miRTarBase - #MIRT035759


—
pre-miRNA Information
pre-miRNA hsa-mir-2110   
Genomic Coordinates chr10: 114174105 - 114174179
Synonyms hsa-mir-2110, MIR2110
Description Homo sapiens miR-2110 stem-loop
Comment Zhu et al. incorrectly referred to this sequence as mir-1309 in . This sequence is unrelated to MIR1309 in plants.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-2110
Sequence 8| UUGGGGAAACGGCCGCUGAGUG |29
Evidence Experimental
Experiments 454
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31660996 18 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1434681640 4 dbSNP
rs1418383763 6 dbSNP
rs745914474 7 dbSNP
rs1178383827 8 dbSNP
rs1412803607 9 dbSNP
rs114530801 10 dbSNP
rs1168982220 11 dbSNP
rs573692968 14 dbSNP
rs1246581316 15 dbSNP
rs1431021422 16 dbSNP
rs1188283086 17 dbSNP
rs1476834649 19 dbSNP
rs192664871 19 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FASN   
Synonyms FAS, OA-519, SDR27X1
Description fatty acid synthase
Transcript NM_004104   
Expression
Putative miRNA Targets on FASN
3'UTR of FASN
(miRNA target sites are highlighted)		 
>FASN|NM_004104|3'UTR
   1 GCCCGTGCCCCCGCCTGCCACCGGAGGTCACTCCACCATCCCCACCCCACCCCACCCCACCCCCGCCATGCAACGGGATT
  81 GAAGGGTCCTGCCGGTGGGACCCTGTCCGGCCCAGTGCCACTGCCCCCCGAGGCTGCTAGATGTAGGTGTTAGGCATGTC
 161 CCACCCACCCGCCGCCTCCCACGGCACCTCGGGGACACCAGAGCTGCCGACTTGGAGACTCCTGGTCTGTGAAGAGCCGG
 241 TGGTGCCCGTGCCCGCAGGAACTGGGCTGGGCCTCGTGCGCCCGTGGGGTCTGCGCTTGGTCTTTCTGTGCTTGGATTTG
 321 CATATTTATTGCATTGCTGGTAGAGACCCCCAGGCCTGTCCACCCTGCCAAGACTCCTCAGGCAGCGTGTGGGTCCCGCA
 401 CTCTGCCCCCATTTCCCCGATGTCCCCTGCGGGCGCGGGCAGCCACCCAAGCCTGCTGGCTGCGGCCCCCTCTCGGCCAG
 481 GCATTGGCTCAGCCCGCTGAGTGGGGGGTCGTGGGCCAGTCCCCGAGGAGCTGGGCCCCTGCACAGGCACACAGGGCCCG
 561 GCCACACCCAGCGGCCCCCCGCACAGCCACCCGTGGGGTGCTGCCCTTATGCCCGGCGCCGGGCACCAACTCCATGTTTG
 641 GTGTTTGTCTGTGTTTGTTTTTCAAGAAATGATTCAAATTGCTGCTTGGATTTTGAAATTTACTGTAACTGTCAGTGTAC
 721 ACGTCTGGACCCCGTTTCATTTTTACACCAATTTGGTAAAAATGCTGCTCTCAGCCTCCCACAATTAAACCGCATGTGAT
 801 CTCCAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guGAGUCGCCGGCAAAGGGGUu 5'
            ||| ||  || |||||||: 
Target 5' caCTCTGCCCCCATTTCCCCGa 3'
 399 - 420 152.00 -24.50
2 
miRNA  3' gugagucgccggcaaAGGGGUu 5'
                         |||||| 
Target 5' gaggtcactccaccaTCCCCAc 3'
 24 - 45 120.00 -14.10
3 
miRNA  3' gugAGUCGCCGG-CAAAGGGGUu 5'
             ||:  |||| |  |||||: 
Target 5' gggTCGTGGGCCAG--TCCCCGa 3'
 506 - 526 110.00 -20.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26976041 8 COSMIC
COSN30152396 24 COSMIC
COSN31924953 54 COSMIC
COSN22234636 166 COSMIC
COSN7457200 322 COSMIC
COSN1202678 348 COSMIC
COSN30424951 397 COSMIC
COSN19505400 434 COSMIC
COSN26134213 565 COSMIC
COSN8246962 734 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1273814942 3 dbSNP
rs773333204 4 dbSNP
rs748284016 5 dbSNP
rs778960909 8 dbSNP
rs749023152 12 dbSNP
rs779839896 13 dbSNP
rs755866211 14 dbSNP
rs750052743 19 dbSNP
rs763507271 20 dbSNP
rs979329981 22 dbSNP
rs867316847 23 dbSNP
rs1332554523 24 dbSNP
rs780846882 27 dbSNP
rs756739982 33 dbSNP
rs1019471382 34 dbSNP
rs751111992 35 dbSNP
rs765732840 36 dbSNP
rs1006698511 37 dbSNP
rs1225544581 39 dbSNP
rs760233108 39 dbSNP
rs990582072 44 dbSNP
rs1223268119 46 dbSNP
rs960505936 49 dbSNP
rs1034854051 54 dbSNP
rs571724953 58 dbSNP
rs999434509 59 dbSNP
rs1239417506 61 dbSNP
rs1463605192 62 dbSNP
rs1187942234 64 dbSNP
rs1249213966 64 dbSNP
rs1255880268 64 dbSNP
rs1313527236 65 dbSNP
rs889701505 67 dbSNP
rs967067775 68 dbSNP
rs553323714 70 dbSNP
rs976500123 74 dbSNP
rs1227419400 75 dbSNP
rs1350882503 76 dbSNP
rs1365878606 81 dbSNP
rs1048272745 85 dbSNP
rs1310835010 92 dbSNP
rs965111777 93 dbSNP
rs1219580705 94 dbSNP
rs1375518462 96 dbSNP
rs1231557560 97 dbSNP
rs1015189209 101 dbSNP
rs1268894839 105 dbSNP
rs1437775559 107 dbSNP
rs535778972 108 dbSNP
rs1478566132 115 dbSNP
rs1193224735 118 dbSNP
rs1321940866 119 dbSNP
rs1455277652 123 dbSNP
rs1405007515 124 dbSNP
rs1157914396 127 dbSNP
rs1388793574 129 dbSNP
rs1361344455 130 dbSNP
rs949168769 130 dbSNP
rs1160536191 134 dbSNP
rs952597898 135 dbSNP
rs150228661 141 dbSNP
rs11550611 142 dbSNP
rs905048805 143 dbSNP
rs979071986 147 dbSNP
rs1289209020 154 dbSNP
rs947607343 161 dbSNP
rs558553256 166 dbSNP
rs1244788775 168 dbSNP
rs1220485667 169 dbSNP
rs1447225209 170 dbSNP
rs1044864237 171 dbSNP
rs1472455180 172 dbSNP
rs538435546 173 dbSNP
rs867883494 174 dbSNP
rs570913417 178 dbSNP
rs1303455951 182 dbSNP
rs895924299 183 dbSNP
rs1370293595 184 dbSNP
rs552654492 190 dbSNP
rs1273455284 191 dbSNP
rs1436120520 197 dbSNP
rs1053071381 204 dbSNP
rs934680958 205 dbSNP
rs1019669290 209 dbSNP
rs527752293 211 dbSNP
rs866956794 212 dbSNP
rs538723720 213 dbSNP
rs1337702324 218 dbSNP
rs560497774 221 dbSNP
rs1242725425 224 dbSNP
rs932796984 225 dbSNP
rs1357102537 227 dbSNP
rs1248860568 229 dbSNP
rs1418063946 232 dbSNP
rs1273090058 234 dbSNP
rs1360018387 236 dbSNP
rs1176821026 238 dbSNP
rs1027229618 239 dbSNP
rs995461637 248 dbSNP
rs1250824241 249 dbSNP
rs1439154329 251 dbSNP
rs921413662 254 dbSNP
rs1472831958 255 dbSNP
rs1190549255 256 dbSNP
rs1388169143 259 dbSNP
rs1015229874 261 dbSNP
rs1308361774 275 dbSNP
rs976907017 276 dbSNP
rs943750425 280 dbSNP
rs896243004 283 dbSNP
rs908307111 284 dbSNP
rs369282795 289 dbSNP
rs906054177 294 dbSNP
rs1043602966 295 dbSNP
rs1343284244 308 dbSNP
rs569649790 308 dbSNP
rs1198428806 310 dbSNP
rs952452012 314 dbSNP
rs548589236 322 dbSNP
rs1051138 328 dbSNP
rs1314463705 330 dbSNP
rs1277201253 332 dbSNP
rs1219142925 347 dbSNP
rs980742707 349 dbSNP
rs1171026693 351 dbSNP
rs969726052 353 dbSNP
rs988811580 354 dbSNP
rs1280446080 361 dbSNP
rs1464346939 376 dbSNP
rs1024791039 381 dbSNP
rs116196441 383 dbSNP
rs561962447 386 dbSNP
rs1382272057 387 dbSNP
rs543307069 389 dbSNP
rs112727550 396 dbSNP
rs912558275 397 dbSNP
rs576196337 398 dbSNP
rs1436525512 408 dbSNP
rs868386578 418 dbSNP
rs998835998 419 dbSNP
rs985600151 420 dbSNP
rs569737154 425 dbSNP
rs151047127 426 dbSNP
rs1205054289 428 dbSNP
rs932895165 430 dbSNP
rs961296963 431 dbSNP
rs1015426363 432 dbSNP
rs1013213698 434 dbSNP
rs896190736 435 dbSNP
rs900084897 436 dbSNP
rs1041160762 437 dbSNP
rs1168205392 440 dbSNP
rs1001987486 442 dbSNP
rs1157188731 444 dbSNP
rs1388069971 446 dbSNP
rs1043248224 447 dbSNP
rs944245002 448 dbSNP
rs1386583103 462 dbSNP
rs545906214 463 dbSNP
rs375894506 464 dbSNP
rs930961982 474 dbSNP
rs1183232681 475 dbSNP
rs919576263 477 dbSNP
rs1286059868 478 dbSNP
rs111482610 485 dbSNP
rs1215802762 490 dbSNP
rs1236361396 495 dbSNP
rs1487437356 496 dbSNP
rs761463731 500 dbSNP
rs969294554 502 dbSNP
rs1209055739 503 dbSNP
rs535079757 503 dbSNP
rs991987900 504 dbSNP
rs1411422746 505 dbSNP
rs377240677 507 dbSNP
rs1161312827 509 dbSNP
rs1319154528 509 dbSNP
rs956547646 510 dbSNP
rs1031744825 511 dbSNP
rs932767049 515 dbSNP
rs189969201 524 dbSNP
rs1305804729 525 dbSNP
rs1349434701 527 dbSNP
rs1223876226 533 dbSNP
rs1308468953 538 dbSNP
rs1317681066 540 dbSNP
rs1319381027 546 dbSNP
rs904624078 559 dbSNP
rs1292402343 560 dbSNP
rs1490780254 564 dbSNP
rs1021586494 572 dbSNP
rs1377115873 573 dbSNP
rs908376743 574 dbSNP
rs1179133520 575 dbSNP
rs1411786852 575 dbSNP
rs997260718 578 dbSNP
rs900074296 580 dbSNP
rs1447456366 581 dbSNP
rs1428240366 584 dbSNP
rs1402303277 591 dbSNP
rs1041320725 592 dbSNP
rs556824081 593 dbSNP
rs1299512454 594 dbSNP
rs1368818892 595 dbSNP
rs538119431 598 dbSNP
rs1421656992 602 dbSNP
rs1394878289 611 dbSNP
rs1381370322 612 dbSNP
rs1315658107 613 dbSNP
rs887305578 614 dbSNP
rs1225937921 615 dbSNP
rs1047233361 617 dbSNP
rs185555023 618 dbSNP
rs529869483 620 dbSNP
rs771260934 621 dbSNP
rs947749455 623 dbSNP
rs1482971540 624 dbSNP
rs368090386 632 dbSNP
rs992102739 633 dbSNP
rs956619346 634 dbSNP
rs1395386869 651 dbSNP
rs1480537331 655 dbSNP
rs15324 660 dbSNP
rs1420739246 669 dbSNP
rs1411996153 670 dbSNP
rs1357014305 675 dbSNP
rs1468851425 678 dbSNP
rs1266368427 688 dbSNP
rs1336768074 690 dbSNP
rs1384320089 691 dbSNP
rs1432869434 695 dbSNP
rs923746060 701 dbSNP
rs1247293775 702 dbSNP
rs979677778 703 dbSNP
rs968797357 705 dbSNP
rs1276793043 709 dbSNP
rs1311779662 713 dbSNP
rs1053260504 716 dbSNP
rs1265122561 717 dbSNP
rs1314483091 722 dbSNP
rs749848304 723 dbSNP
rs996856514 727 dbSNP
rs1307072269 728 dbSNP
rs964039106 731 dbSNP
rs891344983 732 dbSNP
rs1019811991 733 dbSNP
rs773700111 734 dbSNP
rs1479926960 736 dbSNP
rs1445927911 737 dbSNP
rs1407740178 741 dbSNP
rs1455186857 748 dbSNP
rs887380460 749 dbSNP
rs373098550 753 dbSNP
rs1345658900 757 dbSNP
rs1432667586 758 dbSNP
rs1246400416 762 dbSNP
rs996089174 763 dbSNP
rs1456075174 764 dbSNP
rs920031059 768 dbSNP
rs1327169991 772 dbSNP
rs1348869618 778 dbSNP
rs1285600387 781 dbSNP
rs1449195733 784 dbSNP
rs534320789 791 dbSNP
rs1045238157 792 dbSNP
rs940107038 794 dbSNP
rs1480958571 802 dbSNP
rs111698367 806 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC -0.22 0.06 -0.104 0.23 53 Click to see details
CHOL -0.494 0.16 -0.714 0.06 6 Click to see details
PRAD 0.171 0.16 0.258 0.07 35 Click to see details
KIRP -0.185 0.16 -0.133 0.24 30 Click to see details
ESCA 0.326 0.16 0.445 0.09 11 Click to see details
LIHC 0.133 0.19 0.150 0.16 45 Click to see details
HNSC 0.142 0.19 0.180 0.14 39 Click to see details
UCEC 0.214 0.2 0.174 0.24 18 Click to see details
BLCA 0.234 0.2 0.211 0.23 15 Click to see details
PCPG -0.74 0.23 -0.500 0.33 3 Click to see details
LUAD -0.212 0.25 -0.245 0.22 12 Click to see details
COAD 0.676 0.26 0.500 0.33 3 Click to see details
BRCA -0.08 0.28 -0.020 0.44 58 Click to see details
THCA 0.071 0.3 0.104 0.22 58 Click to see details
KICH -0.095 0.33 -0.029 0.45 24 Click to see details
PAAD 0.456 0.35 0.500 0.33 3 Click to see details
CESC -0.308 0.4 -0.500 0.33 3 Click to see details
STAD 0.03 0.44 0.084 0.33 30 Click to see details
LUSC -0.023 0.45 -0.013 0.47 29 Click to see details
LUSC -0.023 0.45 -0.013 0.47 29 Click to see details
LUSC -0.023 0.45 -0.013 0.47 29 Click to see details
96 hsa-miR-2110 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035757 BRD4 bromodomain containing 4 1 1
MIRT035758 NCOR2 nuclear receptor corepressor 2 1 1
MIRT035759 FASN fatty acid synthase 1 1
MIRT035760 C10orf118 coiled-coil domain containing 186 1 1
MIRT055403 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT066205 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT079365 CCDC137 coiled-coil domain containing 137 2 2
MIRT081180 MIDN midnolin 2 4
MIRT082397 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 2 4
MIRT089000 BCL11A B-cell CLL/lymphoma 11A 2 2
MIRT133706 SKI SKI proto-oncogene 2 4
MIRT160053 TET3 tet methylcytosine dioxygenase 3 2 4
MIRT180853 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT263243 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT285532 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT317152 E2F3 E2F transcription factor 3 2 4
MIRT321166 EIF4H eukaryotic translation initiation factor 4H 2 2
MIRT441482 NCEH1 neutral cholesterol ester hydrolase 1 2 2
MIRT443884 CNKSR3 CNKSR family member 3 2 2
MIRT445877 WBP1L WW domain binding protein 1 like 2 2
MIRT446195 GTPBP4 GTP binding protein 4 2 2
MIRT449308 MRO maestro 2 2
MIRT450301 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT450512 EMX1 empty spiracles homeobox 1 2 2
MIRT451534 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451820 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT452239 TRAM1 translocation associated membrane protein 1 2 2
MIRT454207 HLA-A major histocompatibility complex, class I, A 2 2
MIRT455447 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT456496 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 2 2
MIRT457656 SERINC1 serine incorporator 1 2 2
MIRT459819 TPP1 tripeptidyl peptidase 1 2 2
MIRT460556 FEM1A fem-1 homolog A 2 2
MIRT462561 STS steroid sulfatase 2 2
MIRT462986 ZNF740 zinc finger protein 740 2 2
MIRT464671 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465432 TP53 tumor protein p53 2 2
MIRT465934 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466015 TMEM189 transmembrane protein 189 2 2
MIRT468122 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT469652 RAC1 Rac family small GTPase 1 2 2
MIRT469980 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT473531 MAX MYC associated factor X 2 2
MIRT473596 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT473652 MARCKSL1 MARCKS like 1 2 2
MIRT474219 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT474771 KIAA0895L KIAA0895 like 2 2
MIRT479312 VPS72 vacuolar protein sorting 72 homolog 2 2
MIRT481121 AZIN1 antizyme inhibitor 1 2 4
MIRT481682 AR androgen receptor 2 2
MIRT482381 AEN apoptosis enhancing nuclease 2 2
MIRT483833 UNC5B unc-5 netrin receptor B 2 4
MIRT484693 RNF11 ring finger protein 11 2 2
MIRT485238 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT488748 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT489147 MRPL12 mitochondrial ribosomal protein L12 2 4
MIRT489518 MRE11A MRE11 homolog, double strand break repair nuclease 2 8
MIRT498908 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT506426 NAGK N-acetylglucosamine kinase 2 6
MIRT506640 MAPK1 mitogen-activated protein kinase 1 2 4
MIRT507332 FAM168A family with sequence similarity 168 member A 2 2
MIRT513099 DYNAP dynactin associated protein 2 2
MIRT513514 YIPF4 Yip1 domain family member 4 2 6
MIRT521800 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT525078 FRK fyn related Src family tyrosine kinase 2 2
MIRT530927 SCIN scinderin 2 2
MIRT533498 TRIM71 tripartite motif containing 71 2 2
MIRT536787 HNRNPD heterogeneous nuclear ribonucleoprotein D 2 2
MIRT544554 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT552977 VAT1 vesicle amine transport 1 2 2
MIRT557358 HAND1 heart and neural crest derivatives expressed 1 2 2
MIRT560401 TMEM69 transmembrane protein 69 2 2
MIRT565498 SP1 Sp1 transcription factor 2 2
MIRT568962 CACNA1C calcium voltage-gated channel subunit alpha1 C 2 2
MIRT569031 IL21R interleukin 21 receptor 2 2
MIRT573224 TRIM21 tripartite motif containing 21 2 2
MIRT574312 ZNF703 zinc finger protein 703 2 2
MIRT620395 MYO1H myosin IH 2 2
MIRT620936 OSMR oncostatin M receptor 2 2
MIRT638166 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT647743 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT649991 MSI1 musashi RNA binding protein 1 2 2
MIRT669203 CBX8 chromobox 8 2 2
MIRT684546 ZNF708 zinc finger protein 708 2 2
MIRT685837 ANGEL1 angel homolog 1 2 2
MIRT688547 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT693252 HBS1L HBS1 like translational GTPase 2 2
MIRT701970 MIER3 MIER family member 3 2 2
MIRT706385 MC2R melanocortin 2 receptor 2 2
MIRT707484 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT711882 INSIG2 insulin induced gene 2 2 2
MIRT716906 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT717638 HLX H2.0 like homeobox 2 2
MIRT719058 ZNF281 zinc finger protein 281 2 2
MIRT723754 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 2
MIRT725479 GPR26 G protein-coupled receptor 26 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2110 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901)
hsa-miR-2110 Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-2110 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-mir-2110 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-2110 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-2110 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-2110 Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-2110 Vincristine 5978 approved sensitive cell line (W1)
hsa-mir-2110 Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-2110 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-mir-2110 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-2110 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-2110 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-2110 Cisplatin 5460033 NSC119875 approved resistant cell line (SGC-7901)
hsa-miR-2110 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-2110 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-2110 Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-2110 Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-2110 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-2110 Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-2110 Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-2110 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-2110 Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-2110 Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-2110 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2110 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-2110 Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)
hsa-miR-2110 Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission