miRTarBase - #MIRT037392


—
pre-miRNA Information
pre-miRNA hsa-mir-744   
Genomic Coordinates chr17: 12081899 - 12081996
Synonyms MIRN744, hsa-mir-744, MIR744
Description Homo sapiens miR-744 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-744-5p
Sequence 11| UGCGGGGCUAGGGCUAACAGCA |32
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN23015028 1 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs557969425 1 dbSNP
rs748252260 4 dbSNP
rs1470408501 7 dbSNP
rs1178657616 10 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B6B8SM miR-744-5p Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Real-time polymerase chain reaction
Gene Information
Gene Symbol RNASEK   
Synonyms -
Description ribonuclease K
Transcript NM_001004333   
Expression
Putative miRNA Targets on RNASEK
3'UTR of RNASEK
(miRNA target sites are highlighted)		 
>RNASEK|NM_001004333|3'UTR
   1 GGCCCCGGCGCGTTTCCCCGCTCCAGCCCCTCCTCTATTTAAAGACTCCCTGCACCGTGTCACCCAGGTCGCGTCCCACC
  81 CTTGCCGGCGCCCTCTGCGGGACTGGGTTTCCCGGGCGAGAGACTGAATCCCTTCTCCCATCTCTGGCATCCGGCCCCCG
 161 TGGAGAGGGCTGAGGCTGGGGGGCTGTTCCGTTTCTCCACCCTTCGCTGTGTCCCGTATCTCAATAAAGAGAATCTGCTC
 241 TCTTCAGAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acgacaauCGGGAUCGGGGCGu 5'
                  ||:| |||||| | 
Target 5' gtttccccGCTCCAGCCCCTCc 3'
 12 - 33 126.00 -14.70
2 
miRNA  3' acgacaaucgggaUCGGGGCgu 5'
                       :||||||  
Target 5' -------------GGCCCCGgc 3'
 1 - 9 121.00 -13.00
3 
miRNA  3' acgacAAUCGGGAUCGGGGCGu 5'
               || ||: | |:||||: 
Target 5' cacccTTCGCTGT-GTCCCGTa 3'
 198 - 218 120.00 -17.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM9286611 17 COSMIC
COSM4130538 99 COSMIC
COSN27335072 189 COSMIC
COSN20093198 213 COSMIC
COSN6660331 246 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1269544487 2 dbSNP
rs1291486064 4 dbSNP
rs1198776733 5 dbSNP
rs761992612 7 dbSNP
rs1198614927 8 dbSNP
rs1455896561 13 dbSNP
rs765350299 20 dbSNP
rs554426318 21 dbSNP
rs571009523 22 dbSNP
rs752522053 26 dbSNP
rs201976956 27 dbSNP
rs774136570 27 dbSNP
rs755999102 29 dbSNP
rs1404175150 33 dbSNP
rs777710655 36 dbSNP
rs753580168 37 dbSNP
rs1035001359 38 dbSNP
rs1373081131 47 dbSNP
rs1441435206 49 dbSNP
rs756945368 50 dbSNP
rs1362724898 54 dbSNP
rs548068354 57 dbSNP
rs1272076451 58 dbSNP
rs566474251 65 dbSNP
rs780623689 69 dbSNP
rs1473867021 72 dbSNP
rs747457473 74 dbSNP
rs1470196024 76 dbSNP
rs1214819080 84 dbSNP
rs967947425 85 dbSNP
rs769049104 87 dbSNP
rs1427047695 88 dbSNP
rs1194887723 90 dbSNP
rs1373286490 91 dbSNP
rs1250418638 93 dbSNP
rs776959452 94 dbSNP
rs866626825 95 dbSNP
rs1162146400 97 dbSNP
rs7338 99 dbSNP
rs972862478 100 dbSNP
rs770036089 102 dbSNP
rs1181917601 103 dbSNP
rs1289889234 105 dbSNP
rs763110432 105 dbSNP
rs1319754031 106 dbSNP
rs920139333 108 dbSNP
rs766360041 114 dbSNP
rs752751337 115 dbSNP
rs931053289 116 dbSNP
rs760495570 117 dbSNP
rs1049516242 118 dbSNP
rs1228839590 119 dbSNP
rs541887487 120 dbSNP
rs943676563 122 dbSNP
rs1040692575 124 dbSNP
rs745754427 125 dbSNP
rs1267979280 126 dbSNP
rs772164179 127 dbSNP
rs1207249250 131 dbSNP
rs775070189 132 dbSNP
rs1441455330 136 dbSNP
rs1407356313 138 dbSNP
rs1185300523 139 dbSNP
rs1419423016 140 dbSNP
rs1475218771 142 dbSNP
rs753705674 152 dbSNP
rs1394561382 154 dbSNP
rs1361979550 155 dbSNP
rs757075567 156 dbSNP
rs1289196721 157 dbSNP
rs555720428 160 dbSNP
rs749984025 161 dbSNP
rs1311229727 168 dbSNP
rs1357451584 171 dbSNP
rs999434714 173 dbSNP
