miRTarBase - #MIRT036265


—
pre-miRNA Information
pre-miRNA hsa-mir-1229   
Genomic Coordinates chr5: 179798278 - 179798346
Synonyms MIRN1229, hsa-mir-1229, MIR1229
Description Homo sapiens miR-1229 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1229-3p
Sequence 47| CUCUCACCACUGCCCUCCCACAG |69
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN20086841 1 COSMIC
COSN16303113 8 COSMIC
COSM6273761 14 COSMIC
COSM1066702 23 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs754734738 1 dbSNP
rs1479021409 8 dbSNP
rs200647784 9 dbSNP
rs1429872559 12 dbSNP
rs1373546432 13 dbSNP
rs766644214 15 dbSNP
rs758465824 18 dbSNP
rs1396376879 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPL7A   
Synonyms L7A, SURF3, TRUP
Description ribosomal protein L7a
Transcript NM_000972   
Expression
Putative miRNA Targets on RPL7A
3'UTR of RPL7A
(miRNA target sites are highlighted)		 
>RPL7A|NM_000972|3'UTR
   1 ATGTACACTGTTGAGTTTTCTGTACATAAAAATAATTGAAATAATACAAATTTTCCTTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacacccucccGUCACCACUCuc 5'
                     || || ||||  
Target 5' ------atgtaCACTGTTGAGtt 3'
 1 - 17 100.00 -5.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31524866 59 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1220822488 2 dbSNP
rs367862594 3 dbSNP
rs781944519 5 dbSNP
rs782454828 7 dbSNP
rs1260756976 8 dbSNP
rs782583793 8 dbSNP
rs143163645 9 dbSNP
rs1486631770 9 dbSNP
rs1297150757 10 dbSNP
rs1247669574 11 dbSNP
rs1254812175 11 dbSNP
rs782541264 12 dbSNP
rs1190720800 15 dbSNP
rs1393831935 16 dbSNP
rs782651920 21 dbSNP
rs1209482898 22 dbSNP
rs1349240319 24 dbSNP
rs1423313414 25 dbSNP
rs782250058 26 dbSNP
rs782490062 27 dbSNP
rs1448619961 28 dbSNP
rs782639779 30 dbSNP
rs1320258400 33 dbSNP
rs1225863551 38 dbSNP
rs1307352682 42 dbSNP
rs782584723 43 dbSNP
rs1216597561 44 dbSNP
rs782175497 47 dbSNP
rs782412823 49 dbSNP
rs1376429817 50 dbSNP
rs782236911 52 dbSNP
rs1314724569 56 dbSNP
rs966191564 57 dbSNP
rs1044416686 58 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla -0.786 7.2e-4 -0.731 2.3e-3 13 Click to see details
GSE28544 Breast cancer 0.434 1.7e-2 0.205 1.7e-1 24 Click to see details
GSE14794 Lymphoblastoid cells -0.18 4.5e-2 -0.131 1.1e-1 90 Click to see details
GSE19536 Breast cancer -0.168 4.7e-2 -0.208 1.9e-2 100 Click to see details
GSE26953 Aortic valvular endothelial cells 0.315 6.7e-2 0.364 4.0e-2 24 Click to see details
GSE19783 ER+ ER+ breast cancer 0.343 6.9e-2 0.564 4.8e-3 20 Click to see details
GSE42095 Differentiated embryonic stem cells -0.305 7.9e-2 -0.137 2.7e-1 23 Click to see details
GSE19783 ER- ER- breast cancer -0.158 8.2e-2 -0.176 6.0e-2 79 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.269 1.3e-1 0.365 5.7e-2 20 Click to see details
GSE21687 Ependynoma primary tumors -0.142 1.3e-1 -0.138 1.4e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.171 2.1e-1 -0.062 3.8e-1 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.3 2.2e-1 -0.450 1.1e-1 9 Click to see details
GSE38226 Liver fibrosis 0.168 2.3e-1 0.094 3.4e-1 21 Click to see details
GSE19350 CNS germ cell tumors 0.173 3.0e-1 0.005 4.9e-1 12 Click to see details
GSE21032 Prostate cancer 0.056 3.1e-1 0.063 2.9e-1 83 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.021 4.6e-1 0.030 4.4e-1 25 Click to see details
GSE32688 Pancreatic cancer -0.018 4.6e-1 0.044 4.1e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.952 0.02 1.000 0.5 4 Click to see details
LIHC -0.3 0.05 -0.287 0.06 30 Click to see details
STAD -0.384 0.07 -0.471 0.03 16 Click to see details
PRAD -0.735 0.08 -0.700 0.09 5 Click to see details
KIRP 0.29 0.08 0.538 0 24 Click to see details
HNSC -0.383 0.14 -0.321 0.18 10 Click to see details
UCEC -0.317 0.2 -0.133 0.37 9 Click to see details
COAD -0.593 0.2 -0.800 0.1 4 Click to see details
BLCA -0.408 0.21 -0.200 0.35 6 Click to see details
BRCA -0.105 0.25 -0.127 0.21 42 Click to see details
KICH -0.152 0.31 -0.126 0.34 13 Click to see details
CHOL 0.223 0.39 0.200 0.4 4 Click to see details
LUAD 0.219 0.39 0.200 0.4 4 Click to see details
LUSC -0.058 0.4 -0.084 0.36 21 Click to see details
THCA 0.005 0.49 0.012 0.47 34 Click to see details
KIRC -0.001 0.5 0.062 0.33 51 Click to see details
KIRC -0.001 0.5 0.062 0.33 51 Click to see details
KIRC -0.001 0.5 0.062 0.33 51 Click to see details
KIRC -0.001 0.5 0.062 0.33 51 Click to see details
KIRC -0.001 0.5 0.062 0.33 51 Click to see details
KIRC -0.001 0.5 0.062 0.33 51 Click to see details
196 hsa-miR-1229-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT036258 VWA8 von Willebrand factor A domain containing 8 1 1
MIRT036259 SORBS3 sorbin and SH3 domain containing 3 1 1
MIRT036260 HIST1H3A histone cluster 1 H3 family member a 1 1
MIRT036261 TIA1 TIA1 cytotoxic granule associated RNA binding protein 1 1
MIRT036262 COIL coilin 1 1
MIRT036263 PBRM1 polybromo 1 1 1
MIRT036264 KRT28 keratin 28 1 1
MIRT036265 RPL7A ribosomal protein L7a 1 1
MIRT036266 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT036267 CEP152 centrosomal protein 152 1 1
MIRT036268 CPT1B carnitine palmitoyltransferase 1B 1 1
MIRT036269 CEP55 centrosomal protein 55 1 1
MIRT036270 ZMYM2 zinc finger MYM-type containing 2 1 1
MIRT036271 CRISP3 cysteine rich secretory protein 3 1 1
MIRT036272 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT036273 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT036274 PHRF1 PHD and ring finger domains 1 1 1
MIRT036275 RPL3 ribosomal protein L3 1 1
MIRT036276 CSDE1 cold shock domain containing E1 1 1
MIRT036277 PTPRF protein tyrosine phosphatase, receptor type F 1 1
MIRT036278 ZNF264 zinc finger protein 264 1 1
MIRT036279 AHCYL1 adenosylhomocysteinase like 1 1 1
MIRT036280 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT036281 INTS10 integrator complex subunit 10 1 1
MIRT036282 TARDBP TAR DNA binding protein 1 1
MIRT036283 CTNND1 catenin delta 1 1 1
MIRT036284 KCTD15 potassium channel tetramerization domain containing 15 1 1
MIRT036285 CEP350 centrosomal protein 350 1 1
MIRT036286 C19orf10 myeloid derived growth factor 1 1
MIRT036287 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT036288 CHCHD2 coiled-coil-helix-coiled-coil-helix domain containing 2 1 1
MIRT036289 POLR2D RNA polymerase II subunit D 1 1
MIRT036290 PHC1 polyhomeotic homolog 1 1 1
MIRT036291 HNRNPD heterogeneous nuclear ribonucleoprotein D 1 1
MIRT036292 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 1 1
MIRT036293 AIF1L allograft inflammatory factor 1 like 1 1
MIRT036294 NEU3 neuraminidase 3 1 1
MIRT036295 DCTD dCMP deaminase 1 1
MIRT036296 TUBA1B tubulin alpha 1b 1 1
MIRT036297 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT036298 ACOT7 acyl-CoA thioesterase 7 1 1
MIRT036299 MDK midkine 1 1
MIRT036300 INO80D INO80 complex subunit D 1 1
MIRT036301 LDOC1L retrotransposon Gag like 6 1 1
MIRT036302 C2orf44 WD repeat and coiled coil containing 1 1
MIRT036303 SRCAP Snf2 related CREBBP activator protein 1 1
MIRT036304 EPB41L2 erythrocyte membrane protein band 4.1 like 2 1 1
MIRT036305 REXO2 RNA exonuclease 2 1 1
MIRT036306 CTNNBL1 catenin beta like 1 1 1
MIRT036307 SAFB scaffold attachment factor B 1 1
MIRT036308 PPP6R1 protein phosphatase 6 regulatory subunit 1 1 1
MIRT036309 FEN1 flap structure-specific endonuclease 1 1 1
MIRT036310 LRBA LPS responsive beige-like anchor protein 1 1
MIRT036311 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT036312 DAG1 dystroglycan 1 1 1
MIRT036313 HYPK huntingtin interacting protein K 1 1
MIRT036314 HIST1H4C histone cluster 1 H4 family member c 1 1
MIRT036315 CDC42EP4 CDC42 effector protein 4 1 1
MIRT036316 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT036317 GTF2I general transcription factor IIi 1 1
MIRT036318 RPGRIP1L RPGRIP1 like 1 1
MIRT036319 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT036320 TRRAP transformation/transcription domain associated protein 1 1
MIRT036321 PHF8 PHD finger protein 8 1 1
MIRT036322 TSC22D3 TSC22 domain family member 3 1 1
MIRT036323 MPP2 membrane palmitoylated protein 2 1 1
MIRT036324 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT036325 ALS2 ALS2, alsin Rho guanine nucleotide exchange factor 1 1
MIRT036326 KMT2D lysine methyltransferase 2D 1 1
MIRT036327 ITGA5 integrin subunit alpha 5 1 1
MIRT036328 ABCC5 ATP binding cassette subfamily C member 5 1 1
MIRT036329 KIF24 kinesin family member 24 1 1
MIRT036330 PPP4C protein phosphatase 4 catalytic subunit 1 1
MIRT036331 FMNL2 formin like 2 1 1
MIRT036332 NF2 neurofibromin 2 1 1
MIRT036333 NUP210 nucleoporin 210 1 1
MIRT036334 CTDNEP1 CTD nuclear envelope phosphatase 1 1 1
MIRT036335 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 1
MIRT036336 CTCF CCCTC-binding factor 1 1
MIRT036337 LRIT1 leucine rich repeat, Ig-like and transmembrane domains 1 1 1
MIRT036338 SFPQ splicing factor proline and glutamine rich 1 1
MIRT036339 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT036340 NAPEPLD N-acyl phosphatidylethanolamine phospholipase D 1 1
MIRT036341 SLC39A7 solute carrier family 39 member 7 1 1
MIRT036342 KDM5C lysine demethylase 5C 1 1
MIRT036343 ACLY ATP citrate lyase 1 1
MIRT036344 MED19 mediator complex subunit 19 1 1
MIRT036345 SRP72 signal recognition particle 72 1 1
MIRT036346 RUVBL2 RuvB like AAA ATPase 2 1 1
MIRT036347 CLSTN3 calsyntenin 3 1 1
MIRT036348 SAE1 SUMO1 activating enzyme subunit 1 1 1
MIRT036349 TUBG1 tubulin gamma 1 1 1
MIRT036350 FOXP1 forkhead box P1 1 1
MIRT036351 ZNF687 zinc finger protein 687 1 1
MIRT036352 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 1 1
MIRT036353 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
MIRT036354 RNF40 ring finger protein 40 1 1
MIRT036355 KPNB1 karyopherin subunit beta 1 1 1
MIRT036356 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT036357 DDX23 DEAD-box helicase 23 1 1
MIRT036358 BET1L Bet1 golgi vesicular membrane trafficking protein like 1 1
MIRT036359 BRD2 bromodomain containing 2 1 1
MIRT036360 EML1 echinoderm microtubule associated protein like 1 1 1
MIRT036361 BAP1 BRCA1 associated protein 1 1 1
MIRT036362 STAT5B signal transducer and activator of transcription 5B 1 1
MIRT036363 SUPT5H SPT5 homolog, DSIF elongation factor subunit 1 1
MIRT036364 GPI glucose-6-phosphate isomerase 1 1
MIRT036365 PTBP3 polypyrimidine tract binding protein 3 1 1
MIRT036366 RPS15 ribosomal protein S15 1 1
MIRT036367 ZDHHC7 zinc finger DHHC-type containing 7 1 1
MIRT036368 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 1 1
MIRT036369 SNX12 sorting nexin 12 1 1
MIRT036370 OTUD7B OTU deubiquitinase 7B 1 1
MIRT036371 AP2M1 adaptor related protein complex 2 mu 1 subunit 1 1
MIRT036372 C9orf114 SPOUT domain containing methyltransferase 1 1 1
MIRT036373 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT036374 FOXK1 forkhead box K1 1 1
MIRT036375 SIK2 salt inducible kinase 2 1 1
MIRT036376 SCD stearoyl-CoA desaturase 1 1
MIRT036377 PHGDH phosphoglycerate dehydrogenase 1 1
MIRT036378 PITPNB phosphatidylinositol transfer protein beta 1 1
MIRT036379 MAD2L2 mitotic arrest deficient 2 like 2 1 1
MIRT036380 TUSC3 tumor suppressor candidate 3 1 1
MIRT036381 PRKRIP1 PRKR interacting protein 1 1 1
MIRT036382 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT036383 NME2 NME/NM23 nucleoside diphosphate kinase 2 1 1
MIRT036384 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 1 1
MIRT036385 SLC16A13 solute carrier family 16 member 13 1 1
MIRT036386 PRDX4 peroxiredoxin 4 1 1
MIRT036387 NXPE3 neurexophilin and PC-esterase domain family member 3 1 1
MIRT036388 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 1 1
MIRT036389 CPNE1 copine 1 1 1
MIRT036390 PSMC5 proteasome 26S subunit, ATPase 5 1 1
MIRT036391 PAK4 p21 (RAC1) activated kinase 4 1 1
MIRT059262 CELF1 CUGBP Elav-like family member 1 2 2
MIRT061283 IPO7 importin 7 2 2
MIRT080097 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT345981 BIRC5 baculoviral IAP repeat containing 5 2 8
MIRT366471 KLHL15 kelch like family member 15 2 2
MIRT379534 HNRNPK heterogeneous nuclear ribonucleoprotein K 2 2
MIRT443697 HUNK hormonally up-regulated Neu-associated kinase 2 4
MIRT472347 NETO2 neuropilin and tolloid like 2 2 2
MIRT497842 GATA6 GATA binding protein 6 2 4
MIRT510408 ZNF268 zinc finger protein 268 2 4
MIRT519621 ZNF781 zinc finger protein 781 2 2
MIRT519830 ZFP69B ZFP69 zinc finger protein B 2 4
MIRT530712 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT530802 GPR182 G protein-coupled receptor 182 2 2
MIRT534374 SETD7 SET domain containing lysine methyltransferase 7 2 2
MIRT535541 P2RY2 purinergic receptor P2Y2 2 2
MIRT536016 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT556019 MYBL1 MYB proto-oncogene like 1 2 2
MIRT560009 ZNF525 zinc finger protein 525 2 2
MIRT560072 ZNF195 zinc finger protein 195 2 2
MIRT565948 RRAGD Ras related GTP binding D 2 2
MIRT570131 IL1RL2 interleukin 1 receptor like 2 2 2
MIRT570887 ZNF780A zinc finger protein 780A 2 4
MIRT609775 VWC2L von Willebrand factor C domain containing protein 2 like 2 4
MIRT611445 NRIP3 nuclear receptor interacting protein 3 2 2
MIRT611975 ZNF175 zinc finger protein 175 2 2
MIRT612871 IGFBP5 insulin like growth factor binding protein 5 2 4
MIRT613012 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT617515 PTDSS1 phosphatidylserine synthase 1 2 2
MIRT636095 ZDHHC22 zinc finger DHHC-type containing 22 2 2
MIRT637442 ZNF324B zinc finger protein 324B 2 2
MIRT638303 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT638920 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT640590 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT646760 WDR3 WD repeat domain 3 2 2
MIRT652591 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654866 PPL periplakin 2 2
MIRT654952 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT656021 MYO5B myosin VB 2 2
MIRT657078 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT657880 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT659231 CXCR5 C-X-C motif chemokine receptor 5 2 2
MIRT662904 MED18 mediator complex subunit 18 2 2
MIRT685610 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT687424 NRIP1 nuclear receptor interacting protein 1 2 2
MIRT692293 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT693749 ZNF383 zinc finger protein 383 2 2
MIRT695121 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695138 PRY PTPN13-like, Y-linked 2 2
MIRT709581 LETMD1 LETM1 domain containing 1 2 2
MIRT709737 TRIM27 tripartite motif containing 27 2 2
MIRT711058 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT714189 TRAF7 TNF receptor associated factor 7 2 2
MIRT715924 CHD4 chromodomain helicase DNA binding protein 4 2 2
MIRT719463 SRF serum response factor 2 2
MIRT720172 PANK2 pantothenate kinase 2 2 2
MIRT720456 RAB31 RAB31, member RAS oncogene family 2 2
MIRT721642 ZNF207 zinc finger protein 207 2 2
MIRT721996 CLLU1OS chronic lymphocytic leukemia up-regulated 1 opposite strand 2 2
MIRT722187 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 2 2
MIRT725196 PTRF caveolae associated protein 1 2 2
MIRT725518 FAM229B family with sequence similarity 229 member B 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1229 Progesterone approved 5994 Microarray Breast cancer 22330642 2012 down-regulated
miR-1229 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1229 Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1229 Fluorouracil 3385 NSC19893 approved sensitive cell line (KYSE)
hsa-miR-1229-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-1229-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-1229-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-1229-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-1229-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-1229-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1229-3p Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-1229-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-1229-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-1229-3p Fluorouracil 3385 NSC19893 approved resistant Low Gastric Cancer cell line (HGC-27, GFP-MKN45)
hsa-miR-1229-3p Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-1229-3p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-1229-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-1229-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-1229-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-1229-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1229-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-1229-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-1229-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1229-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission