene family 2 4
MIRT681761 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 2
MIRT681798 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681870 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT681942 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682103 ITGA3 integrin subunit alpha 3 2 4
MIRT682182 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682239 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682385 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682445 MTX3 metaxin 3 2 2
MIRT682605 CPA4 carboxypeptidase A4 2 2
MIRT682641 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT689328 FPR1 formyl peptide receptor 1 2 2
MIRT689731 ATXN2 ataxin 2 2 2
MIRT691037 ZNF799 zinc finger protein 799 2 2
MIRT691936 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT694885 ZNF417 zinc finger protein 417 2 2
MIRT695256 ZNF443 zinc finger protein 443 2 2
MIRT695414 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT700588 PRSS22 protease, serine 22 2 2
MIRT701425 NHLRC2 NHL repeat containing 2 2 2
MIRT702485 KIAA1328 KIAA1328 2 2
MIRT702714 IPO9 importin 9 2 2
MIRT704030 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT704422 CTPS1 CTP synthase 1 2 2
MIRT705751 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT712372 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT713521 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT734116 Olr1 oxidized low density lipoprotein (lectin-like) receptor 1 3 0
MIRT734252 OPRM1 opioid receptor mu 1 3 0
MIRT735524 CD274 CD274 molecule 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
let-7d Benzene NULL 241 MiRNA PCR array white blood cell 24780745 2014 up-regulated
let-7d Benzene NULL 241 MiRNA PCR array blood mononuclear cells 24780745 2014 up-regulated
let-7d Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
let-7d Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 up-regulated
let-7d All-trans-retinoic acid (ATRA) approved 444795 Microarray acute promyelocytic leukemia 17260024 2008 up-regulated
let-7d 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
let-7d Cocaine NULL 446220 Quantitative real-time PCR HEK293 cells or rat brain parts 19703567 2009 down-regulated
let-7d Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
let-7d Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 up-regulated
let-7d 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
let-7d Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
let-7d CDF(analogues of curcumin) NULL NULL Quantitative real-time PCR pancreatic cancer cells 22108826 2012 up-regulated
let-7d Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
let-7d 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
let-7d Vitamin D3 approved 5280795 Quantitative real-time PCR Plasma 22594500 2012 up-regulated
let-7d Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
let-7d Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
let-7d Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
let-7d Sevoflurane approved 5206 Quantitative real-time PCR lung cell 23124245 2012 down-regulated
let-7d Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
let-7d Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
let-7d Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-let-7d Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7d Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (MIA-PaCa-2, PANC-1, Aspc-1, L3.6pl, Colo357, BXPC-3, HPAC)
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant High Tongue Squamous Cell Carcinoma cell line (Tca8113)
hsa-let-7d Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-let-7d Cisplatin 5460033 NSC119875 approved sensitive Low Oral Cancer Oral Cancer Tumor Initiating Cells
hsa-let-7d Paclitaxel 36314 NSC125973 approved sensitive Low Oral Cancer Oral Cancer Tumor Initiating Cells
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-let-7d Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (C13*, A2780, OV2008)
hsa-let-7d Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-let-7d Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-let-7d Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor tissue
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-let-7d Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7d Mitoxantrone 4212 NSC279836 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7d Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (HCC827)
hsa-let-7d 7-Difluoromethoxyl-5,4’-Di-N-Octylgenistein sensitive Low Ovarian Cancer cell line (SKOV3, OVCAR)
hsa-let-7d Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7d Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7d Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (PC-9)
hsa-let-7d Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375)
hsa-let-7d Osimertinib 71496458 NSC779217 approved sensitive Low Non-Small Cell Lung Cancer cell line (H1975)
hsa-let-7d Doxorubicin 31703 NSC123127 approved sensitive cell line (W1)
hsa-let-7d Vincristine 5978 approved sensitive cell line (W1)
hsa-let-7d Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-let-7d Methotrexate 126941 NSC740 approved sensitive cell line (HT29)
hsa-let-7d Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7d Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-let-7d Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-let-7d Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR200)
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7d Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-let-7d Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-let-7d-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7d-5p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-let-7d-5p Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-let-7d-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7d-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-let-7d-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-let-7d-5p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-let-7d-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3, A2780, OVCAR-3, CaOV3)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-let-7d-5p Tivantinib 11494412 NSC758242 sensitive High Breast Cancer cell line (BT-20, BT-474, BT-549, CAMA-1, HCC1143, HCC1395, HCC1569, HCC1806, HCC-1937, HCC1954, HCC202, HCC38, HCC70, Hs578T, MCF-7, MDA-MB-175VII, MDA-MB-231, MDA-MB-361, MDA-MB-415, MDA-MB-436, MDA-MB-468, SKBR3, T47D, UACC812, EVSA-T, MPE-600 , SK-BR-
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-let-7d-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-let-7d-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-let-7d-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-let-7d-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-let-7d-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-let-7d-5p Fluorouracil 3385 NSC19893 approved sensitive cell line (HCT15)
hsa-let-7d-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-let-7d-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-let-7d-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-let-7d-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)

Error report submission