rs1368319165 177 dbSNP
rs1477954244 179 dbSNP
rs1415470955 182 dbSNP
rs1246842434 183 dbSNP
rs1288335135 183 dbSNP
rs757984304 184 dbSNP
rs371756524 185 dbSNP
rs557159990 185 dbSNP
rs62063261 189 dbSNP
rs540899523 191 dbSNP
rs933748317 192 dbSNP
rs12135 194 dbSNP
rs747601653 201 dbSNP
rs532923262 203 dbSNP
rs1368214264 209 dbSNP
rs576777382 213 dbSNP
rs893664361 215 dbSNP
rs1039340092 223 dbSNP
rs757099846 239 dbSNP
rs3180517 246 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Flp-In T-REx 293-hAGO1 cells
Location of target site CDS
Original Description (Extracted from the article) ... Validation of interactions identified by CLASH suppports their reliability. ...

- Helwak A; Kudla G; Dudnakova T; Tollervey D, 2013, Cell.

Article - Helwak A; Kudla G; Dudnakova T; Tollervey D
- Cell, 2013
MicroRNAs (miRNAs) play key roles in gene regulation, but reliable bioinformatic or experimental identification of their targets remains difficult. To provide an unbiased view of human miRNA targets, we developed a technique for ligation and sequencing of miRNA-target RNA duplexes associated with human AGO1. Here, we report data sets of more than 18,000 high-confidence miRNA-mRNA interactions. The binding of most miRNAs includes the 5' seed region, but around 60% of seed interactions are noncanonical, containing bulged or mismatched nucleotides. Moreover, seed interactions are generally accompanied by specific, nonseed base pairing. 18% of miRNA-mRNA interactions involve the miRNA 3' end, with little evidence for 5' contacts, and some of these were functionally validated. Analyses of miRNA:mRNA base pairing showed that miRNA species systematically differ in their target RNA interactions, and strongly overrepresented motifs were found in the interaction sites of several miRNAs. We speculate that these affect the response of RISC to miRNA-target binding.
LinkOut: [PMID: 23622248]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.664 2.0e-4 -0.684 1.1e-4 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.575 1.3e-3 0.561 1.8e-3 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.58 3.7e-3 -0.547 6.3e-3 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.414 2.0e-2 0.408 2.1e-2 25 Click to see details
GSE19536 Breast cancer 0.144 7.6e-2 0.168 4.7e-2 100 Click to see details
GSE28260 Renal cortex and medulla -0.347 1.2e-1 -0.341 1.3e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.235 1.3e-1 -0.245 1.2e-1 24 Click to see details
GSE19783 ER- ER- breast cancer 0.097 2.0e-1 0.107 1.7e-1 79 Click to see details
GSE42095 Differentiated embryonic stem cells 0.182 2.0e-1 0.309 7.6e-2 23 Click to see details
GSE32688 Pancreatic cancer 0.149 2.1e-1 0.184 1.6e-1 32 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.192 3.1e-1 -0.267 2.4e-1 9 Click to see details
GSE21687 Ependynoma primary tumors 0.048 3.5e-1 0.085 2.5e-1 64 Click to see details
GSE38226 Liver fibrosis -0.086 3.6e-1 -0.039 4.3e-1 21 Click to see details
GSE19350 CNS germ cell tumors 0.039 4.5e-1 0.329 1.5e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer 0.025 4.6e-1 -0.023 4.6e-1 20 Click to see details
GSE21032 Prostate cancer -0.006 4.8e-1 0.076 2.5e-1 83 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA 0.442 0.03 0.391 0.05 18 Click to see details
KIRP -0.28 0.06 -0.141 0.22 32 Click to see details
LUAD -0.32 0.16 -0.182 0.29 12 Click to see details
ESCA -0.243 0.24 -0.373 0.13 11 Click to see details
PRAD 0.081 0.29 0.069 0.32 50 Click to see details
PCPG -0.611 0.29 -0.500 0.33 3 Click to see details
LIHC -0.073 0.31 -0.045 0.38 49 Click to see details
KIRC 0.05 0.34 0.054 0.33 68 Click to see details
PAAD 0.293 0.35 0.200 0.4 4 Click to see details
LUSC -0.038 0.41 -0.140 0.2 38 Click to see details
COAD 0.096 0.41 0.238 0.29 8 Click to see details
CHOL 0.072 0.43 0.033 0.47 9 Click to see details
THCA -0.022 0.43 -0.109 0.21 59 Click to see details
BRCA -0.014 0.45 -0.031 0.39 84 Click to see details
KICH -0.019 0.46 -0.038 0.43 25 Click to see details
UCEC -0.015 0.48 -0.030 0.45 19 Click to see details
STAD -0.01 0.48 -0.113 0.27 32 Click to see details
CESC -0.065 0.48 0.500 0.33 3 Click to see details
HNSC -0.004 0.49 -0.070 0.33 42 Click to see details
HNSC -0.004 0.49 -0.070 0.33 42 Click to see details
HNSC -0.004 0.49 -0.070 0.33 42 Click to see details
412 hsa-miR-744-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT016085 ARL15 ADP ribosylation factor like GTPase 15 1 1
MIRT016086 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 1 2
MIRT016087 PPTC7 PTC7 protein phosphatase homolog 2 3
MIRT016088 RASSF1 Ras association domain family member 1 1 1
MIRT016089 IER5 immediate early response 5 1 1
MIRT037383 UFC1 ubiquitin-fold modifier conjugating enzyme 1 1 1
MIRT037384 STAM2 signal transducing adaptor molecule 2 1 1
MIRT037385 SRRM2 serine/arginine repetitive matrix 2 1 1
MIRT037386 DCXR dicarbonyl and L-xylulose reductase 1 1
MIRT037387 TSPAN17 tetraspanin 17 1 1
MIRT037388 ACTB actin beta 1 1
MIRT037389 HIST1H2BC histone cluster 1 H2B family member c 1 1
MIRT037390 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT037391 VDAC1 voltage dependent anion channel 1 1 1
MIRT037392 RNASEK ribonuclease K 1 1
MIRT037393 CDK16 cyclin dependent kinase 16 1 1
MIRT037394 ZCCHC24 zinc finger CCHC-type containing 24 1 1
MIRT037395 ARRDC2 arrestin domain containing 2 1 1
MIRT037396 SGMS1 sphingomyelin synthase 1 1 1
MIRT037397 HSPD1 heat shock protein family D (Hsp60) member 1 1 1
MIRT037398 MRPL46 mitochondrial ribosomal protein L46 1 1
MIRT037399 RHEB Ras homolog, mTORC1 binding 1 1
MIRT037400 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT037401 TP53I13 tumor protein p53 inducible protein 13 1 1
MIRT037402 CD44 CD44 molecule (Indian blood group) 1 1
MIRT037403 USP12 ubiquitin specific peptidase 12 1 1
MIRT037404 AP2B1 adaptor related protein complex 2 beta 1 subunit 1 1
MIRT037405 RPL18A ribosomal protein L18a 1 1
MIRT037406 PPP1CA protein phosphatase 1 catalytic subunit alpha 1 1
MIRT037407 TNRC6B trinucleotide repeat containing 6B 1 1
MIRT037408 PXK PX domain containing serine/threonine kinase like 1 1
MIRT037409 TDRKH tudor and KH domain containing 1 1
MIRT037410 PRRC2A proline rich coiled-coil 2A 1 1
MIRT037411 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT037412 NDE1 nudE neurodevelopment protein 1 1 1
MIRT037413 STK16 serine/threonine kinase 16 1 1
MIRT037414 PSMB2 proteasome subunit beta 2 1 1
MIRT037415 EPN1 epsin 1 1 1
MIRT037416 EN2 engrailed homeobox 2 1 1
MIRT037417 LARP1 La ribonucleoprotein domain family member 1 1 1
MIRT037418 SRCAP Snf2 related CREBBP activator protein 1 1
MIRT037419 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 1 1
MIRT037420 AP2A2 adaptor related protein complex 2 alpha 2 subunit 1 1
MIRT037421 ACTG1 actin gamma 1 1 1
MIRT037422 PIKFYVE phosphoinositide kinase, FYVE-type zinc finger containing 1 1
MIRT037423 UBE2O ubiquitin conjugating enzyme E2 O 1 1
MIRT037424 KLHL15 kelch like family member 15 1 1
MIRT037425 SECISBP2 SECIS binding protein 2 1 1
MIRT037426 KIAA0922 transmembrane 131 like 1 1
MIRT037427 PTMA prothymosin, alpha 1 1
MIRT037428 WDR45B WD repeat domain 45B 1 1
MIRT037429 ZNF282 zinc finger protein 282 1 1
MIRT037430 GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase 1 1
MIRT037431 TNKS tankyrase 1 1
MIRT037432 NOP2 NOP2 nucleolar protein 1 1
MIRT037433 GAK cyclin G associated kinase 1 1
MIRT037434 ATP6 ATP synthase F0 subunit 6 1 1
MIRT037435 DIDO1 death inducer-obliterator 1 1 1
MIRT037436 RPL3 ribosomal protein L3 1 1
MIRT037437 AIMP2 aminoacyl tRNA synthetase complex interacting multifunctional protein 2 1 1
MIRT037438 PIGC phosphatidylinositol glycan anchor biosynthesis class C 1 1
MIRT037439 ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 1 1
MIRT037440 USP21 ubiquitin specific peptidase 21 1 1
MIRT037441 NUFIP2 NUFIP2, FMR1 interacting protein 2 1 1
MIRT037442 RPS6 ribosomal protein S6 1 1
MIRT037443 ILKAP ILK associated serine/threonine phosphatase 1 1
MIRT037444 COX1 cytochrome c oxidase subunit I 1 1
MIRT037445 VPS37C VPS37C, ESCRT-I subunit 1 1
MIRT037446 CDK12 cyclin dependent kinase 12 1 1
MIRT037447 RBM8A RNA binding motif protein 8A 1 1
MIRT037448 CKB creatine kinase B 1 1
MIRT037449 DHX57 DExH-box helicase 57 1 1
MIRT037450 DDX23 DEAD-box helicase 23 1 1
MIRT037451 ABI3 ABI family member 3 1 1
MIRT037452 GATAD2B GATA zinc finger domain containing 2B 1 1
MIRT037453 PDPK1 3-phosphoinositide dependent protein kinase 1 1 1
MIRT037454 C17orf70 Fanconi anemia core complex associated protein 100 1 1
MIRT037455 SKI SKI proto-oncogene 1 1
MIRT037456 KCTD11 potassium channel tetramerization domain containing 11 1 1
MIRT037457 GNB2L1 receptor for activated C kinase 1 1 1
MIRT037458 NCOA3 nuclear receptor coactivator 3 1 1
MIRT037459 PAK4 p21 (RAC1) activated kinase 4 2 3
MIRT037460 GDI2 GDP dissociation inhibitor 2 1 1
MIRT037461 SLC2A4RG SLC2A4 regulator 1 1
MIRT037462 SLX4 SLX4 structure-specific endonuclease subunit 1 1
MIRT037463 COPA coatomer protein complex subunit alpha 1 1
MIRT037464 GPRASP2 G protein-coupled receptor associated sorting protein 2 1 1
MIRT037465 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 1 1
MIRT037466 LIMS1 LIM zinc finger domain containing 1 1 1
MIRT037467 COTL1 coactosin like F-actin binding protein 1 1 1
MIRT037468 CAPNS1 calpain small subunit 1 1 1
MIRT037469 FRZB frizzled-related protein 1 1
MIRT037470 UBQLN4 ubiquilin 4 1 1
MIRT037471 NUP153 nucleoporin 153 1 1
MIRT037472 TMEM175 transmembrane protein 175 1 1
MIRT037473 HIST1H2BD histone cluster 1 H2B family member d 1 1
MIRT037474 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT037475 BCL2L12 BCL2 like 12 1 1
MIRT037476 HIST2H2AA3 histone cluster 2 H2A family member a3 1 1
MIRT037477 MINK1 misshapen like kinase 1 1 1
MIRT037478 PDXK pyridoxal kinase 1 1
MIRT037479 FAM110A family with sequence similarity 110 member A 1 1
MIRT037480 ZNF598 zinc finger protein 598 1 1
MIRT037481 ILK integrin linked kinase 1 1
MIRT037482 HINT1 histidine triad nucleotide binding protein 1 1 1
MIRT037483 WBP2 WW domain binding protein 2 1 1
MIRT037484 CYTB cytochrome b 1 1
MIRT037485 SCAMP2 secretory carrier membrane protein 2 1 1
MIRT037486 TRIM33 tripartite motif containing 33 1 1
MIRT037487 SLC25A3 solute carrier family 25 member 3 1 1
MIRT037488 IRS4 insulin receptor substrate 4 1 1
MIRT037489 TSR1 TSR1, ribosome maturation factor 1 1
MIRT037490 TCOF1 treacle ribosome biogenesis factor 1 1 1
MIRT037491 ATXN2L ataxin 2 like 1 1
MIRT037492 MTOR mechanistic target of rapamycin kinase 1 1
MIRT037493 ZNF318 zinc finger protein 318 1 1
MIRT037494 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 3
MIRT037495 SAMD4B sterile alpha motif domain containing 4B 1 1
MIRT037496 STMN1 stathmin 1 1 1
MIRT037497 SAT1 spermidine/spermine N1-acetyltransferase 1 1 1
MIRT037498 SALL1 spalt like transcription factor 1 1 1
MIRT037499 ZSCAN18 zinc finger and SCAN domain containing 18 1 1
MIRT037500 SLC35D1 solute carrier family 35 member D1 1 1
MIRT037501 TM9SF3 transmembrane 9 superfamily member 3 1 1
MIRT037502 TIAM1 T-cell lymphoma invasion and metastasis 1 1 1
MIRT037503 CHD5 chromodomain helicase DNA binding protein 5 1 1
MIRT037504 BAG6 BCL2 associated athanogene 6 1 1
MIRT037505 MED28 mediator complex subunit 28 1 1
MIRT037506 ANKRD52 ankyrin repeat domain 52 1 1
MIRT037507 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 1 1
MIRT037508 PPDPF pancreatic progenitor cell differentiation and proliferation factor 1 1
MIRT037509 PRKACA protein kinase cAMP-activated catalytic subunit alpha 1 1
MIRT037510 HPCAL4 hippocalcin like 4 1 1
MIRT037511 ZNF256 zinc finger protein 256 1 1
MIRT037512 CGNL1 cingulin like 1 1 1
MIRT037513 TUBA1B tubulin alpha 1b 1 1
MIRT037514 LNPEP leucyl and cystinyl aminopeptidase 1 1
MIRT037515 PDE4A phosphodiesterase 4A 1 1
MIRT037516 HOXD11 homeobox D11 2 3
MIRT037517 QARS glutaminyl-tRNA synthetase 1 1
MIRT037518 G3BP1 G3BP stress granule assembly factor 1 1 1
MIRT037519 PLEKHM2 pleckstrin homology and RUN domain containing M2 1 1
MIRT037520 POLR2A RNA polymerase II subunit A 1 1
MIRT037521 KIAA1462 junctional cadherin 5 associated 1 1
MIRT037522 SF3A1 splicing factor 3a subunit 1 1 1
MIRT037523 YBX1 Y-box binding protein 1 1 1
MIRT037524 PTGES3 prostaglandin E synthase 3 1 1
MIRT037525 FOXO3 forkhead box O3 1 1
MIRT037526 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 1 1
MIRT037527 AARS alanyl-tRNA synthetase 1 1
MIRT037528 ZNF155 zinc finger protein 155 1 1
MIRT037529 NCS1 neuronal calcium sensor 1 1 1
MIRT037530 FKBP4 FK506 binding protein 4 1 1
MIRT037531 ARHGDIA Rho GDP dissociation inhibitor alpha 1 1
MIRT037532 MAPK7 mitogen-activated protein kinase 7 1 1
MIRT037533 AGPAT2 1-acylglycerol-3-phosphate O-acyltransferase 2 1 1
MIRT037534 HIST1H1E histone cluster 1 H1 family member e 1 1
MIRT037535 MLF2 myeloid leukemia factor 2 1 1
MIRT037536 EDC3 enhancer of mRNA decapping 3 1 1
MIRT037537 CHRAC1 chromatin accessibility complex 1 1 1
MIRT037538 WIPF3 WAS/WASL interacting protein family member 3 1 1
MIRT037539 COX2 cytochrome c oxidase subunit II 1 1
MIRT037540 SRSF1 serine and arginine rich splicing factor 1 1 1
MIRT037541 CTNNBIP1 catenin beta interacting protein 1 1 1
MIRT037542 RPL4 ribosomal protein L4 1 1
MIRT037543 COX3 cytochrome c oxidase III 1 1
MIRT037544 DDX54 DEAD-box helicase 54 1 1
MIRT037545 TOB2 transducer of ERBB2, 2 1 1
MIRT037546 MAN2C1 mannosidase alpha class 2C member 1 1 1
MIRT037547 SMCR7L mitochondrial elongation factor 1 1 1
MIRT037548 RPLP1 ribosomal protein lateral stalk subunit P1 1 1
MIRT037549 RAN RAN, member RAS oncogene family 1 1
MIRT037550 NONO non-POU domain containing octamer binding 1 1
MIRT037551