miRTarBase - #MIRT036421


—
pre-miRNA Information
pre-miRNA hsa-mir-1226   
Genomic Coordinates chr3: 47849555 - 47849629
Synonyms MIRN1226, hsa-mir-1226, MIR1226
Description Homo sapiens miR-1226 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1226-3p
Sequence 54| UCACCAGCCCUGUGUUCCCUAG |75
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM111744 10 COSMIC
COSM8170291 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1472927902 1 dbSNP
rs370902478 2 dbSNP
rs750372577 5 dbSNP
rs754955605 6 dbSNP
rs373981655 9 dbSNP
rs1431438028 11 dbSNP
rs747968275 12 dbSNP
rs372320878 19 dbSNP
rs141645399 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CABIN1   
Synonyms CAIN, KB-318B8.7, PPP3IN
Description calcineurin binding protein 1
Transcript NM_012295   
Expression
Putative miRNA Targets on CABIN1
3'UTR of CABIN1
(miRNA target sites are highlighted)		 
>CABIN1|NM_012295|3'UTR
   1 GGGGCCACTGCAGCCCCACCGCCACGCCCCAGGGGACCAGCCAGGCCTGGAATGCCCCCTGGGCAGGACCCTGGGCAGGA
  81 CCAGAGGCCCACATGGATGCCACTCCCCACACAGCCCCCAGGCCTGCCCAGCCCACCTCCTCATGGCATCCTCCCTGTAC
 161 CCAGGTCAGGCTGTCCACACCACATGGGAGCCCAGAGGAGGAGGGGCCCGCCTTAGCCATGTGAAGGTGGATTGGTCGCC
 241 ATCTGCACGCCAGGCGGCATCCTTTTCTATGAAGTGTTGACTTTGTAAATCTGCCCACACCCAGCTGGCCATATCCACCC
 321 CTCGACGCCGGGATGAGCCGGCTCTGCCTGTGTCACAGTGGAGGGGTCCTTTAGGGCCAGGCTCACCCCTCACCCTTTTT
 401 TTGGTTGCTTTTCTAATAAAGATGGAACAGTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaucccuUGUGUCCCGACCacu 5'
                 ||||   |||||   
Target 5' tctgcccACACCCAGCTGGcca 3'
 290 - 311 111.00 -10.32
2 
miRNA  3' gaUCCCUUGU--GUCCCGACCacu 5'
            :|||| ||  |||| ||||   
Target 5' caGGGGACCAGCCAGGCCTGGaat 3'
 30 - 53 106.00 -20.92
3 
miRNA  3' gauccCUUGUGUC----CCGACcacu 5'
               | || |||    |||||    
Target 5' tccctGTACCCAGGTCAGGCTGtcca 3'
 152 - 177 95.00 -10.06
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30481882 16 COSMIC
COSN30559820 21 COSMIC
COSN30495155 26 COSMIC
COSN30490415 27 COSMIC
COSN30181821 45 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1220699645 2 dbSNP
rs1280830880 5 dbSNP
rs1347031212 11 dbSNP
rs745478463 12 dbSNP
rs1284963434 17 dbSNP
rs769448175 18 dbSNP
rs1437839574 19 dbSNP
rs1180489915 20 dbSNP
rs775285890 21 dbSNP
rs13054699 22 dbSNP
rs1195865052 23 dbSNP
rs199716373 26 dbSNP
rs1434635652 27 dbSNP
rs1172242874 31 dbSNP
rs774269999 35 dbSNP
rs374444102 36 dbSNP
rs766351635 37 dbSNP
rs1334174671 40 dbSNP
rs919930528 43 dbSNP
rs754133347 45 dbSNP
rs1303860755 46 dbSNP
rs749399271 53 dbSNP
rs374513020 54 dbSNP
rs966007635 55 dbSNP
rs1177680981 56 dbSNP
rs1472385819 57 dbSNP
rs546034155 57 dbSNP
rs752109577 58 dbSNP
rs1362271793 59 dbSNP
rs532370043 70 dbSNP
rs541299518 77 dbSNP
rs1223685648 79 dbSNP
rs559396938 82 dbSNP
rs1445993331 89 dbSNP
rs1204134196 97 dbSNP
rs1328010709 98 dbSNP
rs1281764032 110 dbSNP
rs1225136396 114 dbSNP
rs1373372219 116 dbSNP
rs1283089985 118 dbSNP
rs1451083719 120 dbSNP
rs1385712018 122 dbSNP
rs931930201 123 dbSNP
rs111979585 126 dbSNP
rs548340524 135 dbSNP
rs757410534 140 dbSNP
rs1161503637 141 dbSNP
rs894372753 155 dbSNP
rs781483076 162 dbSNP
rs948651884 166 dbSNP
rs1442695107 179 dbSNP
rs1475443297 183 dbSNP
rs1042664047 189 dbSNP
rs1383295829 191 dbSNP
rs1426533910 195 dbSNP
rs1163916039 210 dbSNP
rs1217403752 211 dbSNP
rs1317208365 221 dbSNP
rs1288527517 224 dbSNP
rs1383982461 225 dbSNP
rs904228984 229 dbSNP
rs1362197262 230 dbSNP
rs1316288796 237 dbSNP
rs1036511683 238 dbSNP
rs907339037 239 dbSNP
rs1031450514 242 dbSNP
rs1327300966 246 dbSNP
rs1003137196 250 dbSNP
rs1055936036 251 dbSNP
rs370537318 254 dbSNP
rs746069262 256 dbSNP
rs894855290 257 dbSNP
rs563793739 258 dbSNP
rs1164085740 259 dbSNP
rs1022031194 262 dbSNP
rs1313092796 263 dbSNP
rs1008378820 270 dbSNP
rs1188123810 271 dbSNP
rs147150467 272 dbSNP
rs1485975575 277 dbSNP
rs1245822471 279 dbSNP
rs1019809401 285 dbSNP
rs903585554 287 dbSNP
rs1291877316 296 dbSNP
rs964252807 300 dbSNP
rs1306326405 302 dbSNP
rs999659483 309 dbSNP
rs997101257 311 dbSNP
rs140280725 315 dbSNP
rs966236510 317 dbSNP
rs376337258 318 dbSNP
rs1028911461 319 dbSNP
rs1285704756 320 dbSNP
rs953392368 324 dbSNP
rs868136991 325 dbSNP
rs570681292 327 dbSNP
rs908648169 328 dbSNP
rs1285877024 330 dbSNP
rs534901746 337 dbSNP
rs940801669 341 dbSNP
rs992591577 345 dbSNP
rs1479926377 349 dbSNP
rs1240737097 355 dbSNP
rs915747352 366 dbSNP
rs370433140 371 dbSNP
rs1446296657 376 dbSNP
rs1184172167 378 dbSNP
rs948636017 387 dbSNP
rs1362964130 392 dbSNP
rs972527079 394 dbSNP
rs1468392251 396 dbSNP
rs1042987890 423 dbSNP
rs1389799258 429 dbSNP
rs928825018 429 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.553 2.5e-2 0.372 1.1e-1 13 Click to see details
GSE28544 Breast cancer 0.393 2.9e-2 0.499 6.5e-3 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.728 5.0e-2 0.829 2.1e-2 6 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.314 6.3e-2 0.285 8.4e-2 25 Click to see details
GSE21687 Ependynoma primary tumors 0.162 1.0e-1 0.061 3.2e-1 64 Click to see details
GSE38226 Liver fibrosis 0.241 1.5e-1 0.308 8.7e-2 21 Click to see details
GSE26953 Aortic valvular endothelial cells -0.166 2.2e-1 -0.182 2.0e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.146 2.5e-1 -0.366 4.3e-2 23 Click to see details
GSE17498 Multiple myeloma 0.071 3.3e-1 0.179 1.3e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.045 4.3e-1 -0.147 2.7e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.033 4.4e-1 0.320 5.9e-2 25 Click to see details
GSE32688 Pancreatic cancer -0.014 4.7e-1 -0.002 5.0e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KICH -0.716 0 -0.623 0 19 Click to see details
CHOL 0.905 0.01 0.771 0.04 6 Click to see details
COAD -0.757 0.02 -0.607 0.07 7 Click to see details
HNSC -0.35 0.03 -0.297 0.06 30 Click to see details
PRAD 0.324 0.06 0.405 0.02 25 Click to see details
KIRP -0.224 0.11 -0.300 0.05 32 Click to see details
KIRC -0.142 0.15 -0.096 0.24 56 Click to see details
LIHC 0.158 0.16 0.252 0.06 41 Click to see details
LUSC -0.145 0.2 -0.157 0.18 36 Click to see details
STAD -0.157 0.22 -0.309 0.06 27 Click to see details
PCPG -0.64 0.28 -0.500 0.33 3 Click to see details
PAAD -0.392 0.3 0.000 0.5 4 Click to see details
ESCA 0.174 0.34 0.119 0.39 8 Click to see details
THCA -0.032 0.41 -0.024 0.43 54 Click to see details
UCEC 0.053 0.41 0.077 0.38 19 Click to see details
LUAD 0.11 0.42 0.086 0.44 6 Click to see details
BLCA -0.046 0.44 0.213 0.23 14 Click to see details
BRCA -0.011 0.47 0.032 0.4 66 Click to see details
BRCA -0.011 0.47 0.032 0.4 66 Click to see details
BRCA -0.011 0.47 0.032 0.4 66 Click to see details
BRCA -0.011 0.47 0.032 0.4 66 Click to see details
210 hsa-miR-1226-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005492 MUC1 mucin 1, cell surface associated 3 1
MIRT036409 IGF1R insulin like growth factor 1 receptor 1 1
MIRT036410 UBE2A ubiquitin conjugating enzyme E2 A 1 1
MIRT036411 WDR1 WD repeat domain 1 1 1
MIRT036412 HIST1H4B histone cluster 1 H4 family member b 1 1
MIRT036413 BLMH bleomycin hydrolase 1 1
MIRT036414 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT036415 KDM2A lysine demethylase 2A 1 1
MIRT036416 RPL35 ribosomal protein L35 1 1
MIRT036417 KARS lysyl-tRNA synthetase 1 1
MIRT036418 AVL9 AVL9 cell migration associated 1 1
MIRT036419 GLUD2 glutamate dehydrogenase 2 1 1
MIRT036420 GALNT2 polypeptide N-acetylgalactosaminyltransferase 2 1 1
MIRT036421 CABIN1 calcineurin binding protein 1 1 1
MIRT036422 LEPREL4 prolyl 3-hydroxylase family member 4 (non-enzymatic) 1 1
MIRT036423 CSDE1 cold shock domain containing E1 1 1
MIRT036424 UBE2G1 ubiquitin conjugating enzyme E2 G1 1 1
MIRT036425 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 1
MIRT036426 CCDC47 coiled-coil domain containing 47 1 1
MIRT036427 SCAMP1 secretory carrier membrane protein 1 1 1
MIRT036428 HSP90AA1 heat shock protein 90 alpha family class A member 1 1 1
MIRT036429 GIMAP8 GTPase, IMAP family member 8 1 1
MIRT036430 MBTPS2 membrane bound transcription factor peptidase, site 2 1 1
MIRT036431 RCC2 regulator of chromosome condensation 2 1 1
MIRT036432 DUT deoxyuridine triphosphatase 1 1
MIRT036433 XYLT2 xylosyltransferase 2 1 1
MIRT036434 SUN2 Sad1 and UNC84 domain containing 2 1 1
MIRT036435 SACS sacsin molecular chaperone 1 1
MIRT036436 C12orf29 chromosome 12 open reading frame 29 1 1
MIRT036437 PSMB2 proteasome subunit beta 2 1 1
MIRT036438 PAF1 PAF1 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT036439 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT036440 PIM2 Pim-2 proto-oncogene, serine/threonine kinase 1 1
MIRT036441 JUNB JunB proto-oncogene, AP-1 transcription factor subunit 1 1
MIRT036442 TBX18 T-box 18 1 1
MIRT036443 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT036444 CYB5B cytochrome b5 type B 1 1
MIRT036445 ATXN2 ataxin 2 1 1
MIRT036446 TBX3 T-box 3 1 1
MIRT036447 EPB41L1 erythrocyte membrane protein band 4.1 like 1 1 1
MIRT036448 TMEM25 transmembrane protein 25 1 1
MIRT036449 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT036450 NDRG3 NDRG family member 3 1 1
MIRT036451 CPSF3L integrator complex subunit 11 1 1
MIRT036452 SORBS2 sorbin and SH3 domain containing 2 1 1
MIRT036453 RPA2 replication protein A2 1 1
MIRT036454 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT036455 ZNF629 zinc finger protein 629 1 1
MIRT036456 NOP2 NOP2 nucleolar protein 1 1
MIRT036457 KIAA1644 KIAA1644 1 1
MIRT036458 HSPA9 heat shock protein family A (Hsp70) member 9 1 1
MIRT036459 ITPR3 inositol 1,4,5-trisphosphate receptor type 3 1 1
MIRT036460 TM9SF4 transmembrane 9 superfamily member 4 1 1
MIRT036461 SLC1A5 solute carrier family 1 member 5 1 1
MIRT036462 EXOC8 exocyst complex component 8 1 1
MIRT036463 ATP6AP2 ATPase H+ transporting accessory protein 2 1 1
MIRT036464 HIST1H4C histone cluster 1 H4 family member c 1 1
MIRT036465 ZDHHC4 zinc finger DHHC-type containing 4 1 1
MIRT036466 ERCC2 ERCC excision repair 2, TFIIH core complex helicase subunit 1 1
MIRT036467 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT036468 RBM27 RNA binding motif protein 27 1 1
MIRT036469 EHHADH enoyl-CoA hydratase and 3-hydroxyacyl CoA dehydrogenase 1 1
MIRT036470 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT036471 RBM10 RNA binding motif protein 10 1 1
MIRT036472 RABGGTB Rab geranylgeranyltransferase beta subunit 1 1
MIRT036473 PFKL phosphofructokinase, liver type 1 1
MIRT036474 TOP2A DNA topoisomerase II alpha 1 1
MIRT036475 KIAA1671 KIAA1671 1 1
MIRT036476 EIF3C eukaryotic translation initiation factor 3 subunit C 1 1
MIRT036477 IPO7 importin 7 1 1
MIRT036478 CTDNEP1 CTD nuclear envelope phosphatase 1 1 1
MIRT036479 ZBTB7B zinc finger and BTB domain containing 7B 1 1
MIRT036480 GPBP1L1 GC-rich promoter binding protein 1 like 1 1 1
MIRT036481 PANK3 pantothenate kinase 3 1 1
MIRT036482 SLC35F6 solute carrier family 35 member F6 1 1
MIRT036483 RPL36A ribosomal protein L36a 1 1
MIRT036484 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT036485 AKIP1 A-kinase interacting protein 1 1 1
MIRT036486 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT036487 ACTG1 actin gamma 1 1 1
MIRT036488 EDC4 enhancer of mRNA decapping 4 1 1
MIRT036489 FTSJD2 cap methyltransferase 1 1 1
MIRT036490 GNB2L1 receptor for activated C kinase 1 1 1
MIRT036491 AP2M1 adaptor related protein complex 2 mu 1 subunit 1 1
MIRT036492 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT036493 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase type 1 alpha 1 1
MIRT036494 ZBTB40 zinc finger and BTB domain containing 40 1 1
MIRT036495 PIK3R4 phosphoinositide-3-kinase regulatory subunit 4 1 1
MIRT036496 CTNNB1 catenin beta 1 1 1
MIRT036497 CEBPA CCAAT/enhancer binding protein alpha 1 1
MIRT036498 PKN3 protein kinase N3 1 1
MIRT036499 FAM3C family with sequence similarity 3 member C 1 1
MIRT036500 IDH1 isocitrate dehydrogenase (NADP(+)) 1, cytosolic 1 1
MIRT036501 CKAP4 cytoskeleton associated protein 4 1 1
MIRT036502 GCN1L1 GCN1, eIF2 alpha kinase activator homolog 1 1
MIRT036503 ASTL astacin like metalloendopeptidase 1 1
MIRT036504 ADAR adenosine deaminase, RNA specific 1 1
MIRT036505 IRAK1 interleukin 1 receptor associated kinase 1 1 1
MIRT036506 ALDH1B1 aldehyde dehydrogenase 1 family member B1 1 1
MIRT036507 HSPB8 heat shock protein family B (small) member 8 1 1
MIRT036508 MCM2 minichromosome maintenance complex component 2 1 1
MIRT036509 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT036510 SIMC1 SUMO interacting motifs containing 1 1 1
MIRT036511 PPIA peptidylprolyl isomerase A 1 1
MIRT036512 CENPF centromere protein F 1 1
MIRT036513 PRPF6 pre-mRNA processing factor 6 1 1
MIRT036514 CHD3 chromodomain helicase DNA binding protein 3 1 1
MIRT036515 PBRM1 polybromo 1 1 1
MIRT036516 USP24 ubiquitin specific peptidase 24 1 1
MIRT036517 UQCC ubiquinol-cytochrome c reductase complex assembly factor 1 1 1
MIRT036518 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 2 3
MIRT036519 CNTNAP3 contactin associated protein like 3 1 1
MIRT036520 DDT D-dopachrome tautomerase 1 1
MIRT036521 ZNF395 zinc finger protein 395 1 1
MIRT036522 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 1 1
MIRT036523 SLC25A39 solute carrier family 25 member 39 1 1
MIRT036524 NCKIPSD NCK interacting protein with SH3 domain 1 1
MIRT036525 AAMP angio associated migratory cell protein 1 1
MIRT036526 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 1 1
MIRT036527 AGPAT6 glycerol-3-phosphate acyltransferase 4 1 1
MIRT036528 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT036529 ABHD14B abhydrolase domain containing 14B 1 1
MIRT036530 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT036531 BAG6 BCL2 associated athanogene 6 1 1
MIRT036532 MRPS26 mitochondrial ribosomal protein S26 1 1
MIRT036533 KIF4B kinesin family member 4B 1 1
MIRT036534 TUBB4B tubulin beta 4B class IVb 1 1
MIRT036535 FAM168B family with sequence similarity 168 member B 1 1
MIRT036536 TUBB4A tubulin beta 4A class IVa 1 1
MIRT036537 AKR1B1 aldo-keto reductase family 1 member B 1 1
MIRT248779 ATXN7L3B ataxin 7 like 3B 2 2
MIRT279943 SLC39A9 solute carrier family 39 member 9 2 4
MIRT337171 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 4
MIRT443071 ABLIM1 actin binding LIM protein 1 2 2
MIRT451814 CDCA3 cell division cycle associated 3 2 2
MIRT467748 SLC36A1 solute carrier family 36 member 1 2 2
MIRT473511 MAZ MYC associated zinc finger protein 2 2
MIRT476233 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 2
MIRT486918 GPX1 glutathione peroxidase 1 2 2
MIRT489205 RPH3AL rabphilin 3A like (without C2 domains) 2 2
MIRT495363 AATF apoptosis antagonizing transcription factor 2 2
MIRT495390 VPS51 VPS51, GARP complex subunit 2 2
MIRT495594 ARHGEF28 Rho guanine nucleotide exchange factor 28 2 2
MIRT495692 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT495833 EHD1 EH domain containing 1 2 2
MIRT499765 CIRH1A UTP4, small subunit processome component 2 10
MIRT504903 CCDC86 coiled-coil domain containing 86 2 2
MIRT513211 RFT1 RFT1 homolog 2 2
MIRT519628 ZNF781 zinc finger protein 781 2 2
MIRT519843 ZFP69B ZFP69 zinc finger protein B 2 4
MIRT530064 PLXNA4 plexin A4 2 2
MIRT531308 GPR26 G protein-coupled receptor 26 2 2
MIRT533268 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT534128 SNX13 sorting nexin 13 2 2
MIRT534291 SLAIN2 SLAIN motif family member 2 2 2
MIRT535866 MORF4L1 mortality factor 4 like 1 2 2
MIRT536022 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT539500 ACTN4 actinin alpha 4 2 2
MIRT547451 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT560019 ZNF525 zinc finger protein 525 2 2
MIRT560084 ZNF195 zinc finger protein 195 2 2
MIRT568722 GRASP general receptor for phosphoinositides 1 associated scaffold protein 2 2
MIRT570893 ZNF780A zinc finger protein 780A 2 2
MIRT571250 FADS6 fatty acid desaturase 6 2 2
MIRT573401 DLC1 DLC1 Rho GTPase activating protein 2 2
MIRT576568 Serpine1 serine (or cysteine) peptidase inhibitor, clade E, member 1 2 2
MIRT612131 NDUFA10 NADH:ubiquinone oxidoreductase subunit A10 2 2
MIRT613022 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT613861 TNFRSF9 TNF receptor superfamily member 9 2 4
MIRT614966 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 2
MIRT616581 FAM107A family with sequence similarity 107 member A 2 2
MIRT626205 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT640512 ANTXR1 anthrax toxin receptor 1 2 2
MIRT640536 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT641548 MOCOS molybdenum cofactor sulfurase 2 2
MIRT641683 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT642859 RNF135 ring finger protein 135 2 2
MIRT649106 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT651844 USP1 ubiquitin specific peptidase 1 2 2
MIRT659044 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT659663 CDC73 cell division cycle 73 2 2
MIRT659959 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT672556 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT675601 ZNF106 zinc finger protein 106 2 2
MIRT676034 C9orf69 transmembrane protein 250 2 2
MIRT678691 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT682730 MSANTD1 Myb/SANT DNA binding domain containing 1 2 2
MIRT682993 RNF40 ring finger protein 40 2 2
MIRT687354 NUP98 nucleoporin 98 2 2
MIRT697178 INMT indolethylamine N-methyltransferase 2 2
MIRT698735 STX12 syntaxin 12 2 2
MIRT699632 SH3BP5 SH3 domain binding protein 5 2 2
MIRT704560 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT704708 CHEK1 checkpoint kinase 1 2 2
MIRT709863 PDIK1L PDLIM1 interacting kinase 1 like 2 2
MIRT712792 ZNF154 zinc finger protein 154 2 2
MIRT712918 MRGPRF MAS related GPR family member F 2 2
MIRT714040 ELMO1 engulfment and cell motility 1 2 2
MIRT714417 TBC1D16 TBC1 domain family member 16 2 2
MIRT714539 ZBTB39 zinc finger and BTB domain containing 39 2 2
MIRT715975 FADS3 fatty acid desaturase 3 2 2
MIRT716452 TMPRSS11BNL TMPRSS11B N-terminal like, pseudogene 2 2
MIRT716996 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT718745 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT719103 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 2 2
MIRT721047 TRIM67 tripartite motif containing 67 2 2
MIRT721082 FTSJ2 mitochondrial rRNA methyltransferase 2 2 2
MIRT722291 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT722940 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT725148 SLC43A1 solute carrier family 43 member 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1226 Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma tissue
hsa-mir-1226 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-mir-1226 Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-1226 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-1226 Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-mir-1226 Fluorouracil 3385 NSC19893 approved sensitive cell line (KYSE)
hsa-mir-1226 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-1226-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1226-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1226-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-1226-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-1226-3p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-1226-3p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-1226-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-1226-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1226-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, SK-HEP-1)
hsa-miR-1226-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-1226-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1226-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-1226-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-1226-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-1226-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-1226-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-1226-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-1226-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1226-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVCAR3)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H460)

Error report submission