miRTarBase - #MIRT036273


—
pre-miRNA Information
pre-miRNA hsa-mir-1229   
Genomic Coordinates chr5: 179798278 - 179798346
Synonyms MIRN1229, hsa-mir-1229, MIR1229
Description Homo sapiens miR-1229 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1229-3p
Sequence 47| CUCUCACCACUGCCCUCCCACAG |69
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN20086841 1 COSMIC
COSN16303113 8 COSMIC
COSM6273761 14 COSMIC
COSM1066702 23 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs754734738 1 dbSNP
rs1479021409 8 dbSNP
rs200647784 9 dbSNP
rs1429872559 12 dbSNP
rs1373546432 13 dbSNP
rs766644214 15 dbSNP
rs758465824 18 dbSNP
rs1396376879 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ADPRHL2   
Synonyms ARH3
Description ADP-ribosylhydrolase like 2
Transcript NM_017825   
Expression
Putative miRNA Targets on ADPRHL2
3'UTR of ADPRHL2
(miRNA target sites are highlighted)		 
>ADPRHL2|NM_017825|3'UTR
   1 TGAGGGCTACAGCTGTTGGGGCTCTGCCAGGTCCCCTGGGACCAACTACAGCTCCAATCAGAAACCCTGCGCTTCCTTGA
  81 GTGTGGCTTCCCACTTTTCCTGCATTGTGGAGCTGACTGAGTACACCGGTGAGGCTGGGGTCTCTGCAGGGGAGGTCACT
 161 GGAACAGCGAGCAAGGGACTGGTGCCTCGCTGGTGCTGGGTCTCTGGTTTGCTGCAGAGCCGTAGGACACTCCTGGCTCC
 241 TCAGTAGGACAGACAGACGCAGGCGGGTTTATTTTGGAGGGGTACTTGTGGCATTTTCCTGTATTGTCTTGGACATGGGA
 321 TGTGGGGAGGTGGAAATGATGAGCAGTAGCATCATTTCTCCCTGTTGGGTTTTAGCCAGTTTGCCAGCAAGCGCATCCTA
 401 GCAGGGTCCCCGAGCAGCAGGTTGTGTGGATGAAGGGACAGGCACTTGCATCCAGCTGATCTAGGTCACACCTGGCTCTT
 481 GGCTGCCATGTGGCTTATTAACAGCTTCCAGTGGAAGTCGCAATAAACAGTTTTTGGTAAATCTCAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacaccCUCCCGUCACCACUCUc 5'
                |||  ||  ||||||: 
Target 5' ctgactGAGTACACCGGTGAGGc 3'
 113 - 135 137.00 -13.70
2 
miRNA  3' gaCACCCUCCCGUC---ACCACUCuc 5'
            |||||: ||::|   || ||||  
Target 5' atGTGGGGAGGTGGAAATGATGAGca 3'
 320 - 345 121.00 -21.30
3 
miRNA  3' gacaccCUCCC---GUC-ACCACUCUc 5'
                |||||   ||| || ||:|: 
Target 5' -----tGAGGGCTACAGCTGTTGGGGc 3'
 1 - 22 101.00 -14.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30488374 15 COSMIC
COSN30532032 22 COSMIC
COSN32075889 25 COSMIC
COSN30530656 57 COSMIC
COSN13541406 72 COSMIC
COSN31544481 77 COSMIC
COSN30164707 96 COSMIC
COSN30131859 170 COSMIC
COSN30137134 189 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs927799465 1 dbSNP
rs1390530377 2 dbSNP
rs199766545 4 dbSNP
rs370323258 7 dbSNP
rs1246303339 11 dbSNP
rs554615991 12 dbSNP
rs1332622600 13 dbSNP
rs375098574 17 dbSNP
rs755555967 18 dbSNP
rs765659747 20 dbSNP
rs1220510286 21 dbSNP
rs1252032467 28 dbSNP
rs750787943 29 dbSNP
rs1194306366 32 dbSNP
rs1159926297 34 dbSNP
rs1269826366 35 dbSNP
rs763426981 36 dbSNP
rs567716077 37 dbSNP
rs118183123 44 dbSNP
rs754383396 45 dbSNP
rs1172191000 47 dbSNP
rs780772725 48 dbSNP
rs536830210 58 dbSNP
rs930295798 71 dbSNP
rs551168109 72 dbSNP
rs1456416682 74 dbSNP
rs558472367 76 dbSNP
rs1044762077 77 dbSNP
rs771497461 82 dbSNP
rs1351914717 87 dbSNP
rs1457666127 91 dbSNP
rs1043361664 93 dbSNP
rs1322817004 102 dbSNP
rs1329079824 103 dbSNP
rs905097396 105 dbSNP
rs1275289508 107 dbSNP
rs1346351023 128 dbSNP
rs926230199 129 dbSNP
rs1266275261 130 dbSNP
rs939298339 133 dbSNP
rs1209847336 135 dbSNP
rs1289780530 137 dbSNP
rs1450463385 138 dbSNP
rs1224200092 141 dbSNP
rs1455773138 149 dbSNP
rs1247708227 151 dbSNP
rs1472033896 153 dbSNP
rs1179604343 156 dbSNP
rs576720144 161 dbSNP
rs1162190169 169 dbSNP
rs540877243 169 dbSNP
rs1010243749 170 dbSNP
rs1411711923 176 dbSNP
rs1020317816 181 dbSNP
rs1323940598 189 dbSNP
rs1369740358 191 dbSNP
rs1409371318 194 dbSNP
rs560305250 205 dbSNP
rs111335009 222 dbSNP
rs1442745809 223 dbSNP
rs1000591876 224 dbSNP
rs1354836750 225 dbSNP
rs1230552822 231 dbSNP
rs1231305228 233 dbSNP
rs1008993282 247 dbSNP
rs1202515222 253 dbSNP
rs1253507226 255 dbSNP
rs1483214796 257 dbSNP
rs1039116339 259 dbSNP
rs900556182 260 dbSNP
rs995255554 262 dbSNP
rs953733520 264 dbSNP
rs1291775648 265 dbSNP
rs1473707605 265 dbSNP
rs1163779742 266 dbSNP
rs1027648959 268 dbSNP
rs921771377 269 dbSNP
rs931838752 272 dbSNP
rs984539410 277 dbSNP
rs1309697685 281 dbSNP
rs950714551 283 dbSNP
rs1481356098 289 dbSNP
rs1372611878 290 dbSNP
rs1392233945 295 dbSNP
rs1333535704 296 dbSNP
rs1004789102 302 dbSNP
rs1035319369 304 dbSNP
rs1316367490 304 dbSNP
rs1253251282 307 dbSNP
rs1226643688 311 dbSNP
rs1277259241 313 dbSNP
rs776758365 316 dbSNP
rs1199544009 327 dbSNP
rs1253409790 330 dbSNP
rs1443658672 351 dbSNP
rs1187709865 355 dbSNP
rs1475170786 361 dbSNP
rs1447626879 362 dbSNP
rs1170232430 363 dbSNP
rs1390586489 373 dbSNP
rs1462655249 385 dbSNP
rs990611408 393 dbSNP
rs1186356531 394 dbSNP
rs542787636 398 dbSNP
rs375692064 404 dbSNP
rs967781077 406 dbSNP
rs1406281875 408 dbSNP
rs1365062876 409 dbSNP
rs746701293 410 dbSNP
rs1433588687 411 dbSNP
rs2281804 412 dbSNP
rs375562901 413 dbSNP
rs934938135 416 dbSNP
rs768352268 417 dbSNP
rs550387479 422 dbSNP
rs1346768917 424 dbSNP
rs1203715588 431 dbSNP
rs1266998735 434 dbSNP
rs1463453552 440 dbSNP
rs776296872 444 dbSNP
rs1353554270 448 dbSNP
rs565439111 450 dbSNP
rs1376122132 453 dbSNP
rs1432396561 453 dbSNP
rs926329153 461 dbSNP
rs1045342 462 dbSNP
rs1381567334 464 dbSNP
rs1456073441 468 dbSNP
rs1213053007 473 dbSNP
rs939227537 485 dbSNP
rs1272671645 498 dbSNP
rs761610966 503 dbSNP
rs1299694838 504 dbSNP
rs892416917 509 dbSNP
rs1223776652 518 dbSNP
rs765288548 520 dbSNP
rs376234523 521 dbSNP
rs1485658008 522 dbSNP
rs1488152861 525 dbSNP
rs1208775463 527 dbSNP
rs900629960 529 dbSNP
rs1481513321 531 dbSNP
rs904587395 531 dbSNP
rs1200455378 533 dbSNP
rs1411245171 538 dbSNP
rs548074559 540 dbSNP
rs1471644866 544 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site 3'UTR
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacaCCCUC--CCGUCACCACUCuc 5'
              |||||  || | || ||||  
Target 5' --tgGGGAGGTGGAAATGATGAGca 3'
 		1 - 23
2 
miRNA  3' gacacccucccgucACCACUCuc 5'
                        || ||:|  
Target 5' gcatcatttctcccTGTTGGG-- 3'
 		27 - 47
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla -0.767 1.1e-3 -0.709 3.3e-3 13 Click to see details
GSE28544 Breast cancer 0.55 2.7e-3 0.415 2.2e-2 24 Click to see details
GSE38226 Liver fibrosis 0.536 6.1e-3 0.413 3.1e-2 21 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.626 3.6e-2 0.700 1.8e-2 9 Click to see details
GSE19350 CNS germ cell tumors -0.349 1.3e-1 -0.351 1.3e-1 12 Click to see details
GSE42095 Differentiated embryonic stem cells 0.2 1.8e-1 0.210 1.7e-1 23 Click to see details
GSE19783 ER- ER- breast cancer -0.09 2.2e-1 -0.065 2.8e-1 79 Click to see details
GSE21032 Prostate cancer 0.082 2.3e-1 0.063 2.9e-1 83 Click to see details
GSE21687 Ependynoma primary tumors -0.089 2.4e-1 -0.109 2.0e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.146 2.4e-1 0.258 1.1e-1 25 Click to see details
GSE19536 Breast cancer -0.06 2.8e-1 -0.036 3.6e-1 100 Click to see details
GSE14794 Lymphoblastoid cells -0.063 2.8e-1 -0.068 2.6e-1 90 Click to see details
GSE32688 Pancreatic cancer 0.088 3.2e-1 0.034 4.3e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.104 3.3e-1 -0.044 4.3e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.065 3.9e-1 -0.132 2.9e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.049 4.1e-1 -0.069 3.7e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.047 4.1e-1 -0.211 1.6e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.299 0.02 0.311 0.01 51 Click to see details
STAD 0.52 0.02 0.579 0.01 16 Click to see details
LUAD 0.93 0.03 0.800 0.1 4 Click to see details
LUSC 0.356 0.06 0.414 0.03 21 Click to see details
KIRP 0.276 0.1 0.297 0.08 24 Click to see details
HNSC -0.344 0.17 -0.164 0.33 10 Click to see details
KICH 0.202 0.25 0.187 0.27 13 Click to see details
BRCA 0.091 0.28 0.004 0.49 42 Click to see details
CHOL 0.423 0.29 0.000 0.5 4 Click to see details
COAD 0.393 0.3 0.400 0.3 4 Click to see details
PAAD -0.352 0.32 -0.600 0.2 4 Click to see details
UCEC 0.175 0.33 0.467 0.1 9 Click to see details
BLCA 0.22 0.34 0.143 0.39 6 Click to see details
PRAD 0.118 0.43 0.100 0.44 5 Click to see details
LIHC 0.034 0.43 -0.046 0.4 30 Click to see details
THCA -0.006 0.49 -0.101 0.28 34 Click to see details
THCA -0.006 0.49 -0.101 0.28 34 Click to see details
THCA -0.006 0.49 -0.101 0.28 34 Click to see details
THCA -0.006 0.49 -0.101 0.28 34 Click to see details
THCA -0.006 0.49 -0.101 0.28 34 Click to see details
THCA -0.006 0.49 -0.101 0.28 34 Click to see details
196 hsa-miR-1229-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT036258 VWA8 von Willebrand factor A domain containing 8 1 1
MIRT036259 SORBS3 sorbin and SH3 domain containing 3 1 1
MIRT036260 HIST1H3A histone cluster 1 H3 family member a 1 1
MIRT036261 TIA1 TIA1 cytotoxic granule associated RNA binding protein 1 1
MIRT036262 COIL coilin 1 1
MIRT036263 PBRM1 polybromo 1 1 1
MIRT036264 KRT28 keratin 28 1 1
MIRT036265 RPL7A ribosomal protein L7a 1 1
MIRT036266 EEF2 eukaryotic translation elongation factor 2 1 1
MIRT036267 CEP152 centrosomal protein 152 1 1
MIRT036268 CPT1B carnitine palmitoyltransferase 1B 1 1
MIRT036269 CEP55 centrosomal protein 55 1 1
MIRT036270 ZMYM2 zinc finger MYM-type containing 2 1 1
MIRT036271 CRISP3 cysteine rich secretory protein 3 1 1
MIRT036272 CDKN1A cyclin dependent kinase inhibitor 1A 1 1
MIRT036273 ADPRHL2 ADP-ribosylhydrolase like 2 1 1
MIRT036274 PHRF1 PHD and ring finger domains 1 1 1
MIRT036275 RPL3 ribosomal protein L3 1 1
MIRT036276 CSDE1 cold shock domain containing E1 1 1
MIRT036277 PTPRF protein tyrosine phosphatase, receptor type F 1 1
MIRT036278 ZNF264 zinc finger protein 264 1 1
MIRT036279 AHCYL1 adenosylhomocysteinase like 1 1 1
MIRT036280 GAPDH glyceraldehyde-3-phosphate dehydrogenase 1 1
MIRT036281 INTS10 integrator complex subunit 10 1 1
MIRT036282 TARDBP TAR DNA binding protein 1 1
MIRT036283 CTNND1 catenin delta 1 1 1
MIRT036284 KCTD15 potassium channel tetramerization domain containing 15 1 1
MIRT036285 CEP350 centrosomal protein 350 1 1
MIRT036286 C19orf10 myeloid derived growth factor 1 1
MIRT036287 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT036288 CHCHD2 coiled-coil-helix-coiled-coil-helix domain containing 2 1 1
MIRT036289 POLR2D RNA polymerase II subunit D 1 1
MIRT036290 PHC1 polyhomeotic homolog 1 1 1
MIRT036291 HNRNPD heterogeneous nuclear ribonucleoprotein D 1 1
MIRT036292 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 1 1
MIRT036293 AIF1L allograft inflammatory factor 1 like 1 1
MIRT036294 NEU3 neuraminidase 3 1 1
MIRT036295 DCTD dCMP deaminase 1 1
MIRT036296 TUBA1B tubulin alpha 1b 1 1
MIRT036297 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 1 1
MIRT036298 ACOT7 acyl-CoA thioesterase 7 1 1
MIRT036299 MDK midkine 1 1
MIRT036300 INO80D INO80 complex subunit D 1 1
MIRT036301 LDOC1L retrotransposon Gag like 6 1 1
MIRT036302 C2orf44 WD repeat and coiled coil containing 1 1
MIRT036303 SRCAP Snf2 related CREBBP activator protein 1 1
MIRT036304 EPB41L2 erythrocyte membrane protein band 4.1 like 2 1 1
MIRT036305 REXO2 RNA exonuclease 2 1 1
MIRT036306 CTNNBL1 catenin beta like 1 1 1
MIRT036307 SAFB scaffold attachment factor B 1 1
MIRT036308 PPP6R1 protein phosphatase 6 regulatory subunit 1 1 1
MIRT036309 FEN1 flap structure-specific endonuclease 1 1 1
MIRT036310 LRBA LPS responsive beige-like anchor protein 1 1
MIRT036311 SCAMP5 secretory carrier membrane protein 5 1 1
MIRT036312 DAG1 dystroglycan 1 1 1
MIRT036313 HYPK huntingtin interacting protein K 1 1
MIRT036314 HIST1H4C histone cluster 1 H4 family member c 1 1
MIRT036315 CDC42EP4 CDC42 effector protein 4 1 1
MIRT036316 ERC1 ELKS/RAB6-interacting/CAST family member 1 1 1
MIRT036317 GTF2I general transcription factor IIi 1 1
MIRT036318 RPGRIP1L RPGRIP1 like 1 1
MIRT036319 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 1 1
MIRT036320 TRRAP transformation/transcription domain associated protein 1 1
MIRT036321 PHF8 PHD finger protein 8 1 1
MIRT036322 TSC22D3 TSC22 domain family member 3 1 1
MIRT036323 MPP2 membrane palmitoylated protein 2 1 1
MIRT036324 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 1 1
MIRT036325 ALS2 ALS2, alsin Rho guanine nucleotide exchange factor 1 1
MIRT036326 KMT2D lysine methyltransferase 2D 1 1
MIRT036327 ITGA5 integrin subunit alpha 5 1 1
MIRT036328 ABCC5 ATP binding cassette subfamily C member 5 1 1
MIRT036329 KIF24 kinesin family member 24 1 1
MIRT036330 PPP4C protein phosphatase 4 catalytic subunit 1 1
MIRT036331 FMNL2 formin like 2 1 1
MIRT036332 NF2 neurofibromin 2 1 1
MIRT036333 NUP210 nucleoporin 210 1 1
MIRT036334 CTDNEP1 CTD nuclear envelope phosphatase 1 1 1
MIRT036335 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 1
MIRT036336 CTCF CCCTC-binding factor 1 1
MIRT036337 LRIT1 leucine rich repeat, Ig-like and transmembrane domains 1 1 1
MIRT036338 SFPQ splicing factor proline and glutamine rich 1 1
MIRT036339 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 1 1
MIRT036340 NAPEPLD N-acyl phosphatidylethanolamine phospholipase D 1 1
MIRT036341 SLC39A7 solute carrier family 39 member 7 1 1
MIRT036342 KDM5C lysine demethylase 5C 1 1
MIRT036343 ACLY ATP citrate lyase 1 1
MIRT036344 MED19 mediator complex subunit 19 1 1
MIRT036345 SRP72 signal recognition particle 72 1 1
MIRT036346 RUVBL2 RuvB like AAA ATPase 2 1 1
MIRT036347 CLSTN3 calsyntenin 3 1 1
MIRT036348 SAE1 SUMO1 activating enzyme subunit 1 1 1
MIRT036349 TUBG1 tubulin gamma 1 1 1
MIRT036350 FOXP1 forkhead box P1 1 1
MIRT036351 ZNF687 zinc finger protein 687 1 1
MIRT036352 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 1 1
MIRT036353 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 1 1
MIRT036354 RNF40 ring finger protein 40 1 1
MIRT036355 KPNB1 karyopherin subunit beta 1 1 1
MIRT036356 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 1 1
MIRT036357 DDX23 DEAD-box helicase 23 1 1
MIRT036358 BET1L Bet1 golgi vesicular membrane trafficking protein like 1 1
MIRT036359 BRD2 bromodomain containing 2 1 1
MIRT036360 EML1 echinoderm microtubule associated protein like 1 1 1
MIRT036361 BAP1 BRCA1 associated protein 1 1 1
MIRT036362 STAT5B signal transducer and activator of transcription 5B 1 1
MIRT036363 SUPT5H SPT5 homolog, DSIF elongation factor subunit 1 1
MIRT036364 GPI glucose-6-phosphate isomerase 1 1
MIRT036365 PTBP3 polypyrimidine tract binding protein 3 1 1
MIRT036366 RPS15 ribosomal protein S15 1 1
MIRT036367 ZDHHC7 zinc finger DHHC-type containing 7 1 1
MIRT036368 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 1 1
MIRT036369 SNX12 sorting nexin 12 1 1
MIRT036370 OTUD7B OTU deubiquitinase 7B 1 1
MIRT036371 AP2M1 adaptor related protein complex 2 mu 1 subunit 1 1
MIRT036372 C9orf114 SPOUT domain containing methyltransferase 1 1 1
MIRT036373 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 1 1
MIRT036374 FOXK1 forkhead box K1 1 1
MIRT036375 SIK2 salt inducible kinase 2 1 1
MIRT036376 SCD stearoyl-CoA desaturase 1 1
MIRT036377 PHGDH phosphoglycerate dehydrogenase 1 1
MIRT036378 PITPNB phosphatidylinositol transfer protein beta 1 1
MIRT036379 MAD2L2 mitotic arrest deficient 2 like 2 1 1
MIRT036380 TUSC3 tumor suppressor candidate 3 1 1
MIRT036381 PRKRIP1 PRKR interacting protein 1 1 1
MIRT036382 DCAF7 DDB1 and CUL4 associated factor 7 1 1
MIRT036383 NME2 NME/NM23 nucleoside diphosphate kinase 2 1 1
MIRT036384 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 1 1
MIRT036385 SLC16A13 solute carrier family 16 member 13 1 1
MIRT036386 PRDX4 peroxiredoxin 4 1 1
MIRT036387 NXPE3 neurexophilin and PC-esterase domain family member 3 1 1
MIRT036388 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 1 1
MIRT036389 CPNE1 copine 1 1 1
MIRT036390 PSMC5 proteasome 26S subunit, ATPase 5 1 1
MIRT036391 PAK4 p21 (RAC1) activated kinase 4 1 1
MIRT059262 CELF1 CUGBP Elav-like family member 1 2 2
MIRT061283 IPO7 importin 7 2 2
MIRT080097 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT345981 BIRC5 baculoviral IAP repeat containing 5 2 8
MIRT366471 KLHL15 kelch like family member 15 2 2
MIRT379534 HNRNPK heterogeneous nuclear ribonucleoprotein K 2 2
MIRT443697 HUNK hormonally up-regulated Neu-associated kinase 2 4
MIRT472347 NETO2 neuropilin and tolloid like 2 2 2
MIRT497842 GATA6 GATA binding protein 6 2 4
MIRT510408 ZNF268 zinc finger protein 268 2 4
MIRT519621 ZNF781 zinc finger protein 781 2 2
MIRT519830 ZFP69B ZFP69 zinc finger protein B 2 4
MIRT530712 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT530802 GPR182 G protein-coupled receptor 182 2 2
MIRT534374 SETD7 SET domain containing lysine methyltransferase 7 2 2
MIRT535541 P2RY2 purinergic receptor P2Y2 2 2
MIRT536016 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT556019 MYBL1 MYB proto-oncogene like 1 2 2
MIRT560009 ZNF525 zinc finger protein 525 2 2
MIRT560072 ZNF195 zinc finger protein 195 2 2
MIRT565948 RRAGD Ras related GTP binding D 2 2
MIRT570131 IL1RL2 interleukin 1 receptor like 2 2 2
MIRT570887 ZNF780A zinc finger protein 780A 2 4
MIRT609775 VWC2L von Willebrand factor C domain containing protein 2 like 2 4
MIRT611445 NRIP3 nuclear receptor interacting protein 3 2 2
MIRT611975 ZNF175 zinc finger protein 175 2 2
MIRT612871 IGFBP5 insulin like growth factor binding protein 5 2 4
MIRT613012 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT617515 PTDSS1 phosphatidylserine synthase 1 2 2
MIRT636095 ZDHHC22 zinc finger DHHC-type containing 22 2 2
MIRT637442 ZNF324B zinc finger protein 324B 2 2
MIRT638303 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT638920 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT640590 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT646760 WDR3 WD repeat domain 3 2 2
MIRT652591 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654866 PPL periplakin 2 2
MIRT654952 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT656021 MYO5B myosin VB 2 2
MIRT657078 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT657880 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT659231 CXCR5 C-X-C motif chemokine receptor 5 2 2
MIRT662904 MED18 mediator complex subunit 18 2 2
MIRT685610 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT687424 NRIP1 nuclear receptor interacting protein 1 2 2
MIRT692293 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT693749 ZNF383 zinc finger protein 383 2 2
MIRT695121 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695138 PRY PTPN13-like, Y-linked 2 2
MIRT709581 LETMD1 LETM1 domain containing 1 2 2
MIRT709737 TRIM27 tripartite motif containing 27 2 2
MIRT711058 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT714189 TRAF7 TNF receptor associated factor 7 2 2
MIRT715924 CHD4 chromodomain helicase DNA binding protein 4 2 2
MIRT719463 SRF serum response factor 2 2
MIRT720172 PANK2 pantothenate kinase 2 2 2
MIRT720456 RAB31 RAB31, member RAS oncogene family 2 2
MIRT721642 ZNF207 zinc finger protein 207 2 2
MIRT721996 CLLU1OS chronic lymphocytic leukemia up-regulated 1 opposite strand 2 2
MIRT722187 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 2 2
MIRT725196 PTRF caveolae associated protein 1 2 2
MIRT725518 FAM229B family with sequence similarity 229 member B 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1229 Progesterone approved 5994 Microarray Breast cancer 22330642 2012 down-regulated
miR-1229 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1229 Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1229 Fluorouracil 3385 NSC19893 approved sensitive cell line (KYSE)
hsa-miR-1229-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-1229-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-1229-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-1229-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-1229-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-1229-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1229-3p Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-1229-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-1229-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-1229-3p Fluorouracil 3385 NSC19893 approved resistant Low Gastric Cancer cell line (HGC-27, GFP-MKN45)
hsa-miR-1229-3p Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-1229-3p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-1229-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-1229-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-1229-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-1229-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1229-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-1229-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-1229-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1229-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission