pre-miRNA Information
pre-miRNA hsa-mir-1303   
Genomic Coordinates chr5: 154685776 - 154685861
Synonyms MIRN1303, hsa-mir-1303, MIR1303
Description Homo sapiens miR-1303 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1303
Sequence 52| UUUAGAGACGGGGUCUUGCUCU |73
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 5 + 154685830 23291724, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs370437195 6 dbSNP
rs1195001383 7 dbSNP
rs546614687 8 dbSNP
rs762579883 9 dbSNP
rs766041486 10 dbSNP
rs751079975 12 dbSNP
rs888516744 13 dbSNP
rs566454487 14 dbSNP
rs766973220 15 dbSNP
rs1474274822 17 dbSNP
rs753222192 18 dbSNP
rs1230907999 19 dbSNP
rs756552638 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol EIF3I   
Synonyms EIF3S2, PRO2242, TRIP-1, TRIP1, eIF3-beta, eIF3-p36
Description eukaryotic translation initiation factor 3 subunit I
Transcript NM_003757   
Expression
Putative miRNA Targets on EIF3I
3'UTR of EIF3I
(miRNA target sites are highlighted)
>EIF3I|NM_003757|3'UTR
   1 GAAGCTGGATCTCCTGCCGGGCGTGGTGGCTCATGCCTGTAATCCCACCACTTTTTTTTTAAGGCAGGCGGATCACCTGA
  81 GGTCAGGAGTTTAAGACCAGCCTGACCAACATGGAGAAACCTCGTCTCTACTAAAAATACAAAAATTAGCCAGGCATGGT
 161 GGCACACGCCTATAGTCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATCACTTGAACCCAGGAGGCAGAGGTTGCAGTGA
 241 GCTGAGATCACGTCATTGCACTCCATCCTGAGCCACAAGAGCAAAACTCCGTCTCAAAAAAAAAAAAGAAGAAGGTGGAT
 321 CTCCAACCAGGCCAGAGAAGATTCTCACAGAAGGTTTTGAACTCTAAGAAATAAATTGGTTTGGTAATAAATGGCTTCTG
 401 GTCAGATAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucUCGUUCUGGGGCAGAGAUUu 5'
            ||||| ||:||||||| || 
Target 5' agAGCAAAACTCCGTCTCAAAa 3'
278 - 299 156.00 -27.30
2
miRNA  3' ucUCGUUCUGGGGCAGAGAUuu 5'
            :| :| |||:||||||||  
Target 5' atGGAGAAACCTCGTCTCTAct 3'
111 - 132 152.00 -21.60
3
miRNA  3' ucUCGUUCUGGGGC-AGAGAUUu 5'
            || |||:::::|  |||||| 
Target 5' acAG-AAGGTTTTGAACTCTAAg 3'
347 - 368 127.00 -13.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN2531980 20 COSMIC
COSN26974783 23 COSMIC
COSN26974782 27 COSMIC
COSN30142597 28 COSMIC
COSN31481225 49 COSMIC
COSN29517072 61 COSMIC
COSN25910201 71 COSMIC
COSN10047351 85 COSMIC
COSN30119854 87 COSMIC
COSN31592098 124 COSMIC
COSN25928296 313 COSMIC
COSN31641551 342 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs776378602 2 dbSNP
rs1261613237 4 dbSNP
rs1431837407 5 dbSNP
rs1312142805 9 dbSNP
rs1211495610 10 dbSNP
rs545432591 12 dbSNP
rs765105798 13 dbSNP
rs777641635 13 dbSNP
rs1377000652 14 dbSNP
rs750271761 15 dbSNP
rs762953569 16 dbSNP
rs1264191873 17 dbSNP
rs767490035 19 dbSNP
rs1197052943 20 dbSNP
rs752887320 23 dbSNP
rs372723503 24 dbSNP
rs754146799 25 dbSNP
rs757504662 29 dbSNP
rs1167833258 30 dbSNP
rs779337333 34 dbSNP
rs746353682 35 dbSNP
rs1362099756 36 dbSNP
rs1402660453 45 dbSNP
rs376058123 46 dbSNP
rs1367389741 47 dbSNP
rs779409735 48 dbSNP
rs746561757 49 dbSNP
rs1315598145 50 dbSNP
rs776214826 51 dbSNP
rs749108622 52 dbSNP
rs770941829 52 dbSNP
rs893622572 53 dbSNP
rs1039552160 54 dbSNP
rs1258802574 61 dbSNP
rs1472585658 62 dbSNP
rs946581570 70 dbSNP
rs564020023 71 dbSNP
rs919705669 73 dbSNP
rs528138540 74 dbSNP
rs777676705 77 dbSNP
rs1357684714 89 dbSNP
rs1436633456 98 dbSNP
rs11554218 101 dbSNP
rs1349789608 107 dbSNP
rs546384941 108 dbSNP
rs998514439 109 dbSNP
rs1029300473 113 dbSNP
rs1373729924 124 dbSNP
rs889472616 125 dbSNP
rs749293687 127 dbSNP
rs886747510 129 dbSNP
rs1276035600 132 dbSNP
rs562315898 132 dbSNP
rs1210963539 134 dbSNP
rs1273373776 141 dbSNP
rs1186951797 153 dbSNP
rs1249442437 154 dbSNP
rs1447289338 156 dbSNP
rs1187342107 159 dbSNP
rs1470699088 163 dbSNP
rs1006623595 165 dbSNP
rs1415731507 167 dbSNP
rs568212067 168 dbSNP
rs529123390 169 dbSNP
rs973636384 173 dbSNP
rs550872046 178 dbSNP
rs1013067204 181 dbSNP
rs1454617290 186 dbSNP
rs372992925 187 dbSNP
rs1363207219 193 dbSNP
rs1434683253 194 dbSNP
rs1355087009 205 dbSNP
rs968791491 206 dbSNP
rs778448087 208 dbSNP
rs1372723183 213 dbSNP
rs1234485214 220 dbSNP
rs1296443220 221 dbSNP
rs1339395486 227 dbSNP
rs998866304 231 dbSNP
rs1373254586 232 dbSNP
rs745401057 234 dbSNP
rs539834620 242 dbSNP
rs1217617306 244 dbSNP
rs1275693956 245 dbSNP
rs1438954616 248 dbSNP
rs1221284969 250 dbSNP
rs189268974 253 dbSNP
rs1470116083 258 dbSNP
rs1137921 267 dbSNP
rs1137947 275 dbSNP
rs1269821384 278 dbSNP
rs1169781043 291 dbSNP
rs912501625 292 dbSNP
rs1321513677 296 dbSNP
rs1404762273 296 dbSNP
rs372584031 296 dbSNP
rs398052892 296 dbSNP
rs764509111 296 dbSNP
rs963946360 296 dbSNP
rs975269592 296 dbSNP
rs1362644572 304 dbSNP
rs1207689243 305 dbSNP
rs1228957733 306 dbSNP
rs199780319 306 dbSNP
rs36086222 308 dbSNP
rs927946886 309 dbSNP
rs1425009471 313 dbSNP
rs1420207289 323 dbSNP
rs555598898 325 dbSNP
rs938037124 327 dbSNP
rs990851314 328 dbSNP
rs1046813656 333 dbSNP
rs1457086835 334 dbSNP
rs1195409973 344 dbSNP
rs908206074 345 dbSNP
rs938386472 347 dbSNP
rs769199509 348 dbSNP
rs182204857 349 dbSNP
rs1461749152 363 dbSNP
rs1351898698 365 dbSNP
rs376843740 380 dbSNP
rs1043218392 383 dbSNP
rs1042186001 389 dbSNP
rs902354987 396 dbSNP
rs933898273 402 dbSNP
rs1423830801 405 dbSNP
rs1339319227 409 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucUCGUUCUGGGGCAGAGAUuu 5'
            :| :| |||:||||||||  
Target 5' atGGAGAAACCTCGTCTCTAct 3'
7 - 28
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.475 1.5e-2 -0.471 1.6e-2 21 Click to see details
GSE28544 Breast cancer -0.398 2.7e-2 -0.439 1.6e-2 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.368 3.8e-2 0.181 2.0e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells 0.308 7.6e-2 0.410 2.6e-2 23 Click to see details
GSE28260 Renal cortex and medulla -0.377 1.0e-1 -0.418 7.8e-2 13 Click to see details
GSE32688 Pancreatic cancer -0.056 3.8e-1 0.017 4.6e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.012 4.8e-1 -0.008 4.8e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
186 hsa-miR-1303 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035871 SOAT1 sterol O-acyltransferase 1 1 1
MIRT035872 FHOD3 formin homology 2 domain containing 3 1 1
MIRT035873 RPL7A ribosomal protein L7a 1 1
MIRT035874 NCAPD2 non-SMC condensin I complex subunit D2 1 1
MIRT035875 RPS8 ribosomal protein S8 1 1
MIRT035876 AHNAK AHNAK nucleoprotein 1 1
MIRT035877 ACTB actin beta 1 1
MIRT035878 DEF8 differentially expressed in FDCP 8 homolog 1 1
MIRT035879 MET MET proto-oncogene, receptor tyrosine kinase 1 1
MIRT035880 MED13 mediator complex subunit 13 1 1
MIRT035881 FAT3 FAT atypical cadherin 3 1 1
MIRT035882 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT035883 RPS16 ribosomal protein S16 1 1
MIRT035884 CDK6 cyclin dependent kinase 6 1 1
MIRT035885 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT035886 PITRM1 pitrilysin metallopeptidase 1 1 1
MIRT035887 PRRC2A proline rich coiled-coil 2A 1 1
MIRT035888 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT035889 MLLT6 MLLT6, PHD finger containing 1 1
MIRT035890 EIF3I eukaryotic translation initiation factor 3 subunit I 1 1
MIRT035891 FASN fatty acid synthase 1 1
MIRT035892 LEPREL4 prolyl 3-hydroxylase family member 4 (non-enzymatic) 1 1
MIRT035893 HSCB HscB mitochondrial iron-sulfur cluster cochaperone 1 1
MIRT035894 PSME4 proteasome activator subunit 4 1 1
MIRT035895 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT035896 ZNF264 zinc finger protein 264 1 1
MIRT035897 HYLS1 HYLS1, centriolar and ciliogenesis associated 1 1
MIRT035898 USP54 ubiquitin specific peptidase 54 1 1
MIRT035899 L1TD1 LINE1 type transposase domain containing 1 1 1
MIRT035900 OR51E2 olfactory receptor family 51 subfamily E member 2 1 1
MIRT053762 CLDN18 claudin 18 3 1
MIRT060730 RPS3 ribosomal protein S3 2 2
MIRT083986 RAB22A RAB22A, member RAS oncogene family 2 2
MIRT098550 TBPL1 TATA-box binding protein like 1 2 6
MIRT134983 TWF1 twinfilin actin binding protein 1 2 4
MIRT136956 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT222065 PURB purine rich element binding protein B 2 2
MIRT239574 UBN2 ubinuclein 2 2 4
MIRT261820 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT264698 C11ORF57 chromosome 11 open reading frame 57 2 4
MIRT308476 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT377481 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT442304 NEU3 neuraminidase 3 2 2
MIRT446083 SLC30A10 solute carrier family 30 member 10 2 2
MIRT449606 PRPF4 pre-mRNA processing factor 4 2 2
MIRT453767 NUCB1 nucleobindin 1 2 10
MIRT455603 SRSF3 serine and arginine rich splicing factor 3 2 2
MIRT455913 KIF2C kinesin family member 2C 2 2
MIRT460091 ZYG11B zyg-11 family member B, cell cycle regulator 2 4
MIRT460866 UBE2S ubiquitin conjugating enzyme E2 S 2 2
MIRT461339 NUP133 nucleoporin 133 2 2
MIRT463769 YOD1 YOD1 deubiquitinase 2 2
MIRT466368 THAP1 THAP domain containing 1 2 4
MIRT467168 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT468703 SDHD succinate dehydrogenase complex subunit D 2 2
MIRT469122 RNF126 ring finger protein 126 2 2
MIRT472426 NCBP2 nuclear cap binding protein subunit 2 2 4
MIRT479420 CDKN1B cyclin dependent kinase inhibitor 1B 2 8
MIRT484260 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT485468 IL6ST interleukin 6 signal transducer 2 10
MIRT490237 H2AFZ H2A histone family member Z 2 6
MIRT491002 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT492127 SUMO2 small ubiquitin-like modifier 2 2 2
MIRT499169 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT499825 PCSK9 proprotein convertase subtilisin/kexin type 9 2 8
MIRT501794 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT503441 GINS4 GINS complex subunit 4 2 4
MIRT503688 MAVS mitochondrial antiviral signaling protein 2 5
MIRT506926 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT511430 HOXA10 homeobox A10 2 6
MIRT512415 LAYN layilin 2 4
MIRT513791 NIPAL3 NIPA like domain containing 3 2 4
MIRT516163 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 2 4
MIRT516513 PARK2 parkin RBR E3 ubiquitin protein ligase 2 2
MIRT516915 HINFP histone H4 transcription factor 2 2
MIRT517102 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT517350 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT518019 ABHD15 abhydrolase domain containing 15 2 2
MIRT520945 SRSF10 serine and arginine rich splicing factor 10 2 2
MIRT525250 RNF213 ring finger protein 213 2 2
MIRT530634 PPIC peptidylprolyl isomerase C 2 4
MIRT530671 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531563 ILDR1 immunoglobulin like domain containing receptor 1 2 2
MIRT538205 CYR61 cysteine rich angiogenic inducer 61 2 2
MIRT538419 COLEC10 collectin subfamily member 10 2 2
MIRT541964 ZNF485 zinc finger protein 485 2 2
MIRT543088 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT543257 ZNF662 zinc finger protein 662 2 2
MIRT543589 KIAA1549 KIAA1549 2 2
MIRT543955 RNF20 ring finger protein 20 2 2
MIRT544043 C9orf64 chromosome 9 open reading frame 64 2 4
MIRT548064 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548240 FBXW7 F-box and WD repeat domain containing 7 2 2
MIRT548442 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT548623 DAZAP1 DAZ associated protein 1 2 4
MIRT548770 COLEC12 collectin subfamily member 12 2 2
MIRT549506 HDDC2 HD domain containing 2 2 4
MIRT551924 AKAP8 A-kinase anchoring protein 8 2 4
MIRT555656 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT556286 MAP3K5 mitogen-activated protein kinase kinase kinase 5 2 2
MIRT557012 HOXD13 homeobox D13 2 4
MIRT563907 CLSPN claspin 2 2
MIRT565527 SON SON DNA binding protein 2 2
MIRT568000 COMMD2 COMM domain containing 2 2 2
MIRT569831 PLA2G16 phospholipase A2 group XVI 2 4
MIRT573905 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT616589 KLHL9 kelch like family member 9 2 2
MIRT617137 ZNF556 zinc finger protein 556 2 2
MIRT617400 API5 apoptosis inhibitor 5 2 2
MIRT617455 CCS copper chaperone for superoxide dismutase 2 2
MIRT617799 ZNF793 zinc finger protein 793 2 2
MIRT618190 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT618303 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT618329 ZNF813 zinc finger protein 813 2 2
MIRT618820 PHF20 PHD finger protein 20 2 2
MIRT619153 PPDPF pancreatic progenitor cell differentiation and proliferation factor 2 2
MIRT619530 ZNF708 zinc finger protein 708 2 2
MIRT619849 KIR3DX1 killer cell immunoglobulin like receptor, three Ig domains X1 2 2
MIRT620806 SLC26A2 solute carrier family 26 member 2 2 2
MIRT621312 YIPF4 Yip1 domain family member 4 2 2
MIRT621358 GUCA1B guanylate cyclase activator 1B 2 2
MIRT621366 ART4 ADP-ribosyltransferase 4 (Dombrock blood group) 2 2
MIRT621547 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT621883 TAOK1 TAO kinase 1 2 2
MIRT622451 RNF19B ring finger protein 19B 2 2
MIRT623404 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT623587 IPO9 importin 9 2 2
MIRT623974 FAM63A MINDY lysine 48 deubiquitinase 1 2 2
MIRT624086 DPP8 dipeptidyl peptidase 8 2 2
MIRT624108 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT632486 RNF8 ring finger protein 8 2 2
MIRT634057 PLIN3 perilipin 3 2 2
MIRT634657 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT640682 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT641242 CENPN centromere protein N 2 2
MIRT642260 ZNF677 zinc finger protein 677 2 2
MIRT642954 RELA RELA proto-oncogene, NF-kB subunit 2 2
MIRT644326 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT644632 ICA1L islet cell autoantigen 1 like 2 2
MIRT645721 POLR3A RNA polymerase III subunit A 2 2
MIRT647850 LYPLA1 lysophospholipase I 2 2
MIRT649281 NEK8 NIMA related kinase 8 2 2
MIRT650038 VHL von Hippel-Lindau tumor suppressor 2 2
MIRT650354 RRP36 ribosomal RNA processing 36 2 2
MIRT651144 ZNF384 zinc finger protein 384 2 2
MIRT651778 UTP6 UTP6, small subunit processome component 2 2
MIRT652576 TLCD2 TLC domain containing 2 2 2
MIRT654621 PTPRJ protein tyrosine phosphatase, receptor type J 2 2
MIRT656023 MYO5A myosin VA 2 2
MIRT656105 MSRB3 methionine sulfoxide reductase B3 2 2
MIRT657749 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT657924 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT658848 DUSP19 dual specificity phosphatase 19 2 2
MIRT659100 DENND6A DENN domain containing 6A 2 2
MIRT659153 DCX doublecortin 2 2
MIRT660870 ADRBK2 G protein-coupled receptor kinase 3 2 2
MIRT661941 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT663577 C10orf32 BLOC-1 related complex subunit 7 2 2
MIRT664625 WDPCP WD repeat containing planar cell polarity effector 2 4
MIRT666562 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT669992 GPR156 G protein-coupled receptor 156 2 4
MIRT670445 RSBN1L round spermatid basic protein 1 like 2 2
MIRT670853 IFNAR1 interferon alpha and beta receptor subunit 1 2 4
MIRT671942 SPPL3 signal peptide peptidase like 3 2 2
MIRT674269 LMOD3 leiomodin 3 2 2
MIRT674424 MIOX myo-inositol oxygenase 2 4
MIRT674982 ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C1 (subunit 9) 2 2
MIRT675038 BACE2 beta-site APP-cleaving enzyme 2 2 4
MIRT675309 C2orf68 chromosome 2 open reading frame 68 2 2
MIRT675641 TTPAL alpha tocopherol transfer protein like 2 2
MIRT688688 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT689369 ZNF101 zinc finger protein 101 2 2
MIRT689605 AKAP6 A-kinase anchoring protein 6 2 2
MIRT691715 LARS leucyl-tRNA synthetase 2 2
MIRT695473 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT695530 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT695878 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT696586 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT703007 HEATR5A HEAT repeat containing 5A 2 2
MIRT707942 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 2
MIRT709765 GPR183 G protein-coupled receptor 183 2 2
MIRT710332 ZNF669 zinc finger protein 669 2 2
MIRT713249 ZFP30 ZFP30 zinc finger protein 2 2
MIRT716613 RBM18 RNA binding motif protein 18 2 2
MIRT733414 BAG2 BCL2 associated athanogene 2 2 0
MIRT756135 THSD7A thrombospondin type 1 domain containing 7A 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1303 Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-1303 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1303 Rituximab sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-1303 Etoposide 36462 NSC141540 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Doxorubicin 31703 NSC123127 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Vinorelbine 44424639 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Vincristine 5978 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Paclitaxel 36314 NSC125973 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-mir-1303 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-1303 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-1303 Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-1303 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-miR-1303 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1303 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1303 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-1303 Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-1303 Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-1303 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1303 Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-1303 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission