miRTarBase - #MIRT035847


—
pre-miRNA Information
pre-miRNA hsa-mir-1268a   
Genomic Coordinates chr15: 22225278 - 22225329
Description Homo sapiens miR-1268a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1268a
Sequence 5| CGGGCGUGGUGGUGGGGG |22
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs369807489 1 dbSNP
rs537950017 2 dbSNP
rs1442921203 4 dbSNP
rs1242314811 5 dbSNP
rs28599926 6 dbSNP
rs931410682 7 dbSNP
rs1360584039 10 dbSNP
rs1245652939 12 dbSNP
rs1321701831 14 dbSNP
rs1260292644 16 dbSNP
rs879525551 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FASN   
Synonyms FAS, OA-519, SDR27X1
Description fatty acid synthase
Transcript NM_004104   
Expression
Putative miRNA Targets on FASN
3'UTR of FASN
(miRNA target sites are highlighted)		 
>FASN|NM_004104|3'UTR
   1 GCCCGTGCCCCCGCCTGCCACCGGAGGTCACTCCACCATCCCCACCCCACCCCACCCCACCCCCGCCATGCAACGGGATT
  81 GAAGGGTCCTGCCGGTGGGACCCTGTCCGGCCCAGTGCCACTGCCCCCCGAGGCTGCTAGATGTAGGTGTTAGGCATGTC
 161 CCACCCACCCGCCGCCTCCCACGGCACCTCGGGGACACCAGAGCTGCCGACTTGGAGACTCCTGGTCTGTGAAGAGCCGG
 241 TGGTGCCCGTGCCCGCAGGAACTGGGCTGGGCCTCGTGCGCCCGTGGGGTCTGCGCTTGGTCTTTCTGTGCTTGGATTTG
 321 CATATTTATTGCATTGCTGGTAGAGACCCCCAGGCCTGTCCACCCTGCCAAGACTCCTCAGGCAGCGTGTGGGTCCCGCA
 401 CTCTGCCCCCATTTCCCCGATGTCCCCTGCGGGCGCGGGCAGCCACCCAAGCCTGCTGGCTGCGGCCCCCTCTCGGCCAG
 481 GCATTGGCTCAGCCCGCTGAGTGGGGGGTCGTGGGCCAGTCCCCGAGGAGCTGGGCCCCTGCACAGGCACACAGGGCCCG
 561 GCCACACCCAGCGGCCCCCCGCACAGCCACCCGTGGGGTGCTGCCCTTATGCCCGGCGCCGGGCACCAACTCCATGTTTG
 641 GTGTTTGTCTGTGTTTGTTTTTCAAGAAATGATTCAAATTGCTGCTTGGATTTTGAAATTTACTGTAACTGTCAGTGTAC
 721 ACGTCTGGACCCCGTTTCATTTTTACACCAATTTGGTAAAAATGCTGCTCTCAGCCTCCCACAATTAAACCGCATGTGAT
 801 CTCCAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggGGGUGGUGGUGCGGGc 5'
            |||||| |||| ||| 
Target 5' acCCCACC-CCACCCCCg 3'
 49 - 65 135.00 -31.50
2 
miRNA  3' ggGGGUGGUGGUG-CGGGc 5'
            |||| ::|||| |||| 
Target 5' ggCCCAGTGCCACTGCCCc 3'
 109 - 127 132.00 -21.70
3 
miRNA  3' gggGGUGGUGGUGCGGGc 5'
             |::|| ::|:|||| 
Target 5' gtgCTGCCCTTATGCCCg 3'
 598 - 615 123.00 -21.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26976041 8 COSMIC
COSN30152396 24 COSMIC
COSN31924953 54 COSMIC
COSN22234636 166 COSMIC
COSN7457200 322 COSMIC
COSN1202678 348 COSMIC
COSN30424951 397 COSMIC
COSN19505400 434 COSMIC
COSN26134213 565 COSMIC
COSN8246962 734 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1273814942 3 dbSNP
rs773333204 4 dbSNP
rs748284016 5 dbSNP
rs778960909 8 dbSNP
rs749023152 12 dbSNP
rs779839896 13 dbSNP
rs755866211 14 dbSNP
rs750052743 19 dbSNP
rs763507271 20 dbSNP
rs979329981 22 dbSNP
rs867316847 23 dbSNP
rs1332554523 24 dbSNP
rs780846882 27 dbSNP
rs756739982 33 dbSNP
rs1019471382 34 dbSNP
rs751111992 35 dbSNP
rs765732840 36 dbSNP
rs1006698511 37 dbSNP
rs1225544581 39 dbSNP
rs760233108 39 dbSNP
rs990582072 44 dbSNP
rs1223268119 46 dbSNP
rs960505936 49 dbSNP
rs1034854051 54 dbSNP
rs571724953 58 dbSNP
rs999434509 59 dbSNP
rs1239417506 61 dbSNP
rs1463605192 62 dbSNP
rs1187942234 64 dbSNP
rs1249213966 64 dbSNP
rs1255880268 64 dbSNP
rs1313527236 65 dbSNP
rs889701505 67 dbSNP
rs967067775 68 dbSNP
rs553323714 70 dbSNP
rs976500123 74 dbSNP
rs1227419400 75 dbSNP
rs1350882503 76 dbSNP
rs1365878606 81 dbSNP
rs1048272745 85 dbSNP
rs1310835010 92 dbSNP
rs965111777 93 dbSNP
rs1219580705 94 dbSNP
rs1375518462 96 dbSNP
rs1231557560 97 dbSNP
rs1015189209 101 dbSNP
rs1268894839 105 dbSNP
rs1437775559 107 dbSNP
rs535778972 108 dbSNP
rs1478566132 115 dbSNP
rs1193224735 118 dbSNP
rs1321940866 119 dbSNP
rs1455277652 123 dbSNP
rs1405007515 124 dbSNP
rs1157914396 127 dbSNP
rs1388793574 129 dbSNP
rs1361344455 130 dbSNP
rs949168769 130 dbSNP
rs1160536191 134 dbSNP
rs952597898 135 dbSNP
rs150228661 141 dbSNP
rs11550611 142 dbSNP
rs905048805 143 dbSNP
rs979071986 147 dbSNP
rs1289209020 154 dbSNP
rs947607343 161 dbSNP
rs558553256 166 dbSNP
rs1244788775 168 dbSNP
rs1220485667 169 dbSNP
rs1447225209 170 dbSNP
rs1044864237 171 dbSNP
rs1472455180 172 dbSNP
rs538435546 173 dbSNP
rs867883494 174 dbSNP
rs570913417 178 dbSNP
rs1303455951 182 dbSNP
rs895924299 183 dbSNP
rs1370293595 184 dbSNP
rs552654492 190 dbSNP
rs1273455284 191 dbSNP
rs1436120520 197 dbSNP
rs1053071381 204 dbSNP
rs934680958 205 dbSNP
rs1019669290 209 dbSNP
rs527752293 211 dbSNP
rs866956794 212 dbSNP
rs538723720 213 dbSNP
rs1337702324 218 dbSNP
rs560497774 221 dbSNP
rs1242725425 224 dbSNP
rs932796984 225 dbSNP
rs1357102537 227 dbSNP
rs1248860568 229 dbSNP
rs1418063946 232 dbSNP
rs1273090058 234 dbSNP
rs1360018387 236 dbSNP
rs1176821026 238 dbSNP
rs1027229618 239 dbSNP
rs995461637 248 dbSNP
rs1250824241 249 dbSNP
rs1439154329 251 dbSNP
rs921413662 254 dbSNP
rs1472831958 255 dbSNP
rs1190549255 256 dbSNP
rs1388169143 259 dbSNP
rs1015229874 261 dbSNP
rs1308361774 275 dbSNP
rs976907017 276 dbSNP
rs943750425 280 dbSNP
rs896243004 283 dbSNP
rs908307111 284 dbSNP
rs369282795 289 dbSNP
rs906054177 294 dbSNP
rs1043602966 295 dbSNP
rs1343284244 308 dbSNP
rs569649790 308 dbSNP
rs1198428806 310 dbSNP
rs952452012 314 dbSNP
rs548589236 322 dbSNP
rs1051138 328 dbSNP
rs1314463705 330 dbSNP
rs1277201253 332 dbSNP
rs1219142925 347 dbSNP
rs980742707 349 dbSNP
rs1171026693 351 dbSNP
rs969726052 353 dbSNP
rs988811580 354 dbSNP
rs1280446080 361 dbSNP
rs1464346939 376 dbSNP
rs1024791039 381 dbSNP
rs116196441 383 dbSNP
rs561962447 386 dbSNP
rs1382272057 387 dbSNP
rs543307069 389 dbSNP
rs112727550 396 dbSNP
rs912558275 397 dbSNP
rs576196337 398 dbSNP
rs1436525512 408 dbSNP
rs868386578 418 dbSNP
rs998835998 419 dbSNP
rs985600151 420 dbSNP
rs569737154 425 dbSNP
rs151047127 426 dbSNP
rs1205054289 428 dbSNP
rs932895165 430 dbSNP
rs961296963 431 dbSNP
rs1015426363 432 dbSNP
rs1013213698 434 dbSNP
rs896190736 435 dbSNP
rs900084897 436 dbSNP
rs1041160762 437 dbSNP
rs1168205392 440 dbSNP
rs1001987486 442 dbSNP
rs1157188731 444 dbSNP
rs1388069971 446 dbSNP
rs1043248224 447 dbSNP
rs944245002 448 dbSNP
rs1386583103 462 dbSNP
rs545906214 463 dbSNP
rs375894506 464 dbSNP
rs930961982 474 dbSNP
rs1183232681 475 dbSNP
rs919576263 477 dbSNP
rs1286059868 478 dbSNP
rs111482610 485 dbSNP
rs1215802762 490 dbSNP
rs1236361396 495 dbSNP
rs1487437356 496 dbSNP
rs761463731 500 dbSNP
rs969294554 502 dbSNP
rs1209055739 503 dbSNP
rs535079757 503 dbSNP
rs991987900 504 dbSNP
rs1411422746 505 dbSNP
rs377240677 507 dbSNP
rs1161312827 509 dbSNP
rs1319154528 509 dbSNP
rs956547646 510 dbSNP
rs1031744825 511 dbSNP
rs932767049 515 dbSNP
rs189969201 524 dbSNP
rs1305804729 525 dbSNP
rs1349434701 527 dbSNP
rs1223876226 533 dbSNP
rs1308468953 538 dbSNP
rs1317681066 540 dbSNP
rs1319381027 546 dbSNP
rs904624078 559 dbSNP
rs1292402343 560 dbSNP
rs1490780254 564 dbSNP
rs1021586494 572 dbSNP
rs1377115873 573 dbSNP
rs908376743 574 dbSNP
rs1179133520 575 dbSNP
rs1411786852 575 dbSNP
rs997260718 578 dbSNP
rs900074296 580 dbSNP
rs1447456366 581 dbSNP
rs1428240366 584 dbSNP
rs1402303277 591 dbSNP
rs1041320725 592 dbSNP
rs556824081 593 dbSNP
rs1299512454 594 dbSNP
rs1368818892 595 dbSNP
rs538119431 598 dbSNP
rs1421656992 602 dbSNP
rs1394878289 611 dbSNP
rs1381370322 612 dbSNP
rs1315658107 613 dbSNP
rs887305578 614 dbSNP
rs1225937921 615 dbSNP
rs1047233361 617 dbSNP
rs185555023 618 dbSNP
rs529869483 620 dbSNP
rs771260934 621 dbSNP
rs947749455 623 dbSNP
rs1482971540 624 dbSNP
rs368090386 632 dbSNP
rs992102739 633 dbSNP
rs956619346 634 dbSNP
rs1395386869 651 dbSNP
rs1480537331 655 dbSNP
rs15324 660 dbSNP
rs1420739246 669 dbSNP
rs1411996153 670 dbSNP
rs1357014305 675 dbSNP
rs1468851425 678 dbSNP
rs1266368427 688 dbSNP
rs1336768074 690 dbSNP
rs1384320089 691 dbSNP
rs1432869434 695 dbSNP
rs923746060 701 dbSNP
rs1247293775 702 dbSNP
rs979677778 703 dbSNP
rs968797357 705 dbSNP
rs1276793043 709 dbSNP
rs1311779662 713 dbSNP
rs1053260504 716 dbSNP
rs1265122561 717 dbSNP
rs1314483091 722 dbSNP
rs749848304 723 dbSNP
rs996856514 727 dbSNP
rs1307072269 728 dbSNP
rs964039106 731 dbSNP
rs891344983 732 dbSNP
rs1019811991 733 dbSNP
rs773700111 734 dbSNP
rs1479926960 736 dbSNP
rs1445927911 737 dbSNP
rs1407740178 741 dbSNP
rs1455186857 748 dbSNP
rs887380460 749 dbSNP
rs373098550 753 dbSNP
rs1345658900 757 dbSNP
rs1432667586 758 dbSNP
rs1246400416 762 dbSNP
rs996089174 763 dbSNP
rs1456075174 764 dbSNP
rs920031059 768 dbSNP
rs1327169991 772 dbSNP
rs1348869618 778 dbSNP
rs1285600387 781 dbSNP
rs1449195733 784 dbSNP
rs534320789 791 dbSNP
rs1045238157 792 dbSNP
rs940107038 794 dbSNP
rs1480958571 802 dbSNP
rs111698367 806 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggggGUGGUGGUGCGGgc 5'
              | |: || ||||  
Target 5' ----CTCTTCCCCGCCac 3'
 		1 - 14
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
44 hsa-miR-1268a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035845 POLR2I RNA polymerase II subunit I 1 1
MIRT035847 FASN fatty acid synthase 1 1
MIRT053736 SOX12 SRY-box 12 1 1
MIRT053737 CAMK2G calcium/calmodulin dependent protein kinase II gamma 1 1
MIRT473717 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT483654 QSOX2 quiescin sulfhydryl oxidase 2 2 4
MIRT484277 AIP aryl hydrocarbon receptor interacting protein 2 4
MIRT486674 WDR81 WD repeat domain 81 2 2
MIRT488672 WWP2 WW domain containing E3 ubiquitin protein ligase 2 2 4
MIRT493453 ITFG3 family with sequence similarity 234 member A 2 2
MIRT495902 ZNF641 zinc finger protein 641 2 2
MIRT500188 BARX1 BARX homeobox 1 2 4
MIRT512015 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT521134 SGPL1 sphingosine-1-phosphate lyase 1 2 4
MIRT530047 TRIM72 tripartite motif containing 72 2 2
MIRT531519 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT543736 DHCR7 7-dehydrocholesterol reductase 2 2
MIRT558054 EVI5L ecotropic viral integration site 5 like 2 2
MIRT569603 TRIM29 tripartite motif containing 29 2 2
MIRT570027 FAM228A family with sequence similarity 228 member A 2 2
MIRT573595 CERS1 ceramide synthase 1 2 2
MIRT623884 FRMPD4 FERM and PDZ domain containing 4 2 2
MIRT630000 PDE6B phosphodiesterase 6B 2 2
MIRT632716 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT633497 ERO1L endoplasmic reticulum oxidoreductase 1 alpha 1 1
MIRT637076 SELPLG selectin P ligand 2 2
MIRT638183 TLN1 talin 1 2 2
MIRT638767 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT668073 GMPS guanine monophosphate synthase 2 2
MIRT669874 RAET1E retinoic acid early transcript 1E 2 2
MIRT670664 KIAA1551 KIAA1551 2 2
MIRT671283 RPL37A ribosomal protein L37a 2 2
MIRT675055 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT682784 BLOC1S3 biogenesis of lysosomal organelles complex 1 subunit 3 2 2
MIRT683344 SCARF1 scavenger receptor class F member 1 2 2
MIRT690283 ZNF154 zinc finger protein 154 2 2
MIRT695172 SLC25A33 solute carrier family 25 member 33 2 2
MIRT695222 SCAMP3 secretory carrier membrane protein 3 2 2
MIRT700485 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT700601 PRKCA protein kinase C alpha 2 2
MIRT701410 NKRF NFKB repressing factor 2 2
MIRT703995 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT711232 RETSAT retinol saturase 2 2
MIRT719510 TMEM175 transmembrane protein 175 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1268a Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1268a Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-1268a Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1268a Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1268a Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor tissue
hsa-miR-1268a Fluorouracil 3385 NSC19893 approved resistant High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1268a Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-1268a Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PATU8988)
hsa-miR-1268a Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1268a Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1268a Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U87, LN229)
hsa-miR-1268a Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (2uM)
hsa-miR-1268a Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (2uM)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma cell line (CAL-27, SCC-9)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved resistant High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved sensitive High Breast Cancer cell line (BCap37)
hsa-miR-1268a Doxorubicin 31703 NSC123127 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1268a Etoposide 36462 NSC141540 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1268a Vinorelbine 44424639 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1268a Vincristine 5978 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-mir-1268a Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-1268a Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-1268a Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-1268a Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-1268a Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-1268a Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-1268a Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-1268a Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-1268a Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1268a Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1268a Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine sensitive cell line (Bats-72)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved resistant cell line (MDAH-2774)

Error report submission