miRTarBase - #MIRT035958


—
pre-miRNA Information
pre-miRNA hsa-mir-1301   
Genomic Coordinates chr2: 25328640 - 25328721
Synonyms MIRN1301, hsa-mir-1301, MIR1301
Description Homo sapiens miR-1301 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1301-3p
Sequence 48| UUGCAGCUGCCUGGGAGUGACUUC |71
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 2 - 25328670 26449202, 27298257, 28411194, 28550310, 28855684, 29267965, 29950133, 29165639, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs775188648 6 dbSNP
rs1022364375 11 dbSNP
rs938368115 12 dbSNP
rs771728471 15 dbSNP
rs778709428 19 dbSNP
rs1358947891 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF816   
Synonyms ZNF816A
Description zinc finger protein 816
Transcript NM_001031665   
Expression
Putative miRNA Targets on ZNF816
3'UTR of ZNF816
(miRNA target sites are highlighted)		 
>ZNF816|NM_001031665|3'UTR
   1 TGATTGTCACAAAGTCTTCAGTAATGCTACAACCATTGCAAATCATTACAGAATCCATATTGAAGAGAGATCTACAAGTG
  81 TAATAAATGTGGCAAATTTTTCAGACGTCATTCATAACTTGTAGTTCATCAGTGAACTCATACTGGAGAGAAACCTTACA
 161 AATATCATGACTGTGACAAGGTCTTCAGTCAAGCTTCATCCTATGCAAAACATAGAATTCATACAGGAGAGAAACCTCAC
 241 AAGTGTGATGATTGTGGCAAAGCCTTTACTTCATGTTCACACCTCATTAGACATCAGAGAATTCATACTGGACAGATGCC
 321 TTACAAATGTAAGGGTGGCAAGGTCTTCACTCTGTGGTCATTCCATGCAGAACATCAGAAAATTCATTTTTGAGATAATT
 401 GTTCCAAATAAAATGAATATAAAAAATCATAAAACTTTAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuUCAGUGAGGGUCCG-UCGACGUu 5'
            :|||   ::||| | |||| || 
Target 5' aaGGTC---TTCAGTCAAGCTTCAt 3'
 178 - 199 123.00 -11.70
2 
miRNA  3' cuUCAGUGAGGGUCCGUCGACGuu 5'
            | ||| | |::| ||| |||  
Target 5' gaATTCA-TACTGGACAGATGCct 3'
 299 - 321 113.00 -10.40
3 
miRNA  3' cuuCAGUG----AG-GGUCCGU-CGACGUu 5'
             |||||    || :|||  | ||| || 
Target 5' attGTCACAAAGTCTTCAGTAATGCTACAa 3'
 3 - 32 99.00 -11.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN27006598 6 COSMIC
COSN30141674 29 COSMIC
COSN30487070 44 COSMIC
COSN31571494 47 COSMIC
COSN30149919 62 COSMIC
COSN31495615 73 COSMIC
COSN27006596 78 COSMIC
COSN30103819 84 COSMIC
COSN1218241 92 COSMIC
COSN30186655 104 COSMIC
COSN15302865 107 COSMIC
COSN15303529 128 COSMIC
COSN30504119 131 COSMIC
COSN31500533 150 COSMIC
COSN30150339 166 COSMIC
COSN5851561 173 COSMIC
COSN31512797 205 COSMIC
COSN31580347 219 COSMIC
COSN31595696 234 COSMIC
COSN31591844 242 COSMIC
COSN15304775 303 COSMIC
COSN31603586 310 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs368474785 1 dbSNP
rs1429974437 3 dbSNP
rs374712133 4 dbSNP
rs1253434930 9 dbSNP
rs201377004 11 dbSNP
rs1199446090 14 dbSNP
rs1485957988 24 dbSNP
rs1214190078 27 dbSNP
rs754769932 31 dbSNP
rs8110048 32 dbSNP
rs1160826050 33 dbSNP
rs1202955325 36 dbSNP
rs749541588 41 dbSNP
rs778187468 42 dbSNP
rs753180907 45 dbSNP
rs781771928 51 dbSNP
rs115122274 60 dbSNP
rs1351666357 65 dbSNP
rs749127499 67 dbSNP
rs1012363878 68 dbSNP
rs1470168343 69 dbSNP
rs879769243 86 dbSNP
rs1247816656 95 dbSNP
rs1194786784 96 dbSNP
rs1311168700 97 dbSNP
rs923207480 103 dbSNP
rs570977624 104 dbSNP
rs3745177 107 dbSNP
rs1252740976 116 dbSNP
rs1808106 128 dbSNP
rs1221697516 131 dbSNP
rs914419128 134 dbSNP
rs990195912 135 dbSNP
rs1346924959 137 dbSNP
rs958818720 139 dbSNP
rs927310386 140 dbSNP
rs981880945 141 dbSNP
rs3745175 143 dbSNP
rs1405962128 144 dbSNP
rs1443035458 148 dbSNP
rs1406555567 149 dbSNP
rs1374651139 154 dbSNP
rs1449277455 155 dbSNP
rs1332349004 157 dbSNP
rs1377339915 162 dbSNP
rs1328095837 165 dbSNP
rs1282314129 169 dbSNP
rs1358381677 169 dbSNP
rs548651348 172 dbSNP
rs1256852740 175 dbSNP
rs1315598765 176 dbSNP
rs994392813 178 dbSNP
rs1238458551 181 dbSNP
rs1461118492 189 dbSNP
rs771989273 196 dbSNP
rs191924511 200 dbSNP
rs1239668470 207 dbSNP
rs1473406210 221 dbSNP
rs569386170 222 dbSNP
rs1433049208 223 dbSNP
rs1044466 226 dbSNP
rs116196611 227 dbSNP
rs1467296240 229 dbSNP
rs1171586491 231 dbSNP
rs1017059815 238 dbSNP
rs1455842148 240 dbSNP
rs1231739384 244 dbSNP
rs1331962401 245 dbSNP
rs1247915046 250 dbSNP
rs866708840 252 dbSNP
rs1342101697 259 dbSNP
rs1437931279 269 dbSNP
rs1005923415 273 dbSNP
rs187343899 279 dbSNP
rs1219968395 280 dbSNP
rs1252001234 282 dbSNP
rs888896607 285 dbSNP
rs1028642866 287 dbSNP
rs997613221 292 dbSNP
rs1443397457 299 dbSNP
rs1280582947 302 dbSNP
rs1044467 303 dbSNP
rs1041625808 304 dbSNP
rs945950800 316 dbSNP
rs765804560 324 dbSNP
rs1428783399 334 dbSNP
rs892973104 341 dbSNP
rs1054326113 357 dbSNP
rs551807137 357 dbSNP
rs1239617306 359 dbSNP
rs1414873713 366 dbSNP
rs1297451694 370 dbSNP
rs1358555053 371 dbSNP
rs1401240323 373 dbSNP
rs937430863 374 dbSNP
rs1330074750 390 dbSNP
rs1230577143 392 dbSNP
rs527331642 394 dbSNP
rs927393407 397 dbSNP
rs981568123 413 dbSNP
rs779176335 427 dbSNP
rs147713568 428 dbSNP
rs918595726 429 dbSNP
rs541793118 430 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuUCAGUGAGGGUCCGU-CGACGUu 5'
            ||||   ::|||  | ||| || 
Target 5' aaAGTC---TTCAGTAATGCTACAa 3'
 		2 - 23
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.405 0 -0.368 0 50 Click to see details
KIRP -0.44 0.01 -0.466 0 32 Click to see details
KICH -0.312 0.06 -0.280 0.09 25 Click to see details
BRCA -0.159 0.07 -0.185 0.05 84 Click to see details
KIRC -0.173 0.08 -0.118 0.17 68 Click to see details
COAD -0.477 0.12 -0.071 0.43 8 Click to see details
LUAD 0.328 0.15 0.294 0.18 12 Click to see details
CESC -0.865 0.17 -0.500 0.33 3 Click to see details
STAD -0.164 0.18 0.022 0.45 32 Click to see details
PAAD 0.573 0.21 0.800 0.1 4 Click to see details
BLCA 0.172 0.25 0.075 0.38 18 Click to see details
ESCA 0.228 0.25 0.318 0.17 11 Click to see details
CHOL -0.188 0.31 -0.133 0.37 9 Click to see details
UCEC 0.107 0.33 0.202 0.2 19 Click to see details
LIHC -0.053 0.36 -0.007 0.48 49 Click to see details
LUSC -0.046 0.39 -0.062 0.36 38 Click to see details
THCA -0.029 0.41 0.028 0.42 59 Click to see details
PCPG -0.096 0.47 0.500 0.33 3 Click to see details
HNSC 0.011 0.47 0.087 0.29 42 Click to see details
HNSC 0.011 0.47 0.087 0.29 42 Click to see details
HNSC 0.011 0.47 0.087 0.29 42 Click to see details
195 hsa-miR-1301-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035957 MRPL10 mitochondrial ribosomal protein L10 1 1
MIRT035958 ZNF816 zinc finger protein 816 1 1
MIRT035959 HDLBP high density lipoprotein binding protein 1 1
MIRT035960 GNG10 G protein subunit gamma 10 1 1
MIRT035961 MICALL1 MICAL like 1 1 1
MIRT035962 CCNH cyclin H 1 1
MIRT035963 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 1
MIRT035964 HIST2H2AC histone cluster 2 H2A family member c 1 1
MIRT035965 PARL presenilin associated rhomboid like 1 1
MIRT035966 TXN thioredoxin 1 1
MIRT035967 CREBBP CREB binding protein 1 1
MIRT035968 CYTB cytochrome b 1 1
MIRT035969 GLI3 GLI family zinc finger 3 1 1
MIRT035970 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 1 1
MIRT035971 PREP prolyl endopeptidase 1 1
MIRT035972 COL6A1 collagen type VI alpha 1 chain 1 1
MIRT035973 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT035974 ADCY3 adenylate cyclase 3 1 1
MIRT035975 POLB DNA polymerase beta 1 1
MIRT035976 HMGA1 high mobility group AT-hook 1 1 1
MIRT035977 SKP1 S-phase kinase associated protein 1 1 1
MIRT035978 ADD2 adducin 2 1 1
MIRT035979 ANXA11 annexin A11 1 1
MIRT035980 CORO1C coronin 1C 1 1
MIRT035981 MDH2 malate dehydrogenase 2 1 1
MIRT035982 BICD2 BICD cargo adaptor 2 1 1
MIRT035983 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT035984 CDK5RAP2 CDK5 regulatory subunit associated protein 2 1 1
MIRT035985 POLR3H RNA polymerase III subunit H 1 1
MIRT035986 COX1 cytochrome c oxidase subunit I 1 1
MIRT035987 HEATR2 dynein axonemal assembly factor 5 1 1
MIRT035988 RPS5 ribosomal protein S5 1 1
MIRT035989 CCT3 chaperonin containing TCP1 subunit 3 1 1
MIRT035990 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 1
MIRT035991 RPL3 ribosomal protein L3 1 1
MIRT035992 TMPO thymopoietin 1 1
MIRT035993 COPE coatomer protein complex subunit epsilon 1 1
MIRT035994 NONO non-POU domain containing octamer binding 1 1
MIRT035995 BLCAP bladder cancer associated protein 1 1
MIRT035996 NUP133 nucleoporin 133 1 1
MIRT035997 VCP valosin containing protein 1 1
MIRT035998 ARIH2 ariadne RBR E3 ubiquitin protein ligase 2 1 1
MIRT035999 SON SON DNA binding protein 1 1
MIRT036000 ATP5J ATP synthase, H+ transporting, mitochondrial Fo complex subunit F6 1 1
MIRT036001 VIM vimentin 1 1
MIRT036002 FKBP8 FK506 binding protein 8 1 1
MIRT036003 SPECC1L sperm antigen with calponin homology and coiled-coil domains 1 like 1 1
MIRT036004 ZCCHC14 zinc finger CCHC-type containing 14 1 1
MIRT036005 TXNL4A thioredoxin like 4A 1 1
MIRT036006 UBE2J2 ubiquitin conjugating enzyme E2 J2 1 1
MIRT036007 FOPNL FGFR1OP N-terminal like 1 1
MIRT036008 VDAC1 voltage dependent anion channel 1 1 1
MIRT036009 CDIP1 cell death inducing p53 target 1 1 1
MIRT036010 EBNA1BP2 EBNA1 binding protein 2 1 1
MIRT036011 CD276 CD276 molecule 1 1
MIRT036012 RPS2 ribosomal protein S2 1 1
MIRT036013 USP28 ubiquitin specific peptidase 28 1 1
MIRT036014 ZMIZ1 zinc finger MIZ-type containing 1 1 1
MIRT036015 B4GALT7 beta-1,4-galactosyltransferase 7 1 1
MIRT036016 CAND1 cullin associated and neddylation dissociated 1 1 1
MIRT036017 CCDC104 cilia and flagella associated protein 36 1 1
MIRT036018 IMPDH1 inosine monophosphate dehydrogenase 1 1 1
MIRT036019 ATXN2L ataxin 2 like 1 1
MIRT036020 PARP1 poly(ADP-ribose) polymerase 1 1 1
MIRT036021 TNXB tenascin XB 1 1
MIRT036022 SYNGR1 synaptogyrin 1 1 1
MIRT036023 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT036024 ATXN7L3B ataxin 7 like 3B 1 1
MIRT036025 BCL2L13 BCL2 like 13 1 1
MIRT036026 RBM42 RNA binding motif protein 42 1 1
MIRT036027 HDGF heparin binding growth factor 1 1
MIRT036028 NAT8L N-acetyltransferase 8 like 1 1
MIRT036029 DLST dihydrolipoamide S-succinyltransferase 1 1
MIRT036030 CEP104 centrosomal protein 104 1 1
MIRT036031 NCOR1 nuclear receptor corepressor 1 1 1
MIRT036032 COCH cochlin 1 1
MIRT036033 NUTF2 nuclear transport factor 2 1 1
MIRT036034 KMT2E lysine methyltransferase 2E 1 1
MIRT036035 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT036036 SEPHS2 selenophosphate synthetase 2 1 1
MIRT036037 DYNC1I2 dynein cytoplasmic 1 intermediate chain 2 1 1
MIRT036038 ZCCHC24 zinc finger CCHC-type containing 24 1 1
MIRT036039 TRRAP transformation/transcription domain associated protein 1 1
MIRT036040 INPP4A inositol polyphosphate-4-phosphatase type I A 1 1
MIRT036041 CHN1 chimerin 1 1 1
MIRT036042 FECH ferrochelatase 1 1
MIRT036043 DCTD dCMP deaminase 1 1
MIRT036044 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT036045 PKM pyruvate kinase, muscle 1 1
MIRT036046 SSRP1 structure specific recognition protein 1 1 1
MIRT036047 CELF1 CUGBP Elav-like family member 1 1 1
MIRT036048 TSR2 TSR2, ribosome maturation factor 1 1
MIRT036049 TP53BP2 tumor protein p53 binding protein 2 1 1
MIRT036050 GSG2 histone H3 associated protein kinase 1 1
MIRT036051 WDFY1 WD repeat and FYVE domain containing 1 1 1
MIRT036052 RPA1 replication protein A1 1 1
MIRT036053 TMEM41A transmembrane protein 41A 1 1
MIRT036054 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT036055 NOP2 NOP2 nucleolar protein 1 1
MIRT036056 PEF1 penta-EF-hand domain containing 1 1 1
MIRT036057 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT036058 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 1
MIRT036059 WDR61 WD repeat domain 61 1 1
MIRT036060 MINK1 misshapen like kinase 1 1 1
MIRT036061 RPL35A ribosomal protein L35a 1 1
MIRT036062 WNT3 Wnt family member 3 1 1
MIRT036063 SYNJ2 synaptojanin 2 1 1
MIRT036064 CFL1 cofilin 1 1 1
MIRT036065 ALDOA aldolase, fructose-bisphosphate A 1 1
MIRT036066 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 1 1
MIRT064841 ZBTB18 zinc finger and BTB domain containing 18 2 4
MIRT090782 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT163227 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 2
MIRT214143 LMNB1 lamin B1 2 2
MIRT291875 ZNF333 zinc finger protein 333 2 2
MIRT292477 ZNF507 zinc finger protein 507 2 2
MIRT306035 SKIL SKI like proto-oncogene 2 2
MIRT443004 TRIOBP TRIO and F-actin binding protein 2 2
MIRT457830 ITPRIP inositol 1,4,5-trisphosphate receptor interacting protein 2 2
MIRT460067 RFTN2 raftlin family member 2 2 2
MIRT460342 ARL14EP ADP ribosylation factor like GTPase 14 effector protein 2 2
MIRT463060 ZNF639 zinc finger protein 639 2 2
MIRT466204 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT476159 GOLGA8B golgin A8 family member B 2 2
MIRT486953 HLA-B major histocompatibility complex, class I, B 2 2
MIRT492391 SEMA6A semaphorin 6A 2 2
MIRT495050 CTRC chymotrypsin C 2 4
MIRT500010 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501565 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT502680 CSNK1G3 casein kinase 1 gamma 3 2 8
MIRT503058 CAB39 calcium binding protein 39 2 2
MIRT504615 PLK1 polo like kinase 1 2 2
MIRT505706 SESN2 sestrin 2 2 2
MIRT506197 PHF19 PHD finger protein 19 2 2
MIRT506821 KIF23 kinesin family member 23 2 6
MIRT513782 PAWR pro-apoptotic WT1 regulator 2 6
MIRT527011 MAGI2 membrane associated guanylate kinase, WW and PDZ domain containing 2 2 4
MIRT527806 KLRD1 killer cell lectin like receptor D1 2 2
MIRT537896 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 4
MIRT537925 DST dystonin 2 2
MIRT540049 FOXC1 forkhead box C1 2 2
MIRT543395 DROSHA drosha ribonuclease III 2 2
MIRT545447 SC5D sterol-C5-desaturase 2 4
MIRT546876 RAB10 RAB10, member RAS oncogene family 2 4
MIRT549419 ACVR2B activin A receptor type 2B 2 2
MIRT551857 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT552453 ZNF410 zinc finger protein 410 2 2
MIRT552772 YIPF6 Yip1 domain family member 6 2 4
MIRT552788 YAF2 YY1 associated factor 2 2 2
MIRT554247 SLAIN2 SLAIN motif family member 2 2 2
MIRT554773 RHEBP1 RHEB pseudogene 1 2 4
MIRT555862 PAIP1 poly(A) binding protein interacting protein 1 2 2
MIRT556475 LIPA lipase A, lysosomal acid type 2 2
MIRT556655 KMT2D lysine methyltransferase 2D 2 4
MIRT558210 EFCAB14 EF-hand calcium binding domain 14 2 4
MIRT558306 DUSP14 dual specificity phosphatase 14 2 2
MIRT558818 CDCA4 cell division cycle associated 4 2 4
MIRT559370 ATP13A3 ATPase 13A3 2 2
MIRT559541 ARGLU1 arginine and glutamate rich 1 2 4
MIRT563022 ZNF680 zinc finger protein 680 2 2
MIRT563036 NBPF12 NBPF member 12 2 2
MIRT563791 SLC28A1 solute carrier family 28 member 1 2 2
MIRT565903 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT566957 LBR lamin B receptor 2 2
MIRT567971 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 2
MIRT570389 TSC22D2 TSC22 domain family member 2 2 2
MIRT575250 Timp3 tissue inhibitor of metalloproteinase 3 2 2
MIRT611519 ZNF25 zinc finger protein 25 2 2
MIRT611592 POTED POTE ankyrin domain family member D 2 2
MIRT614228 NPTXR neuronal pentraxin receptor 2 2
MIRT625933 SCYL3 SCY1 like pseudokinase 3 2 2
MIRT627320 TULP4 tubby like protein 4 2 2
MIRT631516 CTBS chitobiase 2 2
MIRT640705 MRS2 MRS2, magnesium transporter 2 2
MIRT642208 RUVBL2 RuvB like AAA ATPase 2 2 2
MIRT642767 FAM9C family with sequence similarity 9 member C 2 2
MIRT648411 KIAA0146 scaffolding protein involved in DNA repair 1 1
MIRT658045 FUT11 fucosyltransferase 11 2 2
MIRT663720 GLUL glutamate-ammonia ligase 2 2
MIRT698536 TFRC transferrin receptor 2 2
MIRT699988 RPS24 ribosomal protein S24 2 2
MIRT700433 PURB purine rich element binding protein B 2 2
MIRT705890 ADCY9 adenylate cyclase 9 2 2
MIRT706974 XPO5 exportin 5 2 2
MIRT710564 KIAA1958 KIAA1958 2 2
MIRT714070 RUNDC3B RUN domain containing 3B 2 2
MIRT716931 FAM13A family with sequence similarity 13 member A 2 2
MIRT717341 RAB40A RAB40A, member RAS oncogene family 2 2
MIRT717738 MYLK myosin light chain kinase 5 2
MIRT722963 SLC25A26 solute carrier family 25 member 26 2 2
MIRT723470 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT732447 STAT3 signal transducer and activator of transcription 3 2 0
MIRT733631 SIRT1 sirtuin 1 3 0
MIRT733632 CCND1 cyclin D1 3 0
MIRT736012 RHEB Ras homolog, mTORC1 binding 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1301 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901)
hsa-mir-1301 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-1301 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-1301 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-1301 Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-1301 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-1301 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-1301 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-1301 Cisplatin 5460033 NSC119875 approved resistant cell line (SGC-7901)
hsa-mir-1301 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-1301-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-1301-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-1301-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-1301-3p Plx-4720 24180719 NSC757438 sensitive High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-1301-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved sensitive High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-1301-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1301-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer tissue
hsa-miR-1301-3p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer tissue
hsa-miR-1301-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (2uM)
hsa-miR-1301-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-1301-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (2uM)
hsa-miR-1301-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-1301-3p Epirubicin 41867 NSC256942 approved sensitive Low Osteosarcoma cell line (U-2-OS, SAOS-2)
hsa-miR-1301-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901, BGC-823)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1301-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved sensitive High Epithelial Ovarian Cancer cell line (SKOV3)
hsa-miR-1301-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1301-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1301-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-1301-3p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-1301-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1301-3p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-1301-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-1301-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission