miRTarBase - #MIRT036432


—
pre-miRNA Information
pre-miRNA hsa-mir-1226   
Genomic Coordinates chr3: 47849555 - 47849629
Synonyms MIRN1226, hsa-mir-1226, MIR1226
Description Homo sapiens miR-1226 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1226-3p
Sequence 54| UCACCAGCCCUGUGUUCCCUAG |75
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM111744 10 COSMIC
COSM8170291 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1472927902 1 dbSNP
rs370902478 2 dbSNP
rs750372577 5 dbSNP
rs754955605 6 dbSNP
rs373981655 9 dbSNP
rs1431438028 11 dbSNP
rs747968275 12 dbSNP
rs372320878 19 dbSNP
rs141645399 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DUT   
Synonyms dUTPase
Description deoxyuridine triphosphatase
Transcript NM_001025248   
Other Transcripts NM_001025249 , NM_001948   
Expression
Putative miRNA Targets on DUT
3'UTR of DUT
(miRNA target sites are highlighted)		 
>DUT|NM_001025248|3'UTR
   1 AATTTATGCCAAGAACAGAAAACAAGAAGTCATACCTTTTTCTTAAAAAAAAAAAAAAAGTTTTTGCTTCAAGTGTTTTG
  81 GTGTTTTGCACTTCTGTAAACTTACTAGCTTTACCTTCTAAAAGTACTGCATTTTTTACTTTTTTTTATGATCAAGGAAA
 161 AGATCATTAAAAAAAAACACAAAGAAGTTTTTCTTTGTGTTTGGATCAAAAAGAAACTTTGTTTTTCCGCAATTGAAGGT
 241 TGTATGTAAATCTGCTTTGTGGTGACCTGATGTAAACAGTGTCTTCTTAAAATCAAATGTAAATCAATTACAGATTAAAA
 321 AAAAAAGCCTGTATTTAACTCATATGATCTCCCTTCAGCAACTTATTTTGCTTTAATTGCTTTAAATCTTAAGCAATATT
 401 TTTTATTCAGTAAACAAATTCTTTCACAAGGTACAAAATCTTGCATAAGCTGAACTAAAATAAAAATGAAAAGGAGAGAT
 481 TAAAGGTATTCCTTGTTCTTCCCTTCTCTTCACTAGTCTAAAAACTTCTTTTTAATCTTAAGATTCTTTGTGATGAGGGT
 561 GAGAAAAAGAATCCTCAGTTTATTTTTCCACTATTAATCTTTCTTTTGATAAATCCTCTATTGACTGGGTAGAGGTATGT
 641 TTGTGAAAGACATGTAACTTGGGGATTTGTTACTTTAGGTTTGTTCCCTTGAATTTCATCTCATCAGGCAAATTGTACTA
 721 GTTGTAGTTACGAGTTTTCCCTCAGTGAAGTAGCAATAGGCTGTAATCAAGAAAATATGCCATTTATAGAGATAAGATAA
 801 ATGAAATAATACTTCAGCCACCAGGTTTTTCTGTCTCACATACATAAGCAGCATTTCATTGCAGATATGGGACTGATTCT
 881 GTGGCTTACCTTGATTAACATCTTTTGGAAGTTTTGCTAGTGTGCTTTCCTTTCTTTACTATGTTTCTCAGATTCCTTTG
 961 TATCAGGGTTTTGGGTGTCACTTAGGTTTTGTCCATCAGATTCTGTGAGACACCAGGCATCGTTTTGAGGATGTGGGTTA
1041 TACACATGGAGTGCTTCTGGAACTATCAGCCCACTTGACCACCCAGTTTGTGGAAGCACAGGCAAGAGTGTTCTTTTCTG
1121 GTGATTCTCCAGGCCATTTAATACCCTGCAATGTAATTGTCCCTCTGTGGCTCACATTTCATTAGTGAGCCATGAAATCA
1201 ACTCAGTGGGACATAGCCAGCATTTTTGCATACCAGGTTGGGCTATAAAATATTTCTGTTGTCAATAAATTTTAAATGTT
1281 TTCCTGCTAAACTAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaucccuugugucccGACCACu 5'
                         |||||| 
Target 5' caagagtgttcttttCTGGTGa 3'
 1103 - 1124 120.00 -11.60
2 
miRNA  3' gaucCCUUGUGUCCCGACCACu 5'
              |||| ::   ||| ||| 
Target 5' ttttGGAA-GTTTTGCTAGTGt 3'
 903 - 923 113.00 -7.10
3 
miRNA  3' gauccCUUGUGUCC---CGACCACu 5'
               |:::| |||   |:| ||| 
Target 5' tgactGGGTAGAGGTATGTTTGTGa 3'
 622 - 646 105.00 -13.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30531123 16 COSMIC
COSN30455953 36 COSMIC
COSN25650538 43 COSMIC
COSN28851389 60 COSMIC
COSN31899970 60 COSMIC
COSN31526085 145 COSMIC
COSN18738485 178 COSMIC
COSN30529123 178 COSMIC
COSN7047027 185 COSMIC
COSN27375829 327 COSMIC
COSN19549479 405 COSMIC
COSN8745675 555 COSMIC
COSN8341914 617 COSMIC
COSN16436254 1157 COSMIC
COSN8174162 1295 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1208333990 7 dbSNP
rs760819518 13 dbSNP
rs1486288831 14 dbSNP
rs764469281 17 dbSNP
rs1246500240 27 dbSNP
rs111657285 30 dbSNP
rs762278544 34 dbSNP
rs770007620 35 dbSNP
rs1394002464 38 dbSNP
rs1412230992 39 dbSNP
rs1160598753 41 dbSNP
rs765720628 42 dbSNP
rs1274580655 43 dbSNP
rs750996310 43 dbSNP
rs1247409631 45 dbSNP
rs1309342056 45 dbSNP
rs34176493 45 dbSNP
rs751976151 45 dbSNP
rs760134978 45 dbSNP
rs763326450 45 dbSNP
rs766927597 45 dbSNP
rs1318376429 48 dbSNP
rs1369977954 49 dbSNP
rs757837796 50 dbSNP
rs1024453143 51 dbSNP
rs1361048416 59 dbSNP
rs1426521053 60 dbSNP
rs1382525817 63 dbSNP
rs976592404 73 dbSNP
rs922383188 74 dbSNP
rs929730848 75 dbSNP
rs982459956 79 dbSNP
rs1002158260 90 dbSNP
rs1179164793 98 dbSNP
rs909554037 106 dbSNP
rs941007162 107 dbSNP
rs1232220921 108 dbSNP
rs1269023744 111 dbSNP
rs1224064864 116 dbSNP
rs957637470 121 dbSNP
rs1273256938 128 dbSNP
rs1337648042 130 dbSNP
rs988816828 140 dbSNP
rs1281518588 142 dbSNP
rs1226852055 148 dbSNP
rs913345006 149 dbSNP
rs966078844 166 dbSNP
rs541113636 167 dbSNP
rs200974717 169 dbSNP
rs932588880 169 dbSNP
rs559651438 170 dbSNP
rs1260609847 175 dbSNP
rs1156561738 178 dbSNP
rs950304291 179 dbSNP
rs1188599491 181 dbSNP
rs909792980 182 dbSNP
rs1479133046 185 dbSNP
rs1254346671 187 dbSNP
rs1045894173 188 dbSNP
rs941051665 190 dbSNP
rs1420070417 191 dbSNP
rs1286836484 193 dbSNP
rs530143957 194 dbSNP
rs879263317 205 dbSNP
rs1036680871 217 dbSNP
rs1225458872 218 dbSNP
rs1342893893 218 dbSNP
rs763319540 229 dbSNP
rs1274311002 230 dbSNP
rs1344473951 233 dbSNP
rs548625600 234 dbSNP
rs748345998 239 dbSNP
rs1007554623 245 dbSNP
rs896925886 250 dbSNP
rs1328122418 265 dbSNP
rs1318360259 271 dbSNP
rs1454123887 275 dbSNP
rs1406367879 278 dbSNP
rs1290407350 282 dbSNP
rs532217216 282 dbSNP
rs1178095682 300 dbSNP
rs949752097 303 dbSNP
rs1423920739 315 dbSNP
rs568698068 317 dbSNP
rs879669862 317 dbSNP
rs189753094 318 dbSNP
rs1413766395 322 dbSNP
rs1187070003 324 dbSNP
rs1293419341 337 dbSNP
rs1033710401 340 dbSNP
rs963990405 341 dbSNP
rs893371704 342 dbSNP
rs1440877853 345 dbSNP
rs774038526 348 dbSNP
rs1010214323 358 dbSNP
rs1221528384 363 dbSNP
rs1215224216 366 dbSNP
rs1306935868 367 dbSNP
rs1341403543 372 dbSNP
rs1295229334 377 dbSNP
rs977024494 379 dbSNP
rs1383192628 380 dbSNP
rs1338431887 387 dbSNP
rs1029503049 388 dbSNP
rs1358218870 391 dbSNP
rs1329017117 397 dbSNP
rs1411101216 415 dbSNP
rs1422308781 416 dbSNP
rs756310570 421 dbSNP
rs1218470237 422 dbSNP
rs982513760 432 dbSNP
rs909606398 435 dbSNP
rs1185805790 439 dbSNP
rs777865843 441 dbSNP
rs1278598955 448 dbSNP
rs1205316058 457 dbSNP
rs966108025 461 dbSNP
rs941058070 479 dbSNP
rs1272419704 483 dbSNP
rs1204409318 487 dbSNP
rs1360032002 496 dbSNP
rs1316985605 497 dbSNP
rs1485488531 498 dbSNP
rs976099331 499 dbSNP
rs1279726211 503 dbSNP
rs1378012403 503 dbSNP
rs1029031952 509 dbSNP
rs199537992 512 dbSNP
rs991096556 520 dbSNP
rs916184795 521 dbSNP
rs954048680 525 dbSNP
rs1366719003 526 dbSNP
rs28381141 535 dbSNP
rs909812023 543 dbSNP
rs1413386430 546 dbSNP
rs1046366036 547 dbSNP
rs1471268356 549 dbSNP
rs1161082562 561 dbSNP
rs1393005056 567 dbSNP
rs1181549827 570 dbSNP
rs1490510665 574 dbSNP
rs941264734 580 dbSNP
rs1219119050 589 dbSNP
rs1284665897 590 dbSNP
rs1320834716 590 dbSNP
rs903370225 596 dbSNP
rs1433825335 598 dbSNP
rs1287224431 600 dbSNP
rs1404968317 610 dbSNP
rs1346702120 619 dbSNP
rs934788913 621 dbSNP
rs1456734406 625 dbSNP
rs918220186 628 dbSNP
rs949783378 636 dbSNP
rs1459085453 638 dbSNP
rs1410018552 639 dbSNP
rs1181574587 641 dbSNP
rs1045544346 650 dbSNP
rs1189449394 653 dbSNP
rs549993796 653 dbSNP
rs893209283 654 dbSNP
rs1376838501 662 dbSNP
rs1326654702 665 dbSNP
rs937531176 666 dbSNP
rs181415635 670 dbSNP
rs1325008992 677 dbSNP
rs538882445 678 dbSNP
rs1298532989 685 dbSNP
rs553865339 688 dbSNP
rs1385634671 691 dbSNP
rs893393893 701 dbSNP
rs1010410830 703 dbSNP
rs1437653864 709 dbSNP
rs1301824485 710 dbSNP
rs375970947 714 dbSNP
rs1347634843 717 dbSNP
rs1235404053 730 dbSNP
rs138529938 732 dbSNP
rs16960798 733 dbSNP
rs1203999125 738 dbSNP
rs1432579068 739 dbSNP
rs1420068818 744 dbSNP
rs997465489 746 dbSNP
rs1480946671 759 dbSNP
rs1180455114 760 dbSNP
rs1251016570 764 dbSNP
rs1029519727 769 dbSNP
rs1173966759 773 dbSNP
rs1253807976 776 dbSNP
rs28381142 778 dbSNP
rs1312138729 781 dbSNP
rs535826450 789 dbSNP
rs554273908 797 dbSNP
rs143862126 798 dbSNP
rs998114579 803 dbSNP
rs1231118443 818 dbSNP
rs1169200307 822 dbSNP
rs1354638905 826 dbSNP
rs1443696527 837 dbSNP
rs1324478990 838 dbSNP
rs985715148 838 dbSNP
rs1029969909 840 dbSNP
rs779453965 844 dbSNP
rs1003987949 859 dbSNP
rs746226572 863 dbSNP
rs1016661361 867 dbSNP
rs1373605443 869 dbSNP
rs28381143 874 dbSNP
rs569935390 880 dbSNP
rs915582537 889 dbSNP
rs962624689 893 dbSNP
rs971448166 898 dbSNP
rs1253575626 900 dbSNP
rs918503603 901 dbSNP
rs1337742566 906 dbSNP
rs981731917 910 dbSNP
rs971084159 920 dbSNP
rs1207967040 923 dbSNP
rs981087463 927 dbSNP
rs1297398204 934 dbSNP
rs924847443 935 dbSNP
rs927054665 936 dbSNP
rs1310796741 940 dbSNP
rs937079766 942 dbSNP
rs558723621 948 dbSNP
rs1055042302 951 dbSNP
rs1309899778 958 dbSNP
rs1427817678 961 dbSNP
rs1369862096 967 dbSNP
rs1273917729 969 dbSNP
rs1163997197 978 dbSNP
rs577471152 1003 dbSNP
rs934841053 1012 dbSNP
rs150613877 1015 dbSNP
rs556393924 1020 dbSNP
rs914691909 1022 dbSNP
rs1179369236 1023 dbSNP
rs80095677 1023 dbSNP
rs541834217 1024 dbSNP
rs902092003 1031 dbSNP
rs28381144 1038 dbSNP
rs1358852294 1041 dbSNP
rs1264024640 1042 dbSNP
rs1244390771 1043 dbSNP
rs1248205362 1044 dbSNP
rs1336574348 1055 dbSNP
rs1050424946 1065 dbSNP
rs901859123 1066 dbSNP
rs1006270649 1073 dbSNP
rs28381145 1074 dbSNP
rs1051050020 1075 dbSNP
rs1162423666 1084 dbSNP
rs753843437 1085 dbSNP
rs1419709752 1097 dbSNP
rs1454042208 1099 dbSNP
rs1407418157 1100 dbSNP
rs1466747539 1101 dbSNP
rs1413637093 1105 dbSNP
rs146185932 1111 dbSNP
rs28381146 1115 dbSNP
rs751854355 1122 dbSNP
rs186834697 1146 dbSNP
rs1251756216 1152 dbSNP
rs993992585 1156 dbSNP
rs1025592476 1160 dbSNP
rs1265793299 1163 dbSNP
rs1209604029 1164 dbSNP
rs971281752 1172 dbSNP
rs1270180341 1173 dbSNP
rs28381147 1174 dbSNP
rs1328519771 1179 dbSNP
rs1275494442 1187 dbSNP
rs1438605259 1199 dbSNP
rs1328403152 1205 dbSNP
rs1322664882 1206 dbSNP
rs1382507474 1215 dbSNP
rs1390421400 1217 dbSNP
rs1318062988 1218 dbSNP
rs1456358154 1221 dbSNP
rs555954166 1227 dbSNP
rs1004040408 1231 dbSNP
rs1016732987 1232 dbSNP
rs962480976 1239 dbSNP
rs1429427664 1246 dbSNP
rs28381148 1251 dbSNP
rs1023109268 1255 dbSNP
rs547641687 1260 dbSNP
rs958703374 1261 dbSNP
rs1465600268 1266 dbSNP
rs989955237 1270 dbSNP
rs981498553 1271 dbSNP
rs1270993219 1272 dbSNP
rs565816303 1276 dbSNP
rs1279489957 1287 dbSNP
rs914316288 1288 dbSNP
rs1342787685 1294 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaucccUUGUGUCC-CGACCACu 5'
                :|:::||| ||||||| 
Target 5' ---attGATGTAGGAGCTGGTGt 3'
 		1 - 20
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.396 4.2e-2 0.623 1.7e-3 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.296 7.5e-2 0.371 3.4e-2 25 Click to see details
GSE28260 Renal cortex and medulla 0.331 1.3e-1 0.238 2.2e-1 13 Click to see details
GSE32688 Pancreatic cancer 0.145 2.1e-1 0.191 1.5e-1 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.104 3.2e-1 -0.305 7.9e-2 23 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.24 3.2e-1 -0.314 2.7e-1 6 Click to see details
GSE21687 Ependynoma primary tumors 0.054 3.4e-1 0.015 4.5e-1 64 Click to see details
GSE38226 Liver fibrosis -0.078 3.7e-1 -0.018 4.7e-1 21 Click to see details
GSE26953 Aortic valvular endothelial cells 0.04 4.3e-1 0.008 4.9e-1 24 Click to see details
GSE28544 Breast cancer 0.031 4.4e-1 0.084 3.5e-1 24 Click to see details
GSE17498 Multiple myeloma -0.008 4.8e-1 -0.047 3.9e-1 40 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.008 4.8e-1 0.513 4.4e-3 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
ESCA -0.837 0 -0.714 0.02 8 Click to see details
COAD 0.817 0.01 0.786 0.02 7 Click to see details
LUSC -0.348 0.02 -0.259 0.06 36 Click to see details
UCEC -0.476 0.02 -0.370 0.06 19 Click to see details
PRAD -0.395 0.03 -0.375 0.03 25 Click to see details
LUAD -0.716 0.05 -0.600 0.1 6 Click to see details
HNSC -0.287 0.06 -0.332 0.04 30 Click to see details
KIRP -0.216 0.12 -0.158 0.19 32 Click to see details
PAAD -0.755 0.12 -0.800 0.1 4 Click to see details
PCPG -0.915 0.13 -1.000 0.5 3 Click to see details
STAD -0.201 0.16 -0.138 0.25 27 Click to see details
CHOL 0.296 0.28 0.429 0.2 6 Click to see details
KICH 0.115 0.32 0.205 0.2 19 Click to see details
THCA 0.063 0.33 0.109 0.22 54 Click to see details
KIRC -0.055 0.34 -0.093 0.25 56 Click to see details
LIHC -0.062 0.35 -0.160 0.16 41 Click to see details
BRCA 0.033 0.4 0.063 0.31 66 Click to see details
BLCA 0.043 0.44 -0.156 0.3 14 Click to see details
BLCA 0.043 0.44 -0.156 0.3 14 Click to see details
BLCA 0.043 0.44 -0.156 0.3 14 Click to see details
BLCA 0.043 0.44 -0.156 0.3 14 Click to see details
210 hsa-miR-1226-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005492 MUC1 mucin 1, cell surface associated 3 1
MIRT036409 IGF1R insulin like growth factor 1 receptor 1 1
MIRT036410 UBE2A ubiquitin conjugating enzyme E2 A 1 1
MIRT036411 WDR1 WD repeat domain 1 1 1
MIRT036412 HIST1H4B histone cluster 1 H4 family member b 1 1
MIRT036413 BLMH bleomycin hydrolase 1 1
MIRT036414 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT036415 KDM2A lysine demethylase 2A 1 1
MIRT036416 RPL35 ribosomal protein L35 1 1
MIRT036417 KARS lysyl-tRNA synthetase 1 1
MIRT036418 AVL9 AVL9 cell migration associated 1 1
MIRT036419 GLUD2 glutamate dehydrogenase 2 1 1
MIRT036420 GALNT2 polypeptide N-acetylgalactosaminyltransferase 2 1 1
MIRT036421 CABIN1 calcineurin binding protein 1 1 1
MIRT036422 LEPREL4 prolyl 3-hydroxylase family member 4 (non-enzymatic) 1 1
MIRT036423 CSDE1 cold shock domain containing E1 1 1
MIRT036424 UBE2G1 ubiquitin conjugating enzyme E2 G1 1 1
MIRT036425 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 1
MIRT036426 CCDC47 coiled-coil domain containing 47 1 1
MIRT036427 SCAMP1 secretory carrier membrane protein 1 1 1
MIRT036428 HSP90AA1 heat shock protein 90 alpha family class A member 1 1 1
MIRT036429 GIMAP8 GTPase, IMAP family member 8 1 1
MIRT036430 MBTPS2 membrane bound transcription factor peptidase, site 2 1 1
MIRT036431 RCC2 regulator of chromosome condensation 2 1 1
MIRT036432 DUT deoxyuridine triphosphatase 1 1
MIRT036433 XYLT2 xylosyltransferase 2 1 1
MIRT036434 SUN2 Sad1 and UNC84 domain containing 2 1 1
MIRT036435 SACS sacsin molecular chaperone 1 1
MIRT036436 C12orf29 chromosome 12 open reading frame 29 1 1
MIRT036437 PSMB2 proteasome subunit beta 2 1 1
MIRT036438 PAF1 PAF1 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT036439 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT036440 PIM2 Pim-2 proto-oncogene, serine/threonine kinase 1 1
MIRT036441 JUNB JunB proto-oncogene, AP-1 transcription factor subunit 1 1
MIRT036442 TBX18 T-box 18 1 1
MIRT036443 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT036444 CYB5B cytochrome b5 type B 1 1
MIRT036445 ATXN2 ataxin 2 1 1
MIRT036446 TBX3 T-box 3 1 1
MIRT036447 EPB41L1 erythrocyte membrane protein band 4.1 like 1 1 1
MIRT036448 TMEM25 transmembrane protein 25 1 1
MIRT036449 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT036450 NDRG3 NDRG family member 3 1 1
MIRT036451 CPSF3L integrator complex subunit 11 1 1
MIRT036452 SORBS2 sorbin and SH3 domain containing 2 1 1
MIRT036453 RPA2 replication protein A2 1 1
MIRT036454 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT036455 ZNF629 zinc finger protein 629 1 1
MIRT036456 NOP2 NOP2 nucleolar protein 1 1
MIRT036457 KIAA1644 KIAA1644 1 1
MIRT036458 HSPA9 heat shock protein family A (Hsp70) member 9 1 1
MIRT036459 ITPR3 inositol 1,4,5-trisphosphate receptor type 3 1 1
MIRT036460 TM9SF4 transmembrane 9 superfamily member 4 1 1
MIRT036461 SLC1A5 solute carrier family 1 member 5 1 1
MIRT036462 EXOC8 exocyst complex component 8 1 1
MIRT036463 ATP6AP2 ATPase H+ transporting accessory protein 2 1 1
MIRT036464 HIST1H4C histone cluster 1 H4 family member c 1 1
MIRT036465 ZDHHC4 zinc finger DHHC-type containing 4 1 1
MIRT036466 ERCC2 ERCC excision repair 2, TFIIH core complex helicase subunit 1 1
MIRT036467 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT036468 RBM27 RNA binding motif protein 27 1 1
MIRT036469 EHHADH enoyl-CoA hydratase and 3-hydroxyacyl CoA dehydrogenase 1 1
MIRT036470 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT036471 RBM10 RNA binding motif protein 10 1 1
MIRT036472 RABGGTB Rab geranylgeranyltransferase beta subunit 1 1
MIRT036473 PFKL phosphofructokinase, liver type 1 1
MIRT036474 TOP2A DNA topoisomerase II alpha 1 1
MIRT036475 KIAA1671 KIAA1671 1 1
MIRT036476 EIF3C eukaryotic translation initiation factor 3 subunit C 1 1
MIRT036477 IPO7 importin 7 1 1
MIRT036478 CTDNEP1 CTD nuclear envelope phosphatase 1 1 1
MIRT036479 ZBTB7B zinc finger and BTB domain containing 7B 1 1
MIRT036480 GPBP1L1 GC-rich promoter binding protein 1 like 1 1 1
MIRT036481 PANK3 pantothenate kinase 3 1 1
MIRT036482 SLC35F6 solute carrier family 35 member F6 1 1
MIRT036483 RPL36A ribosomal protein L36a 1 1
MIRT036484 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT036485 AKIP1 A-kinase interacting protein 1 1 1
MIRT036486 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT036487 ACTG1 actin gamma 1 1 1
MIRT036488 EDC4 enhancer of mRNA decapping 4 1 1
MIRT036489 FTSJD2 cap methyltransferase 1 1 1
MIRT036490 GNB2L1 receptor for activated C kinase 1 1 1
MIRT036491 AP2M1 adaptor related protein complex 2 mu 1 subunit 1 1
MIRT036492 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT036493 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase type 1 alpha 1 1
MIRT036494 ZBTB40 zinc finger and BTB domain containing 40 1 1
MIRT036495 PIK3R4 phosphoinositide-3-kinase regulatory subunit 4 1 1
MIRT036496 CTNNB1 catenin beta 1 1 1
MIRT036497 CEBPA CCAAT/enhancer binding protein alpha 1 1
MIRT036498 PKN3 protein kinase N3 1 1
MIRT036499 FAM3C family with sequence similarity 3 member C 1 1
MIRT036500 IDH1 isocitrate dehydrogenase (NADP(+)) 1, cytosolic 1 1
MIRT036501 CKAP4 cytoskeleton associated protein 4 1 1
MIRT036502 GCN1L1 GCN1, eIF2 alpha kinase activator homolog 1 1
MIRT036503 ASTL astacin like metalloendopeptidase 1 1
MIRT036504 ADAR adenosine deaminase, RNA specific 1 1
MIRT036505 IRAK1 interleukin 1 receptor associated kinase 1 1 1
MIRT036506 ALDH1B1 aldehyde dehydrogenase 1 family member B1 1 1
MIRT036507 HSPB8 heat shock protein family B (small) member 8 1 1
MIRT036508 MCM2 minichromosome maintenance complex component 2 1 1
MIRT036509 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT036510 SIMC1 SUMO interacting motifs containing 1 1 1
MIRT036511 PPIA peptidylprolyl isomerase A 1 1
MIRT036512 CENPF centromere protein F 1 1
MIRT036513 PRPF6 pre-mRNA processing factor 6 1 1
MIRT036514 CHD3 chromodomain helicase DNA binding protein 3 1 1
MIRT036515 PBRM1 polybromo 1 1 1
MIRT036516 USP24 ubiquitin specific peptidase 24 1 1
MIRT036517 UQCC ubiquinol-cytochrome c reductase complex assembly factor 1 1 1
MIRT036518 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 2 3
MIRT036519 CNTNAP3 contactin associated protein like 3 1 1
MIRT036520 DDT D-dopachrome tautomerase 1 1
MIRT036521 ZNF395 zinc finger protein 395 1 1
MIRT036522 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 1 1
MIRT036523 SLC25A39 solute carrier family 25 member 39 1 1
MIRT036524 NCKIPSD NCK interacting protein with SH3 domain 1 1
MIRT036525 AAMP angio associated migratory cell protein 1 1
MIRT036526 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 1 1
MIRT036527 AGPAT6 glycerol-3-phosphate acyltransferase 4 1 1
MIRT036528 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT036529 ABHD14B abhydrolase domain containing 14B 1 1
MIRT036530 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT036531 BAG6 BCL2 associated athanogene 6 1 1
MIRT036532 MRPS26 mitochondrial ribosomal protein S26 1 1
MIRT036533 KIF4B kinesin family member 4B 1 1
MIRT036534 TUBB4B tubulin beta 4B class IVb 1 1
MIRT036535 FAM168B family with sequence similarity 168 member B 1 1
MIRT036536 TUBB4A tubulin beta 4A class IVa 1 1
MIRT036537 AKR1B1 aldo-keto reductase family 1 member B 1 1
MIRT248779 ATXN7L3B ataxin 7 like 3B 2 2
MIRT279943 SLC39A9 solute carrier family 39 member 9 2 4
MIRT337171 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 4
MIRT443071 ABLIM1 actin binding LIM protein 1 2 2
MIRT451814 CDCA3 cell division cycle associated 3 2 2
MIRT467748 SLC36A1 solute carrier family 36 member 1 2 2
MIRT473511 MAZ MYC associated zinc finger protein 2 2
MIRT476233 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 2
MIRT486918 GPX1 glutathione peroxidase 1 2 2
MIRT489205 RPH3AL rabphilin 3A like (without C2 domains) 2 2
MIRT495363 AATF apoptosis antagonizing transcription factor 2 2
MIRT495390 VPS51 VPS51, GARP complex subunit 2 2
MIRT495594 ARHGEF28 Rho guanine nucleotide exchange factor 28 2 2
MIRT495692 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT495833 EHD1 EH domain containing 1 2 2
MIRT499765 CIRH1A UTP4, small subunit processome component 2 10
MIRT504903 CCDC86 coiled-coil domain containing 86 2 2
MIRT513211 RFT1 RFT1 homolog 2 2
MIRT519628 ZNF781 zinc finger protein 781 2 2
MIRT519843 ZFP69B ZFP69 zinc finger protein B 2 4
MIRT530064 PLXNA4 plexin A4 2 2
MIRT531308 GPR26 G protein-coupled receptor 26 2 2
MIRT533268 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT534128 SNX13 sorting nexin 13 2 2
MIRT534291 SLAIN2 SLAIN motif family member 2 2 2
MIRT535866 MORF4L1 mortality factor 4 like 1 2 2
MIRT536022 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT539500 ACTN4 actinin alpha 4 2 2
MIRT547451 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT560019 ZNF525 zinc finger protein 525 2 2
MIRT560084 ZNF195 zinc finger protein 195 2 2
MIRT568722 GRASP general receptor for phosphoinositides 1 associated scaffold protein 2 2
MIRT570893 ZNF780A zinc finger protein 780A 2 2
MIRT571250 FADS6 fatty acid desaturase 6 2 2
MIRT573401 DLC1 DLC1 Rho GTPase activating protein 2 2
MIRT576568 Serpine1 serine (or cysteine) peptidase inhibitor, clade E, member 1 2 2
MIRT612131 NDUFA10 NADH:ubiquinone oxidoreductase subunit A10 2 2
MIRT613022 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT613861 TNFRSF9 TNF receptor superfamily member 9 2 4
MIRT614966 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 2
MIRT616581 FAM107A family with sequence similarity 107 member A 2 2
MIRT626205 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT640512 ANTXR1 anthrax toxin receptor 1 2 2
MIRT640536 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT641548 MOCOS molybdenum cofactor sulfurase 2 2
MIRT641683 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT642859 RNF135 ring finger protein 135 2 2
MIRT649106 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT651844 USP1 ubiquitin specific peptidase 1 2 2
MIRT659044 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT659663 CDC73 cell division cycle 73 2 2
MIRT659959 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT672556 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT675601 ZNF106 zinc finger protein 106 2 2
MIRT676034 C9orf69 transmembrane protein 250 2 2
MIRT678691 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT682730 MSANTD1 Myb/SANT DNA binding domain containing 1 2 2
MIRT682993 RNF40 ring finger protein 40 2 2
MIRT687354 NUP98 nucleoporin 98 2 2
MIRT697178 INMT indolethylamine N-methyltransferase 2 2
MIRT698735 STX12 syntaxin 12 2 2
MIRT699632 SH3BP5 SH3 domain binding protein 5 2 2
MIRT704560 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT704708 CHEK1 checkpoint kinase 1 2 2
MIRT709863 PDIK1L PDLIM1 interacting kinase 1 like 2 2
MIRT712792 ZNF154 zinc finger protein 154 2 2
MIRT712918 MRGPRF MAS related GPR family member F 2 2
MIRT714040 ELMO1 engulfment and cell motility 1 2 2
MIRT714417 TBC1D16 TBC1 domain family member 16 2 2
MIRT714539 ZBTB39 zinc finger and BTB domain containing 39 2 2
MIRT715975 FADS3 fatty acid desaturase 3 2 2
MIRT716452 TMPRSS11BNL TMPRSS11B N-terminal like, pseudogene 2 2
MIRT716996 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT718745 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT719103 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 2 2
MIRT721047 TRIM67 tripartite motif containing 67 2 2
MIRT721082 FTSJ2 mitochondrial rRNA methyltransferase 2 2 2
MIRT722291 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT722940 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT725148 SLC43A1 solute carrier family 43 member 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1226 Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma tissue
hsa-mir-1226 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-mir-1226 Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-1226 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-1226 Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-mir-1226 Fluorouracil 3385 NSC19893 approved sensitive cell line (KYSE)
hsa-mir-1226 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-1226-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1226-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1226-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-1226-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-1226-3p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-1226-3p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-1226-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-1226-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1226-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, SK-HEP-1)
hsa-miR-1226-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-1226-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1226-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-1226-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-1226-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-1226-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-1226-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-1226-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-1226-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1226-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVCAR3)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H460)

Error report submission