miRTarBase - #MIRT036433


—
pre-miRNA Information
pre-miRNA hsa-mir-1226   
Genomic Coordinates chr3: 47849555 - 47849629
Synonyms MIRN1226, hsa-mir-1226, MIR1226
Description Homo sapiens miR-1226 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1226-3p
Sequence 54| UCACCAGCCCUGUGUUCCCUAG |75
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM111744 10 COSMIC
COSM8170291 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1472927902 1 dbSNP
rs370902478 2 dbSNP
rs750372577 5 dbSNP
rs754955605 6 dbSNP
rs373981655 9 dbSNP
rs1431438028 11 dbSNP
rs747968275 12 dbSNP
rs372320878 19 dbSNP
rs141645399 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol XYLT2   
Synonyms PXYLT2, SOS, XT-II, XT2, xylT-II
Description xylosyltransferase 2
Transcript NM_022167   
Expression
Putative miRNA Targets on XYLT2
3'UTR of XYLT2
(miRNA target sites are highlighted)		 
>XYLT2|NM_022167|3'UTR
   1 CAGGGCCCCAGCCAGTACCCGTGGAGGACCCGGGAAATTGCACCTTACAGACAGTGGAGGGGTGTCCCCTCCCACAGGCA
  81 AGAACCAGAGGCCCAGGCTGCACACCCATTTCAGCCATCAAGAACCCACACAGACGGCAGGGAAGGTGGACACAGTATGA
 161 ACTACTGCTGATGTCTCTGTTGGGGATCAGAGGGCTGGCGGGAACGCGAGAAGGGCACCAGCAGCATTCCACACCCAGCT
 241 CTTCCTCACCTTCCTGTCTAGTTTGAATTTCTTTTTTTTCTTTTTTTTTTTTTTTTTTTAATTTAAAAAGGAAAATGGGT
 321 GGTTGGGAGAGAAACTAGAACAGAAGATGTGCAATAGGGCTCAGAGCAGCCCCAGGAAGTGGGCCATGTCTGTGGGGAGC
 401 AGGGGCTTGCTGAGCCCACCTGCTATTGTTCTGCACGAGGCTGGGCCTGCCTCACTCTCCAGGGCCTCATGCCCCATTCT
 481 GGGCCTGTGGTGCTCGTGGCTGAGGCTCCACAGGGCTGCAAGTGCCCTGCCAGGCTCTAAGGCCCGAAGAACAGGTGATA
 561 TCGGGGGCGCTGCAGAGCTGGGCTCTAGCAGGACAGTTCTTTTGTAGCCAGGGGACCCTAGAAGTGGGGTGGGGCGGCTC
 641 CAGGGCTTTCCAGCATACCCTGCCCCTGGATGGGAAAGGCAGGGTCAGGGCCCACTGAGACCCATGCAGAGTTTCCAGGT
 721 GTGCACTGGAAGTGAGGTCACATGAGCAGCGTGGGAAGAAGACTCTGTCAAGACTCTCAGAAGAACCTGGAGTAATTGTG
 801 CCTGAAGCTCAGCGTGAAGTCTGAAATATGCAACAGAAGAAATATATCTCTATCTCTCTACTCTGGGCTCTGTGTTTTTC
 881 CTCCTGGGTGTCAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaUCCCUUGUGUCCCGACCACu 5'
            :|||| || |||||||| | 
Target 5' ttGGGGATCAGAGGGCTGGCGg 3'
 180 - 201 148.00 -30.10
2 
miRNA  3' gaUCCCUUGUGUCCCGAC---CACu 5'
            |||   ||||||||||   ||| 
Target 5' tgAGGCTCCACAGGGCTGCAAGTGc 3'
 501 - 525 128.00 -22.90
3 
miRNA  3' gaUCCCUUG-UGUCCCGACCacu 5'
            :||| :| :||| |||||   
Target 5' cgGGGGCGCTGCAGAGCTGGgct 3'
 562 - 584 124.00 -19.12
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM5099270 1 COSMIC
COSN30757407 32 COSMIC
COSN15622619 49 COSMIC
COSN20079079 146 COSMIC
COSN14462127 219 COSMIC
COSN42411 261 COSMIC
COSN31592965 288 COSMIC
COSN31587961 289 COSMIC
COSN26639733 519 COSMIC
COSN30541760 729 COSMIC
COSN22000028 770 COSMIC
COSN31514441 845 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759008578 3 dbSNP
rs371628056 4 dbSNP
rs752194705 5 dbSNP
rs1315312474 6 dbSNP
rs755688746 6 dbSNP
rs748970728 7 dbSNP
rs756980598 9 dbSNP
rs778809144 17 dbSNP
rs555173334 19 dbSNP
rs200973528 21 dbSNP
rs200417687 22 dbSNP
rs775422546 23 dbSNP
rs981269532 25 dbSNP
rs747027423 26 dbSNP
rs1334468641 27 dbSNP
rs768758557 32 dbSNP
rs202105650 33 dbSNP
rs1320360472 34 dbSNP
rs955913317 37 dbSNP
rs762131406 39 dbSNP
rs765511309 41 dbSNP
rs1435633049 43 dbSNP
rs777035020 44 dbSNP
rs370911099 46 dbSNP
rs1360929629 47 dbSNP
rs957154959 47 dbSNP
rs1326311782 53 dbSNP
rs527677091 54 dbSNP
rs374021879 65 dbSNP
rs1467219940 66 dbSNP
rs867643901 72 dbSNP
rs921011352 83 dbSNP
rs1172834290 86 dbSNP
rs947164891 87 dbSNP
rs1190890312 88 dbSNP
rs1450414233 96 dbSNP
rs1247801184 100 dbSNP
rs561418470 101 dbSNP
rs1484538215 106 dbSNP
rs1401151751 107 dbSNP
rs1468050824 114 dbSNP
rs1333275485 118 dbSNP
rs1377645738 121 dbSNP
rs1446093598 122 dbSNP
rs1305017482 126 dbSNP
rs1276407281 127 dbSNP
rs530104376 131 dbSNP
rs759845603 133 dbSNP
rs910970742 136 dbSNP
rs1293219591 137 dbSNP
rs944235125 146 dbSNP
rs1343243283 150 dbSNP
rs1200979682 156 dbSNP
rs1379853147 158 dbSNP
rs1303491533 171 dbSNP
rs939886347 174 dbSNP
rs1036881114 178 dbSNP
rs764832202 181 dbSNP
rs1170645234 189 dbSNP
rs1430679261 194 dbSNP
rs183006590 199 dbSNP
rs142287035 200 dbSNP
rs1177339248 201 dbSNP
rs1247758404 206 dbSNP
rs367598607 207 dbSNP
rs151243405 208 dbSNP
rs140413577 209 dbSNP
rs534505673 216 dbSNP
rs1205384904 220 dbSNP
rs1341052719 220 dbSNP
rs888408356 246 dbSNP
rs1045668665 263 dbSNP
rs753759831 268 dbSNP
rs1479333538 269 dbSNP
rs1491006484 270 dbSNP
rs757198701 271 dbSNP
rs1353598617 272 dbSNP
rs1370230487 272 dbSNP
rs1410641713 272 dbSNP
rs146904706 272 dbSNP
rs907471138 273 dbSNP
rs1464989203 274 dbSNP
rs999481318 274 dbSNP
rs1164613566 275 dbSNP
rs1369426187 275 dbSNP
rs1413472491 276 dbSNP
rs1474532603 276 dbSNP
rs1048006830 277 dbSNP
rs1248045368 277 dbSNP
rs1296412346 278 dbSNP
rs1231326015 279 dbSNP
rs906596779 279 dbSNP
rs1002721589 280 dbSNP
rs750117907 280 dbSNP
rs1200497936 281 dbSNP
rs1211630917 281 dbSNP
rs1266382651 281 dbSNP
rs141916726 281 dbSNP
rs1433432551 281 dbSNP
rs1466196999 281 dbSNP
rs1491545172 281 dbSNP
rs749932170 281 dbSNP
rs879079576 281 dbSNP
rs879204056 281 dbSNP
rs386386236 282 dbSNP
rs1349965011 283 dbSNP
rs200739810 284 dbSNP
rs202152162 285 dbSNP
rs955943386 285 dbSNP
rs1400667097 286 dbSNP
rs35374852 286 dbSNP
rs1466202991 287 dbSNP
rs56293548 287 dbSNP
rs1191503432 288 dbSNP
rs1451036645 288 dbSNP
rs1300830905 289 dbSNP
rs1202293467 290 dbSNP
rs989100777 290 dbSNP
rs1279806531 291 dbSNP
rs1232372745 292 dbSNP
rs1367741316 294 dbSNP
rs1343943235 295 dbSNP
rs55719603 300 dbSNP
rs866849469 300 dbSNP
rs1017664732 301 dbSNP
rs965169704 302 dbSNP
rs1279285906 306 dbSNP
rs1317725609 307 dbSNP
rs9898777 317 dbSNP
rs1171289797 319 dbSNP
rs1431287908 320 dbSNP
rs996657921 321 dbSNP
rs1390507233 327 dbSNP
rs1167163895 329 dbSNP
rs74348453 332 dbSNP
rs1188175264 333 dbSNP
rs1443006165 334 dbSNP
rs1011739458 347 dbSNP
rs1209988340 349 dbSNP
rs1028118395 350 dbSNP
rs1489750242 352 dbSNP
rs1214416632 356 dbSNP
rs1338002912 361 dbSNP
rs1286412234 366 dbSNP
rs1246172413 373 dbSNP
rs1021537508 376 dbSNP
rs1310570677 379 dbSNP
rs1411256016 381 dbSNP
rs968831392 383 dbSNP
rs985126799 388 dbSNP
rs1407941230 396 dbSNP
rs1477373180 397 dbSNP
rs1168157428 398 dbSNP
rs1415696769 401 dbSNP
rs2526537 404 dbSNP
rs943760051 412 dbSNP
rs574270654 417 dbSNP
rs568161239 420 dbSNP
rs919839531 426 dbSNP
rs1233732789 427 dbSNP
rs976905473 429 dbSNP
rs1204098155 434 dbSNP
rs570570456 437 dbSNP
rs930249608 438 dbSNP
rs1229351071 443 dbSNP
rs1334806709 444 dbSNP
rs760225141 450 dbSNP
rs772599210 450 dbSNP
rs1350722070 454 dbSNP
rs1402037741 461 dbSNP
rs888701614 477 dbSNP
rs1351368451 482 dbSNP
rs763582876 485 dbSNP
rs1213239461 490 dbSNP
rs1392274740 493 dbSNP
rs1045074700 496 dbSNP
rs78035001 497 dbSNP
rs1003591156 500 dbSNP
rs1408823971 507 dbSNP
rs1244857419 512 dbSNP
rs1045719315 514 dbSNP
rs1290338883 516 dbSNP
rs1035531482 518 dbSNP
rs1248786553 523 dbSNP
rs1489654565 528 dbSNP
rs891669035 534 dbSNP
rs1053815543 537 dbSNP
rs1010070593 546 dbSNP
rs1021987791 547 dbSNP
rs893386692 559 dbSNP
rs1012163874 561 dbSNP
rs374553813 563 dbSNP
rs1362822703 564 dbSNP
rs968653457 565 dbSNP
rs1028463612 569 dbSNP
rs72832457 570 dbSNP
rs1164021193 572 dbSNP
rs1017870550 576 dbSNP
rs1368521286 583 dbSNP
rs545741603 591 dbSNP
rs1019356674 596 dbSNP
rs1421607450 605 dbSNP
rs1399151269 611 dbSNP
rs1427595402 612 dbSNP
rs1159461250 627 dbSNP
rs1194646936 629 dbSNP
rs146505862 635 dbSNP
rs572142698 636 dbSNP
rs575202192 637 dbSNP
rs541042869 656 dbSNP
rs1280519070 663 dbSNP
rs948823052 666 dbSNP
rs928708910 668 dbSNP
rs1193791233 669 dbSNP
rs934697706 670 dbSNP
rs534511885 676 dbSNP
rs1361244621 679 dbSNP
rs1313556709 682 dbSNP
rs910153383 698 dbSNP
rs948307164 703 dbSNP
rs1286279531 708 dbSNP
rs1316008926 728 dbSNP
rs756002181 730 dbSNP
rs1170931392 733 dbSNP
rs561097978 735 dbSNP
rs893389060 738 dbSNP
rs1257488384 743 dbSNP
rs927915704 744 dbSNP
rs1483913548 752 dbSNP
rs1257629442 755 dbSNP
rs1484507848 763 dbSNP
rs779208299 763 dbSNP
rs1052563415 769 dbSNP
rs892535476 772 dbSNP
rs1049939644 776 dbSNP
rs1010515837 777 dbSNP
rs1293267328 779 dbSNP
rs1229969237 780 dbSNP
rs1008388631 797 dbSNP
rs1042869400 804 dbSNP
rs1414378298 805 dbSNP
rs1373938060 808 dbSNP
rs904455526 811 dbSNP
rs1179385600 813 dbSNP
rs994241638 814 dbSNP
rs1006722260 815 dbSNP
rs748392190 816 dbSNP
rs1417912365 817 dbSNP
rs552722392 823 dbSNP
rs952750226 830 dbSNP
rs1484477351 831 dbSNP
rs997803744 837 dbSNP
rs1196018424 838 dbSNP
rs1025370109 840 dbSNP
rs1480152389 846 dbSNP
rs185935405 853 dbSNP
rs1335448622 857 dbSNP
rs117284251 862 dbSNP
rs1232822576 869 dbSNP
rs1023487128 871 dbSNP
rs1360040581 871 dbSNP
rs984708122 878 dbSNP
rs1309351018 887 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaucccUUGUGUCCCGACCACu 5'
                ||:: :| ||||||| 
Target 5' ----ccAATGAGGAGCTGGTGg 3'
 		1 - 18
Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis 0.407 3.4e-2 0.312 8.4e-2 21 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.745 4.5e-2 0.829 2.1e-2 6 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.334 5.1e-2 0.392 2.6e-2 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.303 8.0e-2 0.083 3.5e-1 23 Click to see details
GSE28544 Breast cancer 0.274 9.8e-2 0.264 1.1e-1 24 Click to see details
GSE32688 Pancreatic cancer -0.149 2.1e-1 0.074 3.4e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells -0.157 2.3e-1 -0.154 2.4e-1 24 Click to see details
GSE17498 Multiple myeloma 0.102 2.7e-1 0.102 2.7e-1 40 Click to see details
GSE28260 Renal cortex and medulla -0.187 2.7e-1 -0.004 4.9e-1 13 Click to see details
GSE21687 Ependynoma primary tumors 0.064 3.1e-1 0.010 4.7e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.027 4.5e-1 0.071 3.7e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.03 4.5e-1 -0.427 3.0e-2 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.388 0.01 0.478 0 41 Click to see details
THCA 0.21 0.06 0.211 0.06 54 Click to see details
COAD -0.62 0.07 -0.679 0.05 7 Click to see details
KIRC -0.161 0.12 -0.183 0.09 56 Click to see details
PCPG -0.898 0.15 -1.000 0.5 3 Click to see details
KIRP -0.134 0.23 -0.059 0.37 32 Click to see details
UCEC -0.177 0.23 -0.140 0.28 19 Click to see details
ESCA -0.26 0.27 -0.262 0.27 8 Click to see details
PAAD 0.239 0.38 0.400 0.3 4 Click to see details
PRAD -0.061 0.39 -0.202 0.17 25 Click to see details
LUSC 0.041 0.41 0.044 0.4 36 Click to see details
STAD -0.032 0.44 0.007 0.49 27 Click to see details
KICH 0.032 0.45 -0.105 0.33 19 Click to see details
BLCA 0.035 0.45 0.081 0.39 14 Click to see details
LUAD 0.062 0.45 -0.200 0.35 6 Click to see details
HNSC -0.016 0.47 -0.120 0.26 30 Click to see details
CHOL -0.023 0.48 -0.257 0.31 6 Click to see details
BRCA 0 0.5 0.069 0.29 66 Click to see details
BRCA 0 0.5 0.069 0.29 66 Click to see details
BRCA 0 0.5 0.069 0.29 66 Click to see details
BRCA 0 0.5 0.069 0.29 66 Click to see details
210 hsa-miR-1226-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005492 MUC1 mucin 1, cell surface associated 3 1
MIRT036409 IGF1R insulin like growth factor 1 receptor 1 1
MIRT036410 UBE2A ubiquitin conjugating enzyme E2 A 1 1
MIRT036411 WDR1 WD repeat domain 1 1 1
MIRT036412 HIST1H4B histone cluster 1 H4 family member b 1 1
MIRT036413 BLMH bleomycin hydrolase 1 1
MIRT036414 HSPA1B heat shock protein family A (Hsp70) member 1B 1 1
MIRT036415 KDM2A lysine demethylase 2A 1 1
MIRT036416 RPL35 ribosomal protein L35 1 1
MIRT036417 KARS lysyl-tRNA synthetase 1 1
MIRT036418 AVL9 AVL9 cell migration associated 1 1
MIRT036419 GLUD2 glutamate dehydrogenase 2 1 1
MIRT036420 GALNT2 polypeptide N-acetylgalactosaminyltransferase 2 1 1
MIRT036421 CABIN1 calcineurin binding protein 1 1 1
MIRT036422 LEPREL4 prolyl 3-hydroxylase family member 4 (non-enzymatic) 1 1
MIRT036423 CSDE1 cold shock domain containing E1 1 1
MIRT036424 UBE2G1 ubiquitin conjugating enzyme E2 G1 1 1
MIRT036425 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 1 1
MIRT036426 CCDC47 coiled-coil domain containing 47 1 1
MIRT036427 SCAMP1 secretory carrier membrane protein 1 1 1
MIRT036428 HSP90AA1 heat shock protein 90 alpha family class A member 1 1 1
MIRT036429 GIMAP8 GTPase, IMAP family member 8 1 1
MIRT036430 MBTPS2 membrane bound transcription factor peptidase, site 2 1 1
MIRT036431 RCC2 regulator of chromosome condensation 2 1 1
MIRT036432 DUT deoxyuridine triphosphatase 1 1
MIRT036433 XYLT2 xylosyltransferase 2 1 1
MIRT036434 SUN2 Sad1 and UNC84 domain containing 2 1 1
MIRT036435 SACS sacsin molecular chaperone 1 1
MIRT036436 C12orf29 chromosome 12 open reading frame 29 1 1
MIRT036437 PSMB2 proteasome subunit beta 2 1 1
MIRT036438 PAF1 PAF1 homolog, Paf1/RNA polymerase II complex component 1 1
MIRT036439 SCAMP4 secretory carrier membrane protein 4 1 1
MIRT036440 PIM2 Pim-2 proto-oncogene, serine/threonine kinase 1 1
MIRT036441 JUNB JunB proto-oncogene, AP-1 transcription factor subunit 1 1
MIRT036442 TBX18 T-box 18 1 1
MIRT036443 ACIN1 apoptotic chromatin condensation inducer 1 1 1
MIRT036444 CYB5B cytochrome b5 type B 1 1
MIRT036445 ATXN2 ataxin 2 1 1
MIRT036446 TBX3 T-box 3 1 1
MIRT036447 EPB41L1 erythrocyte membrane protein band 4.1 like 1 1 1
MIRT036448 TMEM25 transmembrane protein 25 1 1
MIRT036449 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT036450 NDRG3 NDRG family member 3 1 1
MIRT036451 CPSF3L integrator complex subunit 11 1 1
MIRT036452 SORBS2 sorbin and SH3 domain containing 2 1 1
MIRT036453 RPA2 replication protein A2 1 1
MIRT036454 LONRF1 LON peptidase N-terminal domain and ring finger 1 1 1
MIRT036455 ZNF629 zinc finger protein 629 1 1
MIRT036456 NOP2 NOP2 nucleolar protein 1 1
MIRT036457 KIAA1644 KIAA1644 1 1
MIRT036458 HSPA9 heat shock protein family A (Hsp70) member 9 1 1
MIRT036459 ITPR3 inositol 1,4,5-trisphosphate receptor type 3 1 1
MIRT036460 TM9SF4 transmembrane 9 superfamily member 4 1 1
MIRT036461 SLC1A5 solute carrier family 1 member 5 1 1
MIRT036462 EXOC8 exocyst complex component 8 1 1
MIRT036463 ATP6AP2 ATPase H+ transporting accessory protein 2 1 1
MIRT036464 HIST1H4C histone cluster 1 H4 family member c 1 1
MIRT036465 ZDHHC4 zinc finger DHHC-type containing 4 1 1
MIRT036466 ERCC2 ERCC excision repair 2, TFIIH core complex helicase subunit 1 1
MIRT036467 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT036468 RBM27 RNA binding motif protein 27 1 1
MIRT036469 EHHADH enoyl-CoA hydratase and 3-hydroxyacyl CoA dehydrogenase 1 1
MIRT036470 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT036471 RBM10 RNA binding motif protein 10 1 1
MIRT036472 RABGGTB Rab geranylgeranyltransferase beta subunit 1 1
MIRT036473 PFKL phosphofructokinase, liver type 1 1
MIRT036474 TOP2A DNA topoisomerase II alpha 1 1
MIRT036475 KIAA1671 KIAA1671 1 1
MIRT036476 EIF3C eukaryotic translation initiation factor 3 subunit C 1 1
MIRT036477 IPO7 importin 7 1 1
MIRT036478 CTDNEP1 CTD nuclear envelope phosphatase 1 1 1
MIRT036479 ZBTB7B zinc finger and BTB domain containing 7B 1 1
MIRT036480 GPBP1L1 GC-rich promoter binding protein 1 like 1 1 1
MIRT036481 PANK3 pantothenate kinase 3 1 1
MIRT036482 SLC35F6 solute carrier family 35 member F6 1 1
MIRT036483 RPL36A ribosomal protein L36a 1 1
MIRT036484 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 1 1
MIRT036485 AKIP1 A-kinase interacting protein 1 1 1
MIRT036486 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT036487 ACTG1 actin gamma 1 1 1
MIRT036488 EDC4 enhancer of mRNA decapping 4 1 1
MIRT036489 FTSJD2 cap methyltransferase 1 1 1
MIRT036490 GNB2L1 receptor for activated C kinase 1 1 1
MIRT036491 AP2M1 adaptor related protein complex 2 mu 1 subunit 1 1
MIRT036492 ASCC3 activating signal cointegrator 1 complex subunit 3 1 1
MIRT036493 PIP5K1A phosphatidylinositol-4-phosphate 5-kinase type 1 alpha 1 1
MIRT036494 ZBTB40 zinc finger and BTB domain containing 40 1 1
MIRT036495 PIK3R4 phosphoinositide-3-kinase regulatory subunit 4 1 1
MIRT036496 CTNNB1 catenin beta 1 1 1
MIRT036497 CEBPA CCAAT/enhancer binding protein alpha 1 1
MIRT036498 PKN3 protein kinase N3 1 1
MIRT036499 FAM3C family with sequence similarity 3 member C 1 1
MIRT036500 IDH1 isocitrate dehydrogenase (NADP(+)) 1, cytosolic 1 1
MIRT036501 CKAP4 cytoskeleton associated protein 4 1 1
MIRT036502 GCN1L1 GCN1, eIF2 alpha kinase activator homolog 1 1
MIRT036503 ASTL astacin like metalloendopeptidase 1 1
MIRT036504 ADAR adenosine deaminase, RNA specific 1 1
MIRT036505 IRAK1 interleukin 1 receptor associated kinase 1 1 1
MIRT036506 ALDH1B1 aldehyde dehydrogenase 1 family member B1 1 1
MIRT036507 HSPB8 heat shock protein family B (small) member 8 1 1
MIRT036508 MCM2 minichromosome maintenance complex component 2 1 1
MIRT036509 SGPL1 sphingosine-1-phosphate lyase 1 1 1
MIRT036510 SIMC1 SUMO interacting motifs containing 1 1 1
MIRT036511 PPIA peptidylprolyl isomerase A 1 1
MIRT036512 CENPF centromere protein F 1 1
MIRT036513 PRPF6 pre-mRNA processing factor 6 1 1
MIRT036514 CHD3 chromodomain helicase DNA binding protein 3 1 1
MIRT036515 PBRM1 polybromo 1 1 1
MIRT036516 USP24 ubiquitin specific peptidase 24 1 1
MIRT036517 UQCC ubiquinol-cytochrome c reductase complex assembly factor 1 1 1
MIRT036518 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 2 3
MIRT036519 CNTNAP3 contactin associated protein like 3 1 1
MIRT036520 DDT D-dopachrome tautomerase 1 1
MIRT036521 ZNF395 zinc finger protein 395 1 1
MIRT036522 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 1 1
MIRT036523 SLC25A39 solute carrier family 25 member 39 1 1
MIRT036524 NCKIPSD NCK interacting protein with SH3 domain 1 1
MIRT036525 AAMP angio associated migratory cell protein 1 1
MIRT036526 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 1 1
MIRT036527 AGPAT6 glycerol-3-phosphate acyltransferase 4 1 1
MIRT036528 QPRT quinolinate phosphoribosyltransferase 1 1
MIRT036529 ABHD14B abhydrolase domain containing 14B 1 1
MIRT036530 BIRC5 baculoviral IAP repeat containing 5 1 1
MIRT036531 BAG6 BCL2 associated athanogene 6 1 1
MIRT036532 MRPS26 mitochondrial ribosomal protein S26 1 1
MIRT036533 KIF4B kinesin family member 4B 1 1
MIRT036534 TUBB4B tubulin beta 4B class IVb 1 1
MIRT036535 FAM168B family with sequence similarity 168 member B 1 1
MIRT036536 TUBB4A tubulin beta 4A class IVa 1 1
MIRT036537 AKR1B1 aldo-keto reductase family 1 member B 1 1
MIRT248779 ATXN7L3B ataxin 7 like 3B 2 2
MIRT279943 SLC39A9 solute carrier family 39 member 9 2 4
MIRT337171 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 4
MIRT443071 ABLIM1 actin binding LIM protein 1 2 2
MIRT451814 CDCA3 cell division cycle associated 3 2 2
MIRT467748 SLC36A1 solute carrier family 36 member 1 2 2
MIRT473511 MAZ MYC associated zinc finger protein 2 2
MIRT476233 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 2
MIRT486918 GPX1 glutathione peroxidase 1 2 2
MIRT489205 RPH3AL rabphilin 3A like (without C2 domains) 2 2
MIRT495363 AATF apoptosis antagonizing transcription factor 2 2
MIRT495390 VPS51 VPS51, GARP complex subunit 2 2
MIRT495594 ARHGEF28 Rho guanine nucleotide exchange factor 28 2 2
MIRT495692 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT495833 EHD1 EH domain containing 1 2 2
MIRT499765 CIRH1A UTP4, small subunit processome component 2 10
MIRT504903 CCDC86 coiled-coil domain containing 86 2 2
MIRT513211 RFT1 RFT1 homolog 2 2
MIRT519628 ZNF781 zinc finger protein 781 2 2
MIRT519843 ZFP69B ZFP69 zinc finger protein B 2 4
MIRT530064 PLXNA4 plexin A4 2 2
MIRT531308 GPR26 G protein-coupled receptor 26 2 2
MIRT533268 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT534128 SNX13 sorting nexin 13 2 2
MIRT534291 SLAIN2 SLAIN motif family member 2 2 2
MIRT535866 MORF4L1 mortality factor 4 like 1 2 2
MIRT536022 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT539500 ACTN4 actinin alpha 4 2 2
MIRT547451 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 2
MIRT560019 ZNF525 zinc finger protein 525 2 2
MIRT560084 ZNF195 zinc finger protein 195 2 2
MIRT568722 GRASP general receptor for phosphoinositides 1 associated scaffold protein 2 2
MIRT570893 ZNF780A zinc finger protein 780A 2 2
MIRT571250 FADS6 fatty acid desaturase 6 2 2
MIRT573401 DLC1 DLC1 Rho GTPase activating protein 2 2
MIRT576568 Serpine1 serine (or cysteine) peptidase inhibitor, clade E, member 1 2 2
MIRT612131 NDUFA10 NADH:ubiquinone oxidoreductase subunit A10 2 2
MIRT613022 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT613861 TNFRSF9 TNF receptor superfamily member 9 2 4
MIRT614966 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 2
MIRT616581 FAM107A family with sequence similarity 107 member A 2 2
MIRT626205 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT640512 ANTXR1 anthrax toxin receptor 1 2 2
MIRT640536 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT641548 MOCOS molybdenum cofactor sulfurase 2 2
MIRT641683 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT642859 RNF135 ring finger protein 135 2 2
MIRT649106 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT651844 USP1 ubiquitin specific peptidase 1 2 2
MIRT659044 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT659663 CDC73 cell division cycle 73 2 2
MIRT659959 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT672556 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT675601 ZNF106 zinc finger protein 106 2 2
MIRT676034 C9orf69 transmembrane protein 250 2 2
MIRT678691 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT682730 MSANTD1 Myb/SANT DNA binding domain containing 1 2 2
MIRT682993 RNF40 ring finger protein 40 2 2
MIRT687354 NUP98 nucleoporin 98 2 2
MIRT697178 INMT indolethylamine N-methyltransferase 2 2
MIRT698735 STX12 syntaxin 12 2 2
MIRT699632 SH3BP5 SH3 domain binding protein 5 2 2
MIRT704560 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT704708 CHEK1 checkpoint kinase 1 2 2
MIRT709863 PDIK1L PDLIM1 interacting kinase 1 like 2 2
MIRT712792 ZNF154 zinc finger protein 154 2 2
MIRT712918 MRGPRF MAS related GPR family member F 2 2
MIRT714040 ELMO1 engulfment and cell motility 1 2 2
MIRT714417 TBC1D16 TBC1 domain family member 16 2 2
MIRT714539 ZBTB39 zinc finger and BTB domain containing 39 2 2
MIRT715975 FADS3 fatty acid desaturase 3 2 2
MIRT716452 TMPRSS11BNL TMPRSS11B N-terminal like, pseudogene 2 2
MIRT716996 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT718745 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT719103 PCYT1A phosphate cytidylyltransferase 1, choline, alpha 2 2
MIRT721047 TRIM67 tripartite motif containing 67 2 2
MIRT721082 FTSJ2 mitochondrial rRNA methyltransferase 2 2 2
MIRT722291 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT722940 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT725148 SLC43A1 solute carrier family 43 member 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1226 Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma tissue
hsa-mir-1226 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-mir-1226 Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-1226 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-1226 Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-mir-1226 Fluorouracil 3385 NSC19893 approved sensitive cell line (KYSE)
hsa-mir-1226 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-1226-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1226-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1226-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Squamous Cell Carcinoma cell line (KYSE410)
hsa-miR-1226-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-1226-3p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-1226-3p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-1226-3p Fluorouracil 3385 NSC19893 approved sensitive Low Esophageal Squamous Cell Carcinoma cell line (KYSE-70, KYSE-140, KYSE-180, KYSE-270, KYSE-410, KYSE-520)
hsa-miR-1226-3p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1226-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, SK-HEP-1)
hsa-miR-1226-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-1226-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1226-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-1226-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-1226-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-1226-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-1226-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-1226-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-1226-3p Ethanol+Tamoxifen sensitive cell line (LY2)
hsa-miR-1226-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1226-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVCAR3)
hsa-miR-1226-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H460)

Error report submission