miRTarBase - #MIRT035981


—
pre-miRNA Information
pre-miRNA hsa-mir-1301   
Genomic Coordinates chr2: 25328640 - 25328721
Synonyms MIRN1301, hsa-mir-1301, MIR1301
Description Homo sapiens miR-1301 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1301-3p
Sequence 48| UUGCAGCUGCCUGGGAGUGACUUC |71
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 2 - 25328670 26449202, 27298257, 28411194, 28550310, 28855684, 29267965, 29950133, 29165639, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs775188648 6 dbSNP
rs1022364375 11 dbSNP
rs938368115 12 dbSNP
rs771728471 15 dbSNP
rs778709428 19 dbSNP
rs1358947891 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MDH2   
Synonyms EIEE51, M-MDH, MDH, MGC:3559, MOR1
Description malate dehydrogenase 2
Transcript NM_005918   
Expression
Putative miRNA Targets on MDH2
3'UTR of MDH2
(miRNA target sites are highlighted)		 
>MDH2|NM_005918|3'UTR
   1 GCCGCTGTGACGGGTGGCCAGTTTCCTTAATTTATGAAGGCATCATGTCACTGCAAAGCCGTTGCAGATAAACTTTGTAT
  81 TTTAATTTGCTTTGGTGATGATTACTGTATTGACATCATCATGCCTTCCAAATTGTGGGTGGCTCTGTGGGCGCATCAAT
 161 AAAAGCCGTCCTTGATTTTATTTTTCAAGGTCCCTTCTGTAAATGCTGTGCTTTCTTCCCTGTGAGAGCCAACTTTAGAG
 241 TGTCTGCTACCTCTTCATTACCAATCAGAATTAGATGATGTTTAACTGTTAGACTGAAGCGTGACGCTTTCATCAGTAGC
 321 TTCAAGAAAGTCTAAATTGTTAATTTATGGAATTGGACACAGTATTCAGTTTACCCGTACATGCTCCTCCCGCCCCTCCT
 401 GTTGGCACCCTTGCATCGCCCAGGCCTGATTCCTCCTGGGGGTAGTTCACCCCCACGGGTTCATAGTTCAGCGGCGAATG
 481 CCAGGCAGCTGTTTTCTGGCTGAGCAAACAGCACCTTTCTCATTGAGCTTCCTCTACTGACCTCTGTCCCCCTTGGGATT
 561 TCATCTTCTGACCGAACCCTGATGTTCAGTGGCAGAGACAGCCCATAGCCAGAACTGTGGGTAGACCAGGGTTGGGGTGT
 641 GCGGTTTGGGACAGCCCAAACCCCAGCCGCTGTGTCAAGGCCTAGGACGCCATGCTGCCATCAAAAGGGGGTTCCAGGTT
 721 TCCATCAGTGGCCTAAAGAAGGGACTTCTTGTTGTACTGAGGAGTGCGGAATTAAAGAGATTTGACTCCCTTTAGTATTG
 801 GGGGCAGTCCGTTCCCCAGACACTGTGGCCTCTGAAGTGGAAACTGAAAGCTGCATACCTGGGAAAGAACTTTCTAGGAA
 881 TAGGCAATGGCCTTCAGTGGAAGAGGGAGGGCTGGAGGTGTGCCCAGTACTTGGATGTTCATCTGTCCACAACAGCTTTT
 961 TGTTTTTTTAAAAAAGCTAAAATGGAAATGGATTTTATCATAAAGGATGACATCGTTTTCTTCTACAATTAATACATGTT
1041 CATTGTATAAAACCCAAAAAGCAGCTAAAAAATAAAGCGGGAAAGGAACTACTGGTAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuucagugaggGUCCGUCGACGUu 5'
                     | |  ||||||| 
Target 5' tgaagtggaaaCTGAAAGCTGCAt 3'
 833 - 856 141.00 -15.90
2 
miRNA  3' cuucagUGAGGGUCCGUCGACGuu 5'
                | | |||||||||||:  
Target 5' gcggcgAATGCCAGGCAGCTGTtt 3'
 471 - 494 138.00 -23.30
3 
miRNA  3' cuuCAGUGAGGGUCCGUCGACGUu 5'
             |||||| | | || |:|||| 
Target 5' catGTCACTGCAAAGCCGTTGCAg 3'
 44 - 67 133.00 -18.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31540233 12 COSMIC
COSN28189308 62 COSMIC
COSN30130465 70 COSMIC
COSN14744726 104 COSMIC
COSN30133898 175 COSMIC
COSN5662874 236 COSMIC
COSN2234898 245 COSMIC
COSM3703275 256 COSMIC
COSN16472669 288 COSMIC
COSN15449098 404 COSMIC
COSM5802099 417 COSMIC
COSM5791818 421 COSMIC
COSN6891659 661 COSMIC
COSN25857940 953 COSMIC
COSN26883765 1089 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs370821454 4 dbSNP
rs200200341 5 dbSNP
rs781988454 10 dbSNP
rs782097077 12 dbSNP
rs1426273611 13 dbSNP
rs1263166494 17 dbSNP
rs920369198 20 dbSNP
rs1482684235 21 dbSNP
rs1241694832 30 dbSNP
rs201988434 34 dbSNP
rs368038976 36 dbSNP
rs782729848 46 dbSNP
rs1324708416 61 dbSNP
rs532779141 63 dbSNP
rs1258022544 68 dbSNP
rs1225845724 71 dbSNP
rs184232622 80 dbSNP
rs142499068 81 dbSNP
rs1395684677 90 dbSNP
rs1380930976 92 dbSNP
rs1338941872 96 dbSNP
rs1047487774 97 dbSNP
rs1406517393 106 dbSNP
rs552157423 107 dbSNP
rs1460370687 110 dbSNP
rs570486382 118 dbSNP
rs1374292408 123 dbSNP
rs781913637 145 dbSNP
rs528578207 146 dbSNP
rs782135077 146 dbSNP
rs950211741 152 dbSNP
rs1185017924 153 dbSNP
rs1462082487 154 dbSNP
rs1194620113 160 dbSNP
rs1481873502 161 dbSNP
rs188846520 168 dbSNP
rs782728859 169 dbSNP
rs3815457 181 dbSNP
rs1317495692 188 dbSNP
rs1246928930 191 dbSNP
rs1383302215 193 dbSNP
rs1327867120 198 dbSNP
rs1389615662 201 dbSNP
rs1398616550 212 dbSNP
rs1298672484 223 dbSNP
rs1457003742 232 dbSNP
rs191822966 237 dbSNP
rs1363140160 247 dbSNP
rs1165106456 252 dbSNP
rs1639614 262 dbSNP
rs183953258 265 dbSNP
rs1421247536 293 dbSNP
rs1251921095 296 dbSNP
rs1209745721 301 dbSNP
rs1489887508 301 dbSNP
rs1293996773 302 dbSNP
rs1032962917 304 dbSNP
rs539695292 306 dbSNP
rs1277987375 307 dbSNP
rs1054336 308 dbSNP
rs527880684 309 dbSNP
rs753562444 310 dbSNP
rs1337275590 335 dbSNP
rs1010294828 337 dbSNP
rs1404206065 338 dbSNP
rs1363201541 339 dbSNP
rs1304361439 341 dbSNP
rs1424727589 345 dbSNP
rs1029709278 349 dbSNP
rs1383876767 354 dbSNP
rs954712298 360 dbSNP
rs1455722515 361 dbSNP
rs1364693660 367 dbSNP
rs1198820075 370 dbSNP
rs987315714 371 dbSNP
rs1479706595 374 dbSNP
rs1271162530 376 dbSNP
rs114243662 377 dbSNP
rs1487999346 378 dbSNP
rs1282466578 381 dbSNP
rs1207094027 382 dbSNP
rs1352598882 388 dbSNP
rs781901989 392 dbSNP
rs1222828004 393 dbSNP
rs189470139 402 dbSNP
rs1343501207 404 dbSNP
rs1285110184 414 dbSNP
rs572862619 417 dbSNP
rs540359595 418 dbSNP
rs114654157 419 dbSNP
rs782515478 425 dbSNP
rs1386144992 434 dbSNP
rs1176083552 437 dbSNP
rs920273905 443 dbSNP
rs575020969 444 dbSNP
rs559197773 450 dbSNP
rs1432173786 454 dbSNP
rs1177750120 457 dbSNP
rs1477566295 458 dbSNP
rs3801471 461 dbSNP
rs1447732618 465 dbSNP
rs1262184922 470 dbSNP
rs114227668 473 dbSNP
rs782492501 474 dbSNP
rs916997707 476 dbSNP
rs1223987947 477 dbSNP
rs1267829142 492 dbSNP
rs1432471917 497 dbSNP
rs1326712581 500 dbSNP
rs1335674338 503 dbSNP
rs1450970473 507 dbSNP
rs1408734762 512 dbSNP
rs950302505 516 dbSNP
rs1409858832 518 dbSNP
rs1044551918 530 dbSNP
rs370028991 533 dbSNP
rs1169667805 542 dbSNP
rs927566136 549 dbSNP
rs1384890292 551 dbSNP
rs1181954550 553 dbSNP
rs1459828855 561 dbSNP
rs936270761 572 dbSNP
rs1054613403 574 dbSNP
rs150969910 575 dbSNP
rs1010160651 582 dbSNP
rs1051653208 596 dbSNP
rs891210225 600 dbSNP
rs201721948 619 dbSNP
rs1339443328 621 dbSNP
rs1313991798 626 dbSNP
rs1243264028 629 dbSNP
rs1009172101 634 dbSNP
rs1316089395 644 dbSNP
rs1442136057 645 dbSNP
rs1353330066 657 dbSNP
rs145909614 661 dbSNP
rs371921624 661 dbSNP
rs1017449268 663 dbSNP
rs964515411 669 dbSNP
rs1161936456 670 dbSNP
rs1446598274 671 dbSNP
rs994757109 680 dbSNP
rs1027537182 681 dbSNP
rs375547096 689 dbSNP
rs1182288512 690 dbSNP
rs1469430215 692 dbSNP
rs10476 693 dbSNP
rs1206513910 700 dbSNP
rs1483111776 701 dbSNP
rs1290349136 712 dbSNP
rs1219806787 715 dbSNP
rs140771504 717 dbSNP
rs1292035336 718 dbSNP
rs782522008 732 dbSNP
rs1371603368 740 dbSNP
rs1281803283 744 dbSNP
rs782682998 745 dbSNP
rs1344969575 746 dbSNP
rs1301306848 750 dbSNP
rs1426609426 751 dbSNP
rs1366498955 756 dbSNP
rs782236218 758 dbSNP
rs1399950364 760 dbSNP
rs1405466083 761 dbSNP
rs1178913302 764 dbSNP
rs927503406 768 dbSNP
rs936132039 769 dbSNP
rs1267574647 781 dbSNP
rs528445886 786 dbSNP
rs1490696006 791 dbSNP
rs1265712716 793 dbSNP
rs372591277 793 dbSNP
rs1214570787 797 dbSNP
rs1315537272 800 dbSNP
rs1054643408 811 dbSNP
rs1323515158 812 dbSNP
rs1281921910 814 dbSNP
rs1406883683 824 dbSNP
rs1346210674 825 dbSNP
rs546736236 830 dbSNP
rs1288537747 843 dbSNP
rs144785944 850 dbSNP
rs1343223457 852 dbSNP
rs1160950068 854 dbSNP
rs1457561893 858 dbSNP
rs1428595315 860 dbSNP
rs1174143437 863 dbSNP
rs1481144586 871 dbSNP
rs1639615 872 dbSNP
rs8200 879 dbSNP
rs891090107 881 dbSNP
rs1006992642 882 dbSNP
rs1461120343 910 dbSNP
rs1261864050 919 dbSNP
rs1225841577 920 dbSNP
rs1312884780 924 dbSNP
rs1294865679 930 dbSNP
rs73705405 937 dbSNP
rs1364426234 941 dbSNP
rs1040151897 945 dbSNP
rs569003236 947 dbSNP
rs751754991 951 dbSNP
rs1334646999 957 dbSNP
rs1405019742 957 dbSNP
rs1377710733 963 dbSNP
rs1470876229 963 dbSNP
rs1169202469 964 dbSNP
rs900342474 970 dbSNP
rs994664096 971 dbSNP
rs180719846 978 dbSNP
rs1027612518 983 dbSNP
rs1461167159 991 dbSNP
rs950594540 1002 dbSNP
rs1206129145 1012 dbSNP
rs1483833460 1024 dbSNP
rs1251233791 1027 dbSNP
rs1202606667 1036 dbSNP
rs1309300607 1037 dbSNP
rs1298673062 1039 dbSNP
rs546348212 1041 dbSNP
rs568161379 1055 dbSNP
rs1381774693 1063 dbSNP
rs1312570345 1065 dbSNP
rs1397545684 1067 dbSNP
rs1402904527 1074 dbSNP
rs1297504568 1079 dbSNP
rs1460066257 1079 dbSNP
rs368696441 1080 dbSNP
rs1004983829 1082 dbSNP
rs3178329 1087 dbSNP
rs566522228 1088 dbSNP
rs1443566848 1095 dbSNP
rs971448321 1096 dbSNP
rs1383796016 1098 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD 0.326 0.01 0.389 0 50 Click to see details
ESCA 0.653 0.01 0.418 0.1 11 Click to see details
THCA -0.279 0.02 -0.300 0.01 59 Click to see details
LUSC 0.279 0.04 0.268 0.05 38 Click to see details
BRCA 0.186 0.05 0.159 0.07 84 Click to see details
KICH -0.245 0.12 -0.144 0.25 25 Click to see details
KIRC 0.136 0.13 0.148 0.11 68 Click to see details
LIHC -0.148 0.16 -0.161 0.13 49 Click to see details
CESC -0.862 0.17 -1.000 0.5 3 Click to see details
HNSC 0.142 0.18 0.037 0.41 42 Click to see details
KIRP -0.141 0.22 -0.162 0.19 32 Click to see details
PAAD -0.46 0.27 -0.800 0.1 4 Click to see details
CHOL -0.187 0.31 -0.233 0.27 9 Click to see details
UCEC -0.113 0.32 -0.098 0.34 19 Click to see details
BLCA -0.083 0.37 -0.125 0.31 18 Click to see details
PCPG 0.381 0.38 0.500 0.33 3 Click to see details
LUAD 0.093 0.39 0.147 0.32 12 Click to see details
STAD 0.046 0.4 0.072 0.35 32 Click to see details
COAD 0.027 0.47 -0.095 0.41 8 Click to see details
COAD 0.027 0.47 -0.095 0.41 8 Click to see details
COAD 0.027 0.47 -0.095 0.41 8 Click to see details
195 hsa-miR-1301-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035957 MRPL10 mitochondrial ribosomal protein L10 1 1
MIRT035958 ZNF816 zinc finger protein 816 1 1
MIRT035959 HDLBP high density lipoprotein binding protein 1 1
MIRT035960 GNG10 G protein subunit gamma 10 1 1
MIRT035961 MICALL1 MICAL like 1 1 1
MIRT035962 CCNH cyclin H 1 1
MIRT035963 RAD23B RAD23 homolog B, nucleotide excision repair protein 1 1
MIRT035964 HIST2H2AC histone cluster 2 H2A family member c 1 1
MIRT035965 PARL presenilin associated rhomboid like 1 1
MIRT035966 TXN thioredoxin 1 1
MIRT035967 CREBBP CREB binding protein 1 1
MIRT035968 CYTB cytochrome b 1 1
MIRT035969 GLI3 GLI family zinc finger 3 1 1
MIRT035970 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 1 1
MIRT035971 PREP prolyl endopeptidase 1 1
MIRT035972 COL6A1 collagen type VI alpha 1 chain 1 1
MIRT035973 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT035974 ADCY3 adenylate cyclase 3 1 1
MIRT035975 POLB DNA polymerase beta 1 1
MIRT035976 HMGA1 high mobility group AT-hook 1 1 1
MIRT035977 SKP1 S-phase kinase associated protein 1 1 1
MIRT035978 ADD2 adducin 2 1 1
MIRT035979 ANXA11 annexin A11 1 1
MIRT035980 CORO1C coronin 1C 1 1
MIRT035981 MDH2 malate dehydrogenase 2 1 1
MIRT035982 BICD2 BICD cargo adaptor 2 1 1
MIRT035983 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT035984 CDK5RAP2 CDK5 regulatory subunit associated protein 2 1 1
MIRT035985 POLR3H RNA polymerase III subunit H 1 1
MIRT035986 COX1 cytochrome c oxidase subunit I 1 1
MIRT035987 HEATR2 dynein axonemal assembly factor 5 1 1
MIRT035988 RPS5 ribosomal protein S5 1 1
MIRT035989 CCT3 chaperonin containing TCP1 subunit 3 1 1
MIRT035990 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 1 1
MIRT035991 RPL3 ribosomal protein L3 1 1
MIRT035992 TMPO thymopoietin 1 1
MIRT035993 COPE coatomer protein complex subunit epsilon 1 1
MIRT035994 NONO non-POU domain containing octamer binding 1 1
MIRT035995 BLCAP bladder cancer associated protein 1 1
MIRT035996 NUP133 nucleoporin 133 1 1
MIRT035997 VCP valosin containing protein 1 1
MIRT035998 ARIH2 ariadne RBR E3 ubiquitin protein ligase 2 1 1
MIRT035999 SON SON DNA binding protein 1 1
MIRT036000 ATP5J ATP synthase, H+ transporting, mitochondrial Fo complex subunit F6 1 1
MIRT036001 VIM vimentin 1 1
MIRT036002 FKBP8 FK506 binding protein 8 1 1
MIRT036003 SPECC1L sperm antigen with calponin homology and coiled-coil domains 1 like 1 1
MIRT036004 ZCCHC14 zinc finger CCHC-type containing 14 1 1
MIRT036005 TXNL4A thioredoxin like 4A 1 1
MIRT036006 UBE2J2 ubiquitin conjugating enzyme E2 J2 1 1
MIRT036007 FOPNL FGFR1OP N-terminal like 1 1
MIRT036008 VDAC1 voltage dependent anion channel 1 1 1
MIRT036009 CDIP1 cell death inducing p53 target 1 1 1
MIRT036010 EBNA1BP2 EBNA1 binding protein 2 1 1
MIRT036011 CD276 CD276 molecule 1 1
MIRT036012 RPS2 ribosomal protein S2 1 1
MIRT036013 USP28 ubiquitin specific peptidase 28 1 1
MIRT036014 ZMIZ1 zinc finger MIZ-type containing 1 1 1
MIRT036015 B4GALT7 beta-1,4-galactosyltransferase 7 1 1
MIRT036016 CAND1 cullin associated and neddylation dissociated 1 1 1
MIRT036017 CCDC104 cilia and flagella associated protein 36 1 1
MIRT036018 IMPDH1 inosine monophosphate dehydrogenase 1 1 1
MIRT036019 ATXN2L ataxin 2 like 1 1
MIRT036020 PARP1 poly(ADP-ribose) polymerase 1 1 1
MIRT036021 TNXB tenascin XB 1 1
MIRT036022 SYNGR1 synaptogyrin 1 1 1
MIRT036023 TUT1 terminal uridylyl transferase 1, U6 snRNA-specific 1 1
MIRT036024 ATXN7L3B ataxin 7 like 3B 1 1
MIRT036025 BCL2L13 BCL2 like 13 1 1
MIRT036026 RBM42 RNA binding motif protein 42 1 1
MIRT036027 HDGF heparin binding growth factor 1 1
MIRT036028 NAT8L N-acetyltransferase 8 like 1 1
MIRT036029 DLST dihydrolipoamide S-succinyltransferase 1 1
MIRT036030 CEP104 centrosomal protein 104 1 1
MIRT036031 NCOR1 nuclear receptor corepressor 1 1 1
MIRT036032 COCH cochlin 1 1
MIRT036033 NUTF2 nuclear transport factor 2 1 1
MIRT036034 KMT2E lysine methyltransferase 2E 1 1
MIRT036035 RANGAP1 Ran GTPase activating protein 1 1 1
MIRT036036 SEPHS2 selenophosphate synthetase 2 1 1
MIRT036037 DYNC1I2 dynein cytoplasmic 1 intermediate chain 2 1 1
MIRT036038 ZCCHC24 zinc finger CCHC-type containing 24 1 1
MIRT036039 TRRAP transformation/transcription domain associated protein 1 1
MIRT036040 INPP4A inositol polyphosphate-4-phosphatase type I A 1 1
MIRT036041 CHN1 chimerin 1 1 1
MIRT036042 FECH ferrochelatase 1 1
MIRT036043 DCTD dCMP deaminase 1 1
MIRT036044 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT036045 PKM pyruvate kinase, muscle 1 1
MIRT036046 SSRP1 structure specific recognition protein 1 1 1
MIRT036047 CELF1 CUGBP Elav-like family member 1 1 1
MIRT036048 TSR2 TSR2, ribosome maturation factor 1 1
MIRT036049 TP53BP2 tumor protein p53 binding protein 2 1 1
MIRT036050 GSG2 histone H3 associated protein kinase 1 1
MIRT036051 WDFY1 WD repeat and FYVE domain containing 1 1 1
MIRT036052 RPA1 replication protein A1 1 1
MIRT036053 TMEM41A transmembrane protein 41A 1 1
MIRT036054 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT036055 NOP2 NOP2 nucleolar protein 1 1
MIRT036056 PEF1 penta-EF-hand domain containing 1 1 1
MIRT036057 CYB5D1 cytochrome b5 domain containing 1 1 1
MIRT036058 HIGD1A HIG1 hypoxia inducible domain family member 1A 1 1
MIRT036059 WDR61 WD repeat domain 61 1 1
MIRT036060 MINK1 misshapen like kinase 1 1 1
MIRT036061 RPL35A ribosomal protein L35a 1 1
MIRT036062 WNT3 Wnt family member 3 1 1
MIRT036063 SYNJ2 synaptojanin 2 1 1
MIRT036064 CFL1 cofilin 1 1 1
MIRT036065 ALDOA aldolase, fructose-bisphosphate A 1 1
MIRT036066 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 1 1
MIRT064841 ZBTB18 zinc finger and BTB domain containing 18 2 4
MIRT090782 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT163227 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 2
MIRT214143 LMNB1 lamin B1 2 2
MIRT291875 ZNF333 zinc finger protein 333 2 2
MIRT292477 ZNF507 zinc finger protein 507 2 2
MIRT306035 SKIL SKI like proto-oncogene 2 2
MIRT443004 TRIOBP TRIO and F-actin binding protein 2 2
MIRT457830 ITPRIP inositol 1,4,5-trisphosphate receptor interacting protein 2 2
MIRT460067 RFTN2 raftlin family member 2 2 2
MIRT460342 ARL14EP ADP ribosylation factor like GTPase 14 effector protein 2 2
MIRT463060 ZNF639 zinc finger protein 639 2 2
MIRT466204 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT476159 GOLGA8B golgin A8 family member B 2 2
MIRT486953 HLA-B major histocompatibility complex, class I, B 2 2
MIRT492391 SEMA6A semaphorin 6A 2 2
MIRT495050 CTRC chymotrypsin C 2 4
MIRT500010 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501565 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT502680 CSNK1G3 casein kinase 1 gamma 3 2 8
MIRT503058 CAB39 calcium binding protein 39 2 2
MIRT504615 PLK1 polo like kinase 1 2 2
MIRT505706 SESN2 sestrin 2 2 2
MIRT506197 PHF19 PHD finger protein 19 2 2
MIRT506821 KIF23 kinesin family member 23 2 6
MIRT513782 PAWR pro-apoptotic WT1 regulator 2 6
MIRT527011 MAGI2 membrane associated guanylate kinase, WW and PDZ domain containing 2 2 4
MIRT527806 KLRD1 killer cell lectin like receptor D1 2 2
MIRT537896 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 4
MIRT537925 DST dystonin 2 2
MIRT540049 FOXC1 forkhead box C1 2 2
MIRT543395 DROSHA drosha ribonuclease III 2 2
MIRT545447 SC5D sterol-C5-desaturase 2 4
MIRT546876 RAB10 RAB10, member RAS oncogene family 2 4
MIRT549419 ACVR2B activin A receptor type 2B 2 2
MIRT551857 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT552453 ZNF410 zinc finger protein 410 2 2
MIRT552772 YIPF6 Yip1 domain family member 6 2 4
MIRT552788 YAF2 YY1 associated factor 2 2 2
MIRT554247 SLAIN2 SLAIN motif family member 2 2 2
MIRT554773 RHEBP1 RHEB pseudogene 1 2 4
MIRT555862 PAIP1 poly(A) binding protein interacting protein 1 2 2
MIRT556475 LIPA lipase A, lysosomal acid type 2 2
MIRT556655 KMT2D lysine methyltransferase 2D 2 4
MIRT558210 EFCAB14 EF-hand calcium binding domain 14 2 4
MIRT558306 DUSP14 dual specificity phosphatase 14 2 2
MIRT558818 CDCA4 cell division cycle associated 4 2 4
MIRT559370 ATP13A3 ATPase 13A3 2 2
MIRT559541 ARGLU1 arginine and glutamate rich 1 2 4
MIRT563022 ZNF680 zinc finger protein 680 2 2
MIRT563036 NBPF12 NBPF member 12 2 2
MIRT563791 SLC28A1 solute carrier family 28 member 1 2 2
MIRT565903 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT566957 LBR lamin B receptor 2 2
MIRT567971 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 2
MIRT570389 TSC22D2 TSC22 domain family member 2 2 2
MIRT575250 Timp3 tissue inhibitor of metalloproteinase 3 2 2
MIRT611519 ZNF25 zinc finger protein 25 2 2
MIRT611592 POTED POTE ankyrin domain family member D 2 2
MIRT614228 NPTXR neuronal pentraxin receptor 2 2
MIRT625933 SCYL3 SCY1 like pseudokinase 3 2 2
MIRT627320 TULP4 tubby like protein 4 2 2
MIRT631516 CTBS chitobiase 2 2
MIRT640705 MRS2 MRS2, magnesium transporter 2 2
MIRT642208 RUVBL2 RuvB like AAA ATPase 2 2 2
MIRT642767 FAM9C family with sequence similarity 9 member C 2 2
MIRT648411 KIAA0146 scaffolding protein involved in DNA repair 1 1
MIRT658045 FUT11 fucosyltransferase 11 2 2
MIRT663720 GLUL glutamate-ammonia ligase 2 2
MIRT698536 TFRC transferrin receptor 2 2
MIRT699988 RPS24 ribosomal protein S24 2 2
MIRT700433 PURB purine rich element binding protein B 2 2
MIRT705890 ADCY9 adenylate cyclase 9 2 2
MIRT706974 XPO5 exportin 5 2 2
MIRT710564 KIAA1958 KIAA1958 2 2
MIRT714070 RUNDC3B RUN domain containing 3B 2 2
MIRT716931 FAM13A family with sequence similarity 13 member A 2 2
MIRT717341 RAB40A RAB40A, member RAS oncogene family 2 2
MIRT717738 MYLK myosin light chain kinase 5 2
MIRT722963 SLC25A26 solute carrier family 25 member 26 2 2
MIRT723470 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT732447 STAT3 signal transducer and activator of transcription 3 2 0
MIRT733631 SIRT1 sirtuin 1 3 0
MIRT733632 CCND1 cyclin D1 3 0
MIRT736012 RHEB Ras homolog, mTORC1 binding 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1301 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901)
hsa-mir-1301 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-1301 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-1301 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-1301 Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-1301 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-1301 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-1301 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-mir-1301 Cisplatin 5460033 NSC119875 approved resistant cell line (SGC-7901)
hsa-mir-1301 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-1301-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-1301-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-1301-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-1301-3p Plx-4720 24180719 NSC757438 sensitive High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-1301-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved sensitive High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-1301-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1301-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer tissue
hsa-miR-1301-3p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer tissue
hsa-miR-1301-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (2uM)
hsa-miR-1301-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-1301-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (2uM)
hsa-miR-1301-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-1301-3p Epirubicin 41867 NSC256942 approved sensitive Low Osteosarcoma cell line (U-2-OS, SAOS-2)
hsa-miR-1301-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901, BGC-823)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1301-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved sensitive High Epithelial Ovarian Cancer cell line (SKOV3)
hsa-miR-1301-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1301-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1301-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-1301-3p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-1301-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1301-3p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-1301-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-1301-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-1301-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission