miRTarBase - #MIRT035885


—
pre-miRNA Information
pre-miRNA hsa-mir-1303   
Genomic Coordinates chr5: 154685776 - 154685861
Synonyms MIRN1303, hsa-mir-1303, MIR1303
Description Homo sapiens miR-1303 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1303
Sequence 52| UUUAGAGACGGGGUCUUGCUCU |73
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 5 + 154685830 23291724, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs370437195 6 dbSNP
rs1195001383 7 dbSNP
rs546614687 8 dbSNP
rs762579883 9 dbSNP
rs766041486 10 dbSNP
rs751079975 12 dbSNP
rs888516744 13 dbSNP
rs566454487 14 dbSNP
rs766973220 15 dbSNP
rs1474274822 17 dbSNP
rs753222192 18 dbSNP
rs1230907999 19 dbSNP
rs756552638 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GEMIN5   
Synonyms GEMIN-5
Description gem nuclear organelle associated protein 5
Transcript NM_015465   
Expression
Putative miRNA Targets on GEMIN5
3'UTR of GEMIN5
(miRNA target sites are highlighted)		 
>GEMIN5|NM_015465|3'UTR
   1 ATTTTCACACACCTTGAAGAAACTGCCAAATTGAAAATGTTTGACATCTTTCACCTCTGCAGTTATGCCTCACCAGACAT
  81 TCACTCTGGTCCCTAGATGTTTTTGCAGTAATCCAAAAGAATACAAACAAGGATTAAGTTTGAATCAACCCTGCCTACCC
 161 ATAGACAACGGTGGATCTGACTTTAGACTCAATTGTGGTCTCCTACTGGAGGGAAGATCATGAAAAGCCCACAGTAGTTA
 241 TTCAGAACTAACACCTGCAGAGTGTTGGTCATCTCTACAGCCTTAGGCAGGTTTCACCCAAAGAGGAGAAACTTCTGTCG
 321 TCACCCAAAGTGTTACATGCTTAAAACACAAGCTACCTTTGTAAATACTTCATCTGATCAGAAGTGTGTCATGCTTGTTT
 401 GAGATGGAGTTGCTGCATTTTAGGACTATTGATACCTTTTTTTAATTGTTTTTATAATATTTAATTTGAAAGAGGAGACC
 481 CTTCTCTCTCTACTCTTTCATAGACTGAAGTTTGAATATGAAATAGGCCTTAACCATCATGTTGACTCTCCTGTCAGAAT
 561 TTTAGGTTGGAAATTTGGTTTTATTCTTTCATGTAATTGCTTATTTGAACAGATCACTTACTAAAGCTTTAGAAGAAGTG
 641 ATTCAAATGTGTGTTTTCCCTTCAGTTTTATAACAAATGGATTGATGGCAGTCAAATAGCTCAGGAATAAATTACTGTTT
 721 CAATGGTTCTTAAACTTTCTTGGATCATAGGATCCTTTTGAGAATCAGATTAAAGCCAAAGATACTCTTTGGAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucUCGUUCUGG---GGCAGAGAUuu 5'
            || :|||||   |: ||||||  
Target 5' agAG-GAGACCCTTCTCTCTCTAct 3'
 471 - 494 139.00 -19.73
2 
miRNA  3' ucuCGU-UC-UGG--GGCAGAGAUuu 5'
             ||| || :::  :| ||||||  
Target 5' cctGCAGAGTGTTGGTCATCTCTAca 3'
 254 - 279 125.00 -11.50
3 
miRNA  3' ucUCGUUCUGGGGCAGAGAUUu 5'
            | ::| |||:: |:|:||| 
Target 5' ctATTGATACCTT-TTTTTAAt 3'
 426 - 446 123.00 -5.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30158601 13 COSMIC
COSN31541656 19 COSMIC
COSN30484505 22 COSMIC
COSN30463467 55 COSMIC
COSN30552422 68 COSMIC
COSN30179486 78 COSMIC
COSN30100468 85 COSMIC
COSN30100164 86 COSMIC
COSN9929552 614 COSMIC
COSN5158886 705 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1316891551 9 dbSNP
rs757964433 13 dbSNP
rs1225033876 22 dbSNP
rs1342786831 25 dbSNP
rs750074141 36 dbSNP
rs764876926 37 dbSNP
rs1292592160 45 dbSNP
rs1402638124 47 dbSNP
rs761540653 48 dbSNP
rs1034356562 52 dbSNP
rs1279017806 53 dbSNP
rs1283995389 54 dbSNP
rs181296339 61 dbSNP
rs1440731650 63 dbSNP
rs1229897109 66 dbSNP
rs1001087242 77 dbSNP
rs758023849 79 dbSNP
rs544865749 85 dbSNP
rs1283917125 86 dbSNP
rs1042614311 88 dbSNP
rs1327937479 92 dbSNP
rs994326789 93 dbSNP
rs572685976 97 dbSNP
rs1280569464 103 dbSNP
rs375493611 113 dbSNP
rs559119477 114 dbSNP
rs962372979 122 dbSNP
rs1404910493 123 dbSNP
rs1040123690 139 dbSNP
rs943041242 160 dbSNP
rs1173748050 165 dbSNP
rs910185185 169 dbSNP
rs542497206 170 dbSNP
rs1469631348 172 dbSNP
rs1176094508 181 dbSNP
rs138770378 182 dbSNP
rs1404917160 189 dbSNP
rs1413313225 190 dbSNP
rs919165420 192 dbSNP
rs1371633987 194 dbSNP
rs1239082441 198 dbSNP
rs1305735912 199 dbSNP
rs971898952 200 dbSNP
rs1184006812 205 dbSNP
rs1276131984 227 dbSNP
rs1460655151 231 dbSNP
rs1261510243 232 dbSNP
rs1342761865 234 dbSNP
rs971182603 236 dbSNP
rs1025030141 243 dbSNP
rs1275065348 247 dbSNP
rs1483878846 252 dbSNP
rs1202762794 258 dbSNP
rs891981128 266 dbSNP
rs1437486533 282 dbSNP
rs1053167799 291 dbSNP
rs1379485699 293 dbSNP
rs1477325128 303 dbSNP
rs1317737864 305 dbSNP
rs1173625543 309 dbSNP
rs992223122 319 dbSNP
rs752233341 320 dbSNP
rs1167139937 328 dbSNP
rs1395263880 336 dbSNP
rs1387045462 342 dbSNP
rs1324922278 347 dbSNP
rs1328906704 349 dbSNP
rs936089739 353 dbSNP
rs1033726137 355 dbSNP
rs904514373 356 dbSNP
rs1044829902 359 dbSNP
rs1338945596 368 dbSNP
rs1452392183 372 dbSNP
rs1210735392 398 dbSNP
rs1269544152 405 dbSNP
rs1449879804 417 dbSNP
rs1381118638 426 dbSNP
rs1322967608 431 dbSNP
rs1432511575 432 dbSNP
rs1345395201 435 dbSNP
rs547246177 438 dbSNP
rs1001267867 443 dbSNP
rs947933085 444 dbSNP
rs1372911377 451 dbSNP
rs15287 456 dbSNP
rs1458081495 457 dbSNP
rs1164579026 458 dbSNP
rs1388133387 475 dbSNP
rs1398413424 480 dbSNP
rs7328 482 dbSNP
rs992096107 486 dbSNP
rs1367240390 490 dbSNP
rs369608147 492 dbSNP
rs1294577933 493 dbSNP
rs918424970 498 dbSNP
rs972502110 504 dbSNP
rs1267386789 507 dbSNP
rs1009757090 516 dbSNP
rs753466973 518 dbSNP
rs1213100051 523 dbSNP
rs1241112330 525 dbSNP
rs1268905819 534 dbSNP
rs1016583228 539 dbSNP
rs985122404 544 dbSNP
rs1424689023 567 dbSNP
rs1190081973 569 dbSNP
rs1366299642 583 dbSNP
rs1190232872 592 dbSNP
rs1474704461 600 dbSNP
rs577529819 607 dbSNP
rs953728043 610 dbSNP
rs780433690 611 dbSNP
rs1040153093 615 dbSNP
rs1046337 616 dbSNP
rs998393645 617 dbSNP
rs116322096 633 dbSNP
rs1397520186 639 dbSNP
rs1310344377 642 dbSNP
rs888858722 647 dbSNP
rs1323523069 649 dbSNP
rs1289067206 657 dbSNP
rs1048752245 664 dbSNP
rs1292579148 665 dbSNP
rs1000282536 668 dbSNP
rs77761603 670 dbSNP
rs1044388597 674 dbSNP
rs1202522580 683 dbSNP
rs919197988 690 dbSNP
rs1254560734 694 dbSNP
rs948670417 695 dbSNP
rs1182522683 697 dbSNP
rs1413732500 699 dbSNP
rs971928581 714 dbSNP
rs189354930 723 dbSNP
rs1056363114 725 dbSNP
rs184416875 729 dbSNP
rs1374697255 739 dbSNP
rs918424409 740 dbSNP
rs1308790785 747 dbSNP
rs1352594712 756 dbSNP
rs1222092813 761 dbSNP
rs1306447520 769 dbSNP
rs991730728 784 dbSNP
rs1236155117 788 dbSNP
rs959519006 790 dbSNP
rs760982824 800 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucUCGUUCUGGGG--CAGAGAUUu 5'
            ||||  :|||:  ||||| |: 
Target 5' agAGCA--GCCCTGAGTCTCCAGt 3'
 		3 - 24
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.518 5.7e-3 0.578 1.9e-3 23 Click to see details
GSE28260 Renal cortex and medulla 0.606 1.4e-2 0.747 1.7e-3 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.323 5.8e-2 0.228 1.4e-1 25 Click to see details
GSE28544 Breast cancer 0.184 1.9e-1 0.172 2.1e-1 24 Click to see details
GSE32688 Pancreatic cancer 0.14 2.2e-1 0.248 8.6e-2 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.157 2.3e-1 -0.177 2.0e-1 24 Click to see details
GSE38226 Liver fibrosis 0.157 2.5e-1 0.260 1.3e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
186 hsa-miR-1303 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035871 SOAT1 sterol O-acyltransferase 1 1 1
MIRT035872 FHOD3 formin homology 2 domain containing 3 1 1
MIRT035873 RPL7A ribosomal protein L7a 1 1
MIRT035874 NCAPD2 non-SMC condensin I complex subunit D2 1 1
MIRT035875 RPS8 ribosomal protein S8 1 1
MIRT035876 AHNAK AHNAK nucleoprotein 1 1
MIRT035877 ACTB actin beta 1 1
MIRT035878 DEF8 differentially expressed in FDCP 8 homolog 1 1
MIRT035879 MET MET proto-oncogene, receptor tyrosine kinase 1 1
MIRT035880 MED13 mediator complex subunit 13 1 1
MIRT035881 FAT3 FAT atypical cadherin 3 1 1
MIRT035882 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT035883 RPS16 ribosomal protein S16 1 1
MIRT035884 CDK6 cyclin dependent kinase 6 1 1
MIRT035885 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT035886 PITRM1 pitrilysin metallopeptidase 1 1 1
MIRT035887 PRRC2A proline rich coiled-coil 2A 1 1
MIRT035888 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT035889 MLLT6 MLLT6, PHD finger containing 1 1
MIRT035890 EIF3I eukaryotic translation initiation factor 3 subunit I 1 1
MIRT035891 FASN fatty acid synthase 1 1
MIRT035892 LEPREL4 prolyl 3-hydroxylase family member 4 (non-enzymatic) 1 1
MIRT035893 HSCB HscB mitochondrial iron-sulfur cluster cochaperone 1 1
MIRT035894 PSME4 proteasome activator subunit 4 1 1
MIRT035895 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT035896 ZNF264 zinc finger protein 264 1 1
MIRT035897 HYLS1 HYLS1, centriolar and ciliogenesis associated 1 1
MIRT035898 USP54 ubiquitin specific peptidase 54 1 1
MIRT035899 L1TD1 LINE1 type transposase domain containing 1 1 1
MIRT035900 OR51E2 olfactory receptor family 51 subfamily E member 2 1 1
MIRT053762 CLDN18 claudin 18 3 1
MIRT060730 RPS3 ribosomal protein S3 2 2
MIRT083986 RAB22A RAB22A, member RAS oncogene family 2 2
MIRT098550 TBPL1 TATA-box binding protein like 1 2 6
MIRT134983 TWF1 twinfilin actin binding protein 1 2 4
MIRT136956 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT222065 PURB purine rich element binding protein B 2 2
MIRT239574 UBN2 ubinuclein 2 2 4
MIRT261820 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT264698 C11ORF57 chromosome 11 open reading frame 57 2 4
MIRT308476 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT377481 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT442304 NEU3 neuraminidase 3 2 2
MIRT446083 SLC30A10 solute carrier family 30 member 10 2 2
MIRT449606 PRPF4 pre-mRNA processing factor 4 2 2
MIRT453767 NUCB1 nucleobindin 1 2 10
MIRT455603 SRSF3 serine and arginine rich splicing factor 3 2 2
MIRT455913 KIF2C kinesin family member 2C 2 2
MIRT460091 ZYG11B zyg-11 family member B, cell cycle regulator 2 4
MIRT460866 UBE2S ubiquitin conjugating enzyme E2 S 2 2
MIRT461339 NUP133 nucleoporin 133 2 2
MIRT463769 YOD1 YOD1 deubiquitinase 2 2
MIRT466368 THAP1 THAP domain containing 1 2 4
MIRT467168 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT468703 SDHD succinate dehydrogenase complex subunit D 2 2
MIRT469122 RNF126 ring finger protein 126 2 2
MIRT472426 NCBP2 nuclear cap binding protein subunit 2 2 4
MIRT479420 CDKN1B cyclin dependent kinase inhibitor 1B 2 8
MIRT484260 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT485468 IL6ST interleukin 6 signal transducer 2 10
MIRT490237 H2AFZ H2A histone family member Z 2 6
MIRT491002 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT492127 SUMO2 small ubiquitin-like modifier 2 2 2
MIRT499169 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT499825 PCSK9 proprotein convertase subtilisin/kexin type 9 2 8
MIRT501794 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT503441 GINS4 GINS complex subunit 4 2 4
MIRT503688 MAVS mitochondrial antiviral signaling protein 2 5
MIRT506926 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT511430 HOXA10 homeobox A10 2 6
MIRT512415 LAYN layilin 2 4
MIRT513791 NIPAL3 NIPA like domain containing 3 2 4
MIRT516163 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 2 4
MIRT516513 PARK2 parkin RBR E3 ubiquitin protein ligase 2 2
MIRT516915 HINFP histone H4 transcription factor 2 2
MIRT517102 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT517350 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT518019 ABHD15 abhydrolase domain containing 15 2 2
MIRT520945 SRSF10 serine and arginine rich splicing factor 10 2 2
MIRT525250 RNF213 ring finger protein 213 2 2
MIRT530634 PPIC peptidylprolyl isomerase C 2 4
MIRT530671 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531563 ILDR1 immunoglobulin like domain containing receptor 1 2 2
MIRT538205 CYR61 cysteine rich angiogenic inducer 61 2 2
MIRT538419 COLEC10 collectin subfamily member 10 2 2
MIRT541964 ZNF485 zinc finger protein 485 2 2
MIRT543088 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT543257 ZNF662 zinc finger protein 662 2 2
MIRT543589 KIAA1549 KIAA1549 2 2
MIRT543955 RNF20 ring finger protein 20 2 2
MIRT544043 C9orf64 chromosome 9 open reading frame 64 2 4
MIRT548064 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548240 FBXW7 F-box and WD repeat domain containing 7 2 2
MIRT548442 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT548623 DAZAP1 DAZ associated protein 1 2 4
MIRT548770 COLEC12 collectin subfamily member 12 2 2
MIRT549506 HDDC2 HD domain containing 2 2 4
MIRT551924 AKAP8 A-kinase anchoring protein 8 2 4
MIRT555656 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT556286 MAP3K5 mitogen-activated protein kinase kinase kinase 5 2 2
MIRT557012 HOXD13 homeobox D13 2 4
MIRT563907 CLSPN claspin 2 2
MIRT565527 SON SON DNA binding protein 2 2
MIRT568000 COMMD2 COMM domain containing 2 2 2
MIRT569831 PLA2G16 phospholipase A2 group XVI 2 4
MIRT573905 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT616589 KLHL9 kelch like family member 9 2 2
MIRT617137 ZNF556 zinc finger protein 556 2 2
MIRT617400 API5 apoptosis inhibitor 5 2 2
MIRT617455 CCS copper chaperone for superoxide dismutase 2 2
MIRT617799 ZNF793 zinc finger protein 793 2 2
MIRT618190 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT618303 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT618329 ZNF813 zinc finger protein 813 2 2
MIRT618820 PHF20 PHD finger protein 20 2 2
MIRT619153 PPDPF pancreatic progenitor cell differentiation and proliferation factor 2 2
MIRT619530 ZNF708 zinc finger protein 708 2 2
MIRT619849 KIR3DX1 killer cell immunoglobulin like receptor, three Ig domains X1 2 2
MIRT620806 SLC26A2 solute carrier family 26 member 2 2 2
MIRT621312 YIPF4 Yip1 domain family member 4 2 2
MIRT621358 GUCA1B guanylate cyclase activator 1B 2 2
MIRT621366 ART4 ADP-ribosyltransferase 4 (Dombrock blood group) 2 2
MIRT621547 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT621883 TAOK1 TAO kinase 1 2 2
MIRT622451 RNF19B ring finger protein 19B 2 2
MIRT623404 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT623587 IPO9 importin 9 2 2
MIRT623974 FAM63A MINDY lysine 48 deubiquitinase 1 2 2
MIRT624086 DPP8 dipeptidyl peptidase 8 2 2
MIRT624108 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT632486 RNF8 ring finger protein 8 2 2
MIRT634057 PLIN3 perilipin 3 2 2
MIRT634657 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT640682 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT641242 CENPN centromere protein N 2 2
MIRT642260 ZNF677 zinc finger protein 677 2 2
MIRT642954 RELA RELA proto-oncogene, NF-kB subunit 2 2
MIRT644326 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT644632 ICA1L islet cell autoantigen 1 like 2 2
MIRT645721 POLR3A RNA polymerase III subunit A 2 2
MIRT647850 LYPLA1 lysophospholipase I 2 2
MIRT649281 NEK8 NIMA related kinase 8 2 2
MIRT650038 VHL von Hippel-Lindau tumor suppressor 2 2
MIRT650354 RRP36 ribosomal RNA processing 36 2 2
MIRT651144 ZNF384 zinc finger protein 384 2 2
MIRT651778 UTP6 UTP6, small subunit processome component 2 2
MIRT652576 TLCD2 TLC domain containing 2 2 2
MIRT654621 PTPRJ protein tyrosine phosphatase, receptor type J 2 2
MIRT656023 MYO5A myosin VA 2 2
MIRT656105 MSRB3 methionine sulfoxide reductase B3 2 2
MIRT657749 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT657924 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT658848 DUSP19 dual specificity phosphatase 19 2 2
MIRT659100 DENND6A DENN domain containing 6A 2 2
MIRT659153 DCX doublecortin 2 2
MIRT660870 ADRBK2 G protein-coupled receptor kinase 3 2 2
MIRT661941 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT663577 C10orf32 BLOC-1 related complex subunit 7 2 2
MIRT664625 WDPCP WD repeat containing planar cell polarity effector 2 4
MIRT666562 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT669992 GPR156 G protein-coupled receptor 156 2 4
MIRT670445 RSBN1L round spermatid basic protein 1 like 2 2
MIRT670853 IFNAR1 interferon alpha and beta receptor subunit 1 2 4
MIRT671942 SPPL3 signal peptide peptidase like 3 2 2
MIRT674269 LMOD3 leiomodin 3 2 2
MIRT674424 MIOX myo-inositol oxygenase 2 4
MIRT674982 ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C1 (subunit 9) 2 2
MIRT675038 BACE2 beta-site APP-cleaving enzyme 2 2 4
MIRT675309 C2orf68 chromosome 2 open reading frame 68 2 2
MIRT675641 TTPAL alpha tocopherol transfer protein like 2 2
MIRT688688 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT689369 ZNF101 zinc finger protein 101 2 2
MIRT689605 AKAP6 A-kinase anchoring protein 6 2 2
MIRT691715 LARS leucyl-tRNA synthetase 2 2
MIRT695473 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT695530 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT695878 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT696586 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT703007 HEATR5A HEAT repeat containing 5A 2 2
MIRT707942 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 2
MIRT709765 GPR183 G protein-coupled receptor 183 2 2
MIRT710332 ZNF669 zinc finger protein 669 2 2
MIRT713249 ZFP30 ZFP30 zinc finger protein 2 2
MIRT716613 RBM18 RNA binding motif protein 18 2 2
MIRT733414 BAG2 BCL2 associated athanogene 2 2 0
MIRT756135 THSD7A thrombospondin type 1 domain containing 7A 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1303 Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-1303 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1303 Rituximab sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-1303 Etoposide 36462 NSC141540 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Doxorubicin 31703 NSC123127 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Vinorelbine 44424639 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Vincristine 5978 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Paclitaxel 36314 NSC125973 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-mir-1303 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-1303 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-1303 Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-1303 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-miR-1303 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1303 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1303 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-1303 Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-1303 Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-1303 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1303 Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-1303 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